Search Results

Search found 9273 results on 371 pages for 'complex strings'.

Page 44/371 | < Previous Page | 40 41 42 43 44 45 46 47 48 49 50 51  | Next Page >

  • Perl's use encoding pragma breaking UTF strings

    - by Karel Bílek
    I have a problem with Perl and Encoding pragma. (I use utf-8 everywhere, in input, output, the perl scripts themselves. I don't want to use other encoding, never ever.) However. When I write binmode(STDOUT, ':utf8'); use utf8; $r = "\x{ed}"; print $r; I see the string "í" (which is what I want - and what is 00+ED unicode char). But when I add the "use encoding" pragma like this binmode(STDOUT, ':utf8'); use utf8; use encoding 'utf8'; $r = "\x{ed}"; print $r; all I see is a box character. Why? Moreover, when I add Data::Dumper and let the Dumper print the new string like this binmode(STDOUT, ':utf8'); use utf8; use encoding 'utf8'; $r = "\x{ed}"; use Data::Dumper; print Dumper($r); I see that perl changed the string to "\x{fffd}". Why?

    Read the article

  • How do i change this method to get strings instead of ints

    - by David
    here is the original code: public static int getInt () { Scanner in = new Scanner (System.in) ; if (in.hasNextInt()) { int a = in.nextInt() ; return a ; } else { System.out.println ("try again:") ; return getInt () ; } } This checks and sees if the input it receives is an int. If it is then it returns the int, if not it tells you to try again and re-runs. This is what i tried to do to change it: public static String getIns () { Scanner in = new Scanner (System.in) ; if (in.hasNextString()) { String a = in.nextString() ; return a ; } else { System.out.println ("try again:") ; return getIns () ; } } This doesn't work though. I looked through the documentation for the scanner class and i think the problem is that there is no such method as in.hasNextString or in.nextString What methods from the scanner class can i use to do what i intend these to do?

    Read the article

  • SQL Server T-SQL statement to replace/delete sub-strings

    - by StefanE
    Hi, I have a table with 6 columns containing HTML content with some markups in it and now when moving to a new designed site most of this HTML code has to be deleted. More or less all tags except <B> and </B>. Is there a nice way of doing this, identify all tags end delete them within the data? I'm sure there are no < symbols in the test so a regular expression would maybe work? My alternative is to fetch every row, process it and update the database but I'm guessing this is possible to do in T-SQL directly. My server is an MSSQL 2008 and is located in a hosted environment but I can fetch a local copy if needed. Thanks, Stefan

    Read the article

  • Return highest number found in an array of strings

    - by Mdd
    I have an array of objects. The objects have a property called level that is a string which contains a number and is in consistent format. I am trying to find the highest number and return just that one but I seem to be blocked as far as how to proceed from my current code. Here is a fiddle to my current code: http://jsfiddle.net/6sXYR/ Here is my JavaScript: var myArray = [ { color: 'blue', level: 'L1' }, { color: 'red', level: 'L1' }, { color: 'green', level: 'L2' }, { color: 'yellow', level: 'L2' }, { color: 'purple', level: 'L3' } ]; for (var i = 0; i < myArray.length; i++) { console.log( myArray[i].level.substring(1,2) ); }; The result I am trying to get is to return just the number '3' from the example above. The highest number may not always be in the last object in the array, but it will always be in the format of L#.

    Read the article

  • Escape apostrophes inside double quoted strings (Javascript)

    - by George Sheppard
    Say i have a string that i need to evaluate in javascript such as : window.some_class.update( 'Runner', 'update_runner', '{"runner":{"id":"1","name":"Nin's Lad" } }'); In order for eval() to evaluate it, i need to escape the apostrophe in runner_name (Nin's Lad). Is this possable with regex? I dont want to escape the single quotes around Runner and update_runner. I'd just like to escape any single quotes inside double quotes. Thanks,

    Read the article

  • List available languages for PyGTK UI strings

    - by detly
    I'm cleaning up some localisation and translation settings in our PyGTK application. The app is only intended to be used under GNU/Linux systems. One of the features we want is for users to select the language used for the applications (some prefer their native language, some prefer English for consistency, some like French because it sounds romantic, etc). For this to work, I need to actually show a combo box with the various languages available. How can I get this list? In fact, I need a list of pairs of the language code ("en", "ru", etc) and the language name in the native language ("English (US)", "???????"). If I had to implement a brute force method, I'd do something like: look in the system locale dir (eg. "/usr/share/locale") for all language code dirs (eg. "en/") containing the relative path "LC_MESSAGES/OurAppName.mo". Is there a more programmatic way?

    Read the article

  • Match HTML tags in two strings using regex in Python

    - by jack
    I want to verify that the HTML tags present in a source string are also present in a target string. For example: >> source = '<em>Hello</em><label>What's your name</label>' >> verify_target(’<em>Hi</em><label>My name is Jim</label>') True >> verify_target('<label>My name is Jim</label><em>Hi</em>') True >> verify_target('<em>Hi<label>My name is Jim</label></em>') False

    Read the article

  • Ruby on rails - how to retrieve connection strings

    - by Jett
    Hi Everyone, Are there any ways to retrieve the database connection string where my ruby is connected? what i would like to get is the: 1) Database name where the ruby is connected 2) The username of the SQL Server 3) Password of the SQL Server 4) Server name I want to store it in session variables. (I'am using MS SQL Server.) Please help! thanks!

    Read the article

  • DB4o Linq query - How to check for null strings

    - by Dave
    Hey there - simple query: var q = (from SomeObject o in container where o.SomeInt > 8 && o.SomeString != null //Null Ref here select o; I always get a null reference exception. If I use String.IsNullOrEmpty(o.SomeString) the query takes about 100 times as long, as if I use && o.SomeString != "" (which is way faster, but obviously not correct). I'm guessing because DB4o needs to activate the objects, in order to pass them in to the IsNullOrEmpty call, and can't use the indexes. My question is, what's a better way to check for nulls in this situation? Is there something like: mystring != Db4o.DBNull.Value, or something? Cheers, Dave

    Read the article

  • PHP: Condense array of similar strings into one merged array

    - by Matt Andrews
    Hi everyone. Working with an array of dates (opening times for a business). I want to condense them to their briefest possible form. So far, I started out with this structure Array ( [Mon] => 12noon-2:45pm, 5:30pm-10:30pm [Tue] => 12noon-2:45pm, 5:30pm-10:30pm [Wed] => 12noon-2:45pm, 5:30pm-10:30pm [Thu] => 12noon-2:45pm, 5:30pm-10:30pm [Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) What I want to achieve is this: Array ( [Mon-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) I've tried writing a recursive function and have managed to output this so far: Array ( [Mon-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Tue-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Wed-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Thu-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) Can anybody see a simple way of comparing the values and combining the keys where they're similar? My recursive function is basically two nested foreach() loops - not very elegant. Thanks, Matt EDIT: Here's my code so far, which produces the 3rd array above (from the first one as input): $last_time = array('t' => '', 'd' => ''); // blank array for looping $i = 0; foreach($final_times as $day=>$time) { if($last_time['t'] != $time ) { // it's a new time if($i != 0) { $print_times[] = $day . ' ' . $time; } // only print if it's not the first, otherwise we get two mondays } else { // this day has the same time as last time $end_day = $day; foreach($final_times as $day2=>$time2) { if($time == $time2) { $end_day = $day2; } } $print_times[] = $last_time['d'] . '-' . $end_day . ' ' . $time; } $last_time = array('t' => $time, 'd' => $day); $i++; }

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Django approximate matching of unicode strings with ascii equivalents

    - by c
    I have the following model and instance: class Bashable(models.Model): name = models.CharField(max_length=100) >>> foo = Bashable.objects.create(name=u"piñata") Now I want to be able to search for objects, but using ascii characters rather than unicode, something like this: >>> Bashable.objects.filter(name__lookslike="pinata") Is there a way in Django to do this sort of approximate string matching, using ascii stand-ins for the unicode characters in the database? Here is a related question, but for Apple's Core Data.

    Read the article

  • Where can I learn about JNDI strings?

    - by ferrari fan
    How do you know how to form a JNDI string? I know there must be a format and that the divisions must mean something but I haven't been able to find a good resource that explains them. For example: java:comp/env/wm/default. This is supposed to connect to a WorkManager in Websphere with the name of default. But what does the "java", "comp", "env" mean? I know what the wm/default mean because that's the JNDI name put in the WorkManager, but what does the rest mean? Thanks

    Read the article

  • how to split strings and bind them as header for gridview

    - by prince23
    hi i have an string List rows = new List(); now rows has an data like this countryname~population india~12,211 china~23,22,223 usa~45,454 japan~34,343,232 now i need to bind this data in gridview like countryname and population as header for gridview countryname population india 12,211 china 2322223 usa 45454 japan 34343232 any help would be great thank you

    Read the article

  • Strings exported from a module have extra line breaks

    - by Jesse Millikan
    In a DrScheme project, I'm using a MrEd editor-canvas% with text% and inserting a string from a literal in a Scheme file. This results in an extra blank line in the editor for each line of text I'm trying to insert. I've tracked this down to the apparent fact that string literals from outside modules are getting extra line breaks. Here's a full example. The editor is irrelevant at this point, but it displays the result. ; test-literals.ss (module test-literals scheme (provide (all-defined-out)) (define exported-string "From another module with some more line breaks. ")) ; editor-test.ss (module editor-test scheme (require mred "test-literals.ss") (define w (instantiate frame% ("Editor Test" #f) )) (define c (instantiate editor-canvas% (w) (line-count 12) (min-width 400))) (define editor (instantiate text% ())) (send c set-editor editor) (send w show #t) (send editor erase) (send editor insert "Some text with some line breaks. ") (send editor insert exported-string)) And the result in the editor is Some text with some line breaks. From another module with some more line breaks.

    Read the article

  • WatiN Testing and Connection Strings Fiasco

    - by azamsharp
    I have a separate project which performs watiN tests. The project is in the form of class library project. When I run test it launches the browser and then uses the Web.config of the Web Application Project which I am testing. The Web.config of web application project has the Dev connection string which should not be used for testing. What are different ways that I can take and tell my WatiN to use the App.config that is inside the WatiN project and not the Web application project? Here are couple of options that I have: 1) Replace the connection string at runtime. 2) Replace the connection string at pre-build event or something.

    Read the article

  • MS-SQL statement to replace/delete sub-strings

    - by StefanE
    Hi, I have a table with 6 columns containing HTML content with some markups in it and now when moving to a new designed site most of this HTML code has to be deleted. More or less all tags except and . Is there a nice way of doing this, identify all tags end delete them within the data? I'm sure there are no < symbols in the test so a regular expression would maybe work? My alternative is to fecth every row, process it and update the database but I'm guessing this is possible to do in SQL directly. Thanks, Stefan

    Read the article

  • How to loop an array with strings as indexes in PHP

    - by Axel Lambregts
    I had to make an array with as indexes A-Z (the alphabet). Each index had to have a value 0. So i made this array: $alfabet = array( 'A' => 0, 'B' => 0, 'C' => 0, 'D' => 0, 'E' => 0, 'F' => 0, 'G' => 0, 'H' => 0, 'I' => 0, 'J' => 0, 'K' => 0, 'L' => 0, 'M' => 0, 'N' => 0, 'O' => 0, 'P' => 0, 'Q' => 0, 'R' => 0, 'S' => 0, 'T' => 0, 'U' => 0, 'V' => 0, 'W' => 0, 'X' => 0, 'Y' => 0, 'Z' => 0 ); I also have got text from a file ($text = file_get_contents('tekst15.txt');) I have putted the chars in that file to an array: $textChars = str_split ($text); and sorted it from A-Z: sort($textChars); What i want is that (with a for loop) when he finds an A in the textChars array, the value of the other array with index A, goes up by one (so like: $alfabet[A]++; Can anyone help me with this loop? I have this atm: for($i = 0; $i <= count($textChars); $i++){ while($textChars[$i] == $alfabet[A]){ $alfabet[A]++; } } echo $alfabet[A]; Problem 1: i want to loop the alfabet array to, so now i only check for A but i want to check all indexes. Problem2: this now returns 7 for each alphabet index i try so its totally wrong :) I'm sorry about my english but thanks for your time.

    Read the article

  • Scrubyt: Using big5 strings in query_field for fill_textfield

    - by kuribo
    Does anyone know of a way to get fill_textfield to accept a big5-encoded string in the query_field? I keep getting an "unterminated string meets end of file" error with this: require 'rubygems' require 'scrubyt' search_data = Scrubyt::Extractor.define do fetch 'http://www.google.com/ncr' fill_textfield 'q', '????' submit end

    Read the article

  • Interning strings in Java

    - by Tiny
    The following segment of code interns a string. String str1="my"; String str2="string"; String concat1=str1+str2; concat1.intern(); System.out.println(concat1=="mystring"); The expression concat1=="mystring" returns true because concat1 has been interned. If the given string mystring is changed to string as shown in the following snippet. String str11="str"; String str12="ing"; String concat11=str11+str12; concat11.intern(); System.out.println(concat11=="string"); The comparison expression concat11=="string" returns false. The string held by concat11 doesn't seem to be interned. What am I overlooking here? I have tested on Java 7, update 11.

    Read the article

  • Error in merging two sequences of timestamps to yield strings

    - by AruniRC
    The code sorts two input sequences - seq01 and seq02 - on the basis of their timestamp values and returns a sequence that denotes which sequence is to be read for the values to be in order. For cases where seq02's timestamp value is lesser than seq01's timestamp value we yield a "2" to the sequence being returned, else a "1". These denote whether at that point seq01 is to be taken or seq02 is to be taken for the data to be in order (by timestamp value). let mergeSeq (seq01:seq<_>) (seq02:seq<_>) = seq { use iter01 = seq01.GetEnumerator() use iter02 = seq02.GetEnumerator() while iter01.MoveNext() do let _,_,time01 = iter01.Current let _,_,time02 = iter02.Current while time02 < time01 && iter02.MoveNext() do yield "2" yield "1" } To test it in the FSI created two sequences a and b, a={1;3;5;...} and b={0;2;4;...}. So the expected values for let c = mergeSeq a b would have been {"2","1","2","1"...}. However I am getting this error: error FS0001: The type ''a * 'b * 'c' does not match the type 'int' EDIT After correcting: let mergeSeq (seq01:seq<_>) (seq02:seq<_>) = seq { use iter01 = seq01.GetEnumerator() use iter02 = seq02.GetEnumerator() while iter01.MoveNext() do let time01 = iter01.Current let time02 = iter02.Current while time02 < time01 && iter02.MoveNext() do yield "2" yield "1" } After running this, there's another error: call MoveNext. Somehow the iteration is not being performed.

    Read the article

  • Problem with parsing strings

    - by Peter Small
    I am trying to put a line of dialog on each of a series of images. To match the dialog line with the correct image, I end each line with a forward slash (/) followed by a number to identify the matching image. I then parse each line to get the dialog and then the reference number for the image. It all works fine except that when I put the dialog line into a textView I get the whole line in the textView instead of the dialog part. What is confusing is that the console seems to indicate that the parsing of the dialog line has been carried out correctly. Here are the details of my coding: @interface DialogSequence_1ViewController : UIViewController { IBOutlet UIImageView *theImage; IBOutlet UITextView *fullDialog; IBOutlet UITextView *selectedDialog; IBOutlet UIButton *test_1; IBOutlet UIButton *test_2; IBOutlet UIButton *test_3; NSArray *arrayLines; IBOutlet UISlider *readingSpeed; NSArray *cartoonViews; NSMutableString *dialog; NSMutableArray *dialogLineSections; int lNum; } @property (retain,nonatomic) UITextView *fullDialog; @property (retain,nonatomic) UITextView *selectedDialog; @property (retain,nonatomic) UIButton *test_1; @property (retain,nonatomic) UIButton *test_2; @property (retain,nonatomic) UIButton *test_3; @property (retain,nonatomic) NSArray *arrayLines; @property (retain,nonatomic) NSMutableString *dialog; @property (retain,nonatomic) NSMutableArray *dialogLineSections; @property (retain,nonatomic) UIImageView *theImage; @property (retain,nonatomic) UISlider *readingSpeed; -(IBAction)start:(id)sender; -(IBAction)counter:(id)sender; -(IBAction)runNextLine:(id)sender; @end @implementation DialogSequence_1ViewController @synthesize fullDialog; @synthesize selectedDialog; @synthesize test_1; @synthesize test_2; @synthesize test_3; @synthesize arrayLines; @synthesize dialog; @synthesize theImage; @synthesize readingSpeed; @synthesize dialogLineSections; -(IBAction)runNextLine:(id)sender{ //Get dialog line to display from the arrayLines array NSMutableString *dialogLineDetails; dialogLineDetails =[arrayLines objectAtIndex:lNum]; NSLog(@"dialogLineDetails = %@",dialogLineDetails); //Parse the dialog line dialogLineSections = [dialogLineDetails componentsSeparatedByString: @"/"]; selectedDialog.text =[dialogLineSections objectAtIndex: 0]; NSLog(@"Dialog part of line = %@",[dialogLineSections objectAtIndex: 0]); NSMutableString *imageBit; imageBit = [dialogLineSections objectAtIndex: 1]; NSLog(@"Image code = %@",imageBit); //Select right image int im = [imageBit intValue]; NSLog(@"imageChoiceInteger = %i",im); //------more code } I get a warning on the line: dialogLineSections = [dialogLineDetails componentsSeparatedByString: @"/"]; warning: incompatible Objective-C types assigning 'struct NSArray *', expected 'struct NSMutableArray *' I don't quite understand this and have tried to change the types but to no avail. Would be grateful for some advice here.

    Read the article

< Previous Page | 40 41 42 43 44 45 46 47 48 49 50 51  | Next Page >