Search Results

Search found 18695 results on 748 pages for 'query manipulation'.

Page 445/748 | < Previous Page | 441 442 443 444 445 446 447 448 449 450 451 452  | Next Page >

  • Adjust static value into dynamic (javascript) value possible in Sharepoint allitems.aspx page?

    - by lerac
    <SharePoint:SPDataSource runat="server" IncludeHidden="true" SelectCommand="&lt;View&gt;&lt;Query&gt;&lt;OrderBy&gt;&lt;FieldRef Name=&quot;EventDate&quot;/&gt;&lt;/OrderBy&gt;&lt;Where&gt;&lt;Contains&gt;&lt;FieldRef Name=&quot;lawyer_x0020_1&quot;/&gt;&lt;Value Type=&quot;Note&quot;&gt;F. Sanches&lt;/Value&gt;&lt;/Contains&gt;&lt;/Where&gt;&lt;/Query&gt;&lt;/View&gt;" id="datasource1" DataSourceMode="List" UseInternalName="true"><InsertParameters><asp:Parameter DefaultValue="{ANUMBER}" Name="ListID"></asp:Parameter> This codeline is just one line of the allitems.aspx of a sharepoint list item. It only displays items where lawyer 1 = F. Sanches. Before I start messing around with the .ASPX page I wonder if it possible to change F. Sanches (in the code) into a dynamical variable (from a javascript value or something else that can be used to place the javascript value in there dynamically). If I put any javascript code in the line it will not work. P.S. Ignore ANUMBER part in code. Let say to make it simple I have javascript variable like this (now static but with my other code it is dynamic). It would be an achievement if it would place a static javascript variable. <SCRIPT type=text/javascript>javaVAR = "P. Janssen";</script> If Yes -- how? If No -- Thank you!

    Read the article

  • Remove redundant SQL code

    - by Dave Jarvis
    Code The following code calculates the slope and intercept for a linear regression against a slathering of data. It then applies the equation y = mx + b against the same result set to calculate the value of the regression line for each row. Can the two separate sub-selects be joined so that the data and its slope/intercept are calculated without executing the data gathering part of the query twice? SELECT AVG(D.AMOUNT) as AMOUNT, Y.YEAR * ymxb.SLOPE + ymxb.INTERCEPT as REGRESSION_LINE, Y.YEAR as YEAR, MAKEDATE(Y.YEAR,1) as AMOUNT_DATE FROM CITY C, STATION S, YEAR_REF Y, MONTH_REF M, DAILY D, (SELECT ((avg(t.AMOUNT * t.YEAR)) - avg(t.AMOUNT) * avg(t.YEAR)) / (stddev( t.AMOUNT ) * stddev( t.YEAR )) as CORRELATION, ((sum(t.YEAR) * sum(t.AMOUNT)) - (count(1) * sum(t.YEAR * t.AMOUNT))) / (power(sum(t.YEAR), 2) - count(1) * sum(power(t.YEAR, 2))) as SLOPE, ((sum( t.YEAR ) * sum( t.YEAR * t.AMOUNT )) - (sum( t.AMOUNT ) * sum(power(t.YEAR, 2)))) / (power(sum(t.YEAR), 2) - count(1) * sum(power(t.YEAR, 2))) as INTERCEPT FROM ( SELECT AVG(D.AMOUNT) as AMOUNT, Y.YEAR as YEAR, MAKEDATE(Y.YEAR,1) as AMOUNT_DATE FROM CITY C, STATION S, YEAR_REF Y, MONTH_REF M, DAILY D WHERE $X{ IN, C.ID, CityCode } AND SQRT( POW( C.LATITUDE - S.LATITUDE, 2 ) + POW( C.LONGITUDE - S.LONGITUDE, 2 ) ) < $P{Radius} AND S.STATION_DISTRICT_ID = Y.STATION_DISTRICT_ID AND Y.YEAR BETWEEN 1900 AND 2009 AND M.YEAR_REF_ID = Y.ID AND M.CATEGORY_ID = $P{CategoryCode} AND M.ID = D.MONTH_REF_ID AND D.DAILY_FLAG_ID <> 'M' GROUP BY Y.YEAR ) t ) ymxb WHERE $X{ IN, C.ID, CityCode } AND SQRT( POW( C.LATITUDE - S.LATITUDE, 2 ) + POW( C.LONGITUDE - S.LONGITUDE, 2 ) ) < $P{Radius} AND S.STATION_DISTRICT_ID = Y.STATION_DISTRICT_ID AND Y.YEAR BETWEEN 1900 AND 2009 AND M.YEAR_REF_ID = Y.ID AND M.CATEGORY_ID = $P{CategoryCode} AND M.ID = D.MONTH_REF_ID AND D.DAILY_FLAG_ID <> 'M' GROUP BY Y.YEAR Question How do I execute the duplicate bits only once per query, instead of twice? The duplicate bit is the WHERE clause: $X{ IN, C.ID, CityCode } AND SQRT( POW( C.LATITUDE - S.LATITUDE, 2 ) + POW( C.LONGITUDE - S.LONGITUDE, 2 ) ) < $P{Radius} AND S.STATION_DISTRICT_ID = Y.STATION_DISTRICT_ID AND Y.YEAR BETWEEN 1900 AND 2009 AND M.YEAR_REF_ID = Y.ID AND M.CATEGORY_ID = $P{CategoryCode} AND M.ID = D.MONTH_REF_ID AND D.DAILY_FLAG_ID <> 'M' Related http://stackoverflow.com/questions/1595659/how-to-eliminate-duplicate-calculation-in-sql Thank you!

    Read the article

  • Greasemonkey script not executed when unusual content loading is being used

    - by Sam Brightman
    I'm trying to write a Greasemonkey script for Facebook and having some trouble with the funky page/content loading that they do (I don't quite understand this - a lot of the links are actually just changing the GET, but I think they do some kind of server redirect to make the URL look the same to the browser too?). Essentially the only test required is putting a GM_log() on its own in the script. If you click around Facebook, even with facebook.com/* as the pattern, it is often not executed. Is there anything I can do, or is the idea of a "page load" fixed in Greasemonkey, and FB is "tricking" it into not running by using a single URL? If I try to do some basic content manipulation like this: GM.log("starting"); var GM_FB=new Object; GM_FB.birthdays = document.evaluate("//div[@class='UIUpcoming_Item']", document, null, XPathResult.UNORDERED_NODE_SNAPSHOT_TYPE, null); for (i = GM_FB.birthdays.snapshotLength - 1; i >= 0; i--) { if (GM_FB.birthdayRegex.test(GM_FB.birthdays.snapshotItem(i).innerHTML)) { GM_FB.birthdays.snapshotItem(i).setAttribute('style','font-weight: bold; background: #fffe88'); } } The result is that sometimes only a manual page refresh will make it work. Pulling up the Firebug console and forcing the code to run works fine. Note that this isn't due to late loading of certain parts of the DOM: I have adding some code later to wait for the relevant elements and, crucially, the message never gets logged for certain transitions. For example, when I switch from Messages to News Feed and back.

    Read the article

  • Beginner Question: For extract a large subset of a table from MySQL, how does Indexing, order of tab

    - by chongman
    Sorry if this is too simple, but thanks in advance for helping. This is for MySQL but might be relevant for other RDMBSs tblA has 4 columns: colA, colB, colC, mydata, A_id It has about 10^9 records, with 10^3 distinct values for colA, colB, colC. tblB has 3 columns: colA, colB, B_id It has about 10^4 records. I want all the records from tblA (except the A_id) that have a match in tblB. In other words, I want to use tblB to describe the subset that I want to extract and then extract those records from tblA. Namely: SELECT a.colA, a.colB, a.colC, a.mydata FROM tblA as a INNER JOIN tblB as b ON a.colA=b.colA a.colB=b.colB ; It's taking a really long time (more than an hour) on a newish computer (4GB, Core2Quad, ubuntu), and I just want to check my understanding of the following optimization steps. ** Suppose this is the only query I will ever run on these tables. So ignore the need to run other queries. Now my questions: 1) What indexes should I create to optimize this query? I think I just need a multiple index on (colA, colB) for both tables. I don't think I need separate indexes for colA and colB. Another stack overflow article (that I can't find) mentioned that when adding new indexes, it is slower when there are existing indexes, so that might be a reason to use the multiple index. 2) Is INNER JOIN correct? I just want results where a match is found. 3) Is it faster if I join (tblA to tblB) or the other way around, (tblB to tblA)? This previous answer says that the optimizer should take care of that. 4) Does the order of the part after ON matter? This previous answer say that the optimizer also takes care of the execution order.

    Read the article

  • populate checkboxes with database.

    - by amby
    Hi, I have to poulate checkboxes with data coming from database but no checkbox is showing on my page. please give me correct way to do that. in C# file page_load method i m doing this: public partial class dbTest1 : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { string Server = "al2222"; string Username = "hshshshsh"; string Password = "sjjssjs"; string Database = "database1"; string ConnectionString = "Data Source=" + Server + ";"; ConnectionString += "User ID=" + Username + ";"; ConnectionString += "Password=" + Password + ";"; ConnectionString += "Initial Catalog=" + Database; string query = "Select * from Customer_Order where orderNumber = 17"; using (SqlConnection conn = new SqlConnection(ConnectionString)) { using (SqlCommand cmd = new SqlCommand(query, conn)) { conn.Open(); SqlDataReader dr = cmd.ExecuteReader(); while (dr.Read()) { if (!IsPostBack) { Interests.DataSource = dr; Interests.DataTextField = "OptionName"; Interests.DataValueField = "OptionName"; Interests.DataBind(); } } conn.Close(); conn.Dispose(); } } } } and in .aspx using this: <asp:CheckBoxList ID="Interests" runat="server"></asp:CheckBoxList> please tell me correct way to do that.

    Read the article

  • What is happening in this T-SQL code? (Concatenting the results of a SELECT statement)

    - by Ben McCormack
    I'm just starting to learn T-SQL and could use some help in understanding what's going on in a particular block of code. I modified some code in an answer I received in a previous question, and here is the code in question: DECLARE @column_list AS varchar(max) SELECT @column_list = COALESCE(@column_list, ',') + 'SUM(Case When Sku2=' + CONVERT(varchar, Sku2) + ' Then Quantity Else 0 End) As [' + CONVERT(varchar, Sku2) + ' - ' + Convert(varchar,Description) +'],' FROM OrderDetailDeliveryReview Inner Join InvMast on SKU2 = SKU and LocationTypeID=4 GROUP BY Sku2 , Description ORDER BY Sku2 Set @column_list = Left(@column_list,Len(@column_list)-1) Select @column_list ---------------------------------------- 1 row is returned: ,SUM(Case When Sku2=157 Then Quantity Else 0 End) As [157 -..., SUM(Case ... The T-SQL code does exactly what I want, which is to make a single result based on the results of a query, which will then be used in another query. However, I can't figure out how the SELECT @column_list =... statement is putting multiple values into a single string of characters by being inside a SELECT statement. Without the assignment to @column_list, the SELECT statement would simply return multiple rows. How is it that by having the variable within the SELECT statement that the results get "flattened" down into one value? How should I read this T-SQL to properly understand what's going on?

    Read the article

  • php paging and the use of limit clause

    - by Average Joe
    Imagine you got a 1m record table and you want to limit the search results down to say 10,000 and not more than that. So what do I use for that? Well, the answer is use the limit clause. example select recid from mytable order by recid asc limit 10000 This is going to give me the last 10,000 records entered into this table. So far no paging. But the limit phrase is already in use. That brings to question to the next level. What if I want to page thru this record particular record set 100 recs at a time? Since the limit phrase is already part of the original query, how do I use it again, this time to take care of the paging? If the org. query did not have a limit clause to begin with, I'd adjust it as limit 0,100 and then adjusting it as 100,100 and then 200,100 and so on while the paging takes it course. But at this time, I cannot. You almost think you'd want to use two limit phrases one after the other - which is not not gonna work. limit 10000 limit 0,1000 for sure it would error out. So what's the solution in this particular case?

    Read the article

  • Getting the ranking of a photo in SQL

    - by Jake Petroules
    I have the following tables: Photos [ PhotoID, CategoryID, ... ] PK [ PhotoID ] Categories [ CategoryID, ... ] PK [ CategoryID ] Votes [ PhotoID, UserID, ... ] PK [ PhotoID, UserID ] A photo belongs to one category. A category may contain many photos. A user may vote once on any photo. A photo can be voted for by many users. I want to select the ranks of a photo (by counting how many votes it has) both overall and within the scope of the category that photo belongs to. The count of SELECT * FROM Votes WHERE PhotoID = @PhotoID being the number of votes a photo has. I want the resulting table to have generated columns for overall rank, and rank within category, so that I may order the results by either. So for example, the resulting table from the query should look like: PhotoID VoteCount RankOverall RankInCategory 1 48 1 7 3 45 2 5 19 33 3 1 2 17 4 3 7 9 5 5 ... ...you get the idea. How can I achieve this? So far I've got the following query to retrieve the vote counts, but I need to generate the ranks as well: SELECT PhotoID, UserID, CategoryID, DateUploaded, (SELECT COUNT(CommentID) AS Expr1 FROM dbo.Comments WHERE (PhotoID = dbo.Photos.PhotoID)) AS CommentCount, (SELECT COUNT(PhotoID) AS Expr1 FROM dbo.PhotoVotes WHERE (PhotoID = dbo.Photos.PhotoID)) AS VoteCount, Comments FROM dbo.Photos

    Read the article

  • IIS URL Rewriting: How can I reliably keep relative paths when serving multiple files?

    - by NVRAM
    My WebApp is part CMS, and when I serve up an HTML page to the user it typically contains relative paths in a.href and img.src attributes. I currently have them accessed by urls like: ~/get-data.aspx/instance/user/page.html -- where instance indicates the particular instance for the report and "user/page.html" is a path created by an external application that generates the content. This works pretty reliably with code in the application's BeginRequest method that translates the text after ".aspx" into a query string, then uses Context.RewritePath(). So far so good, but I've just tripped over something that took me by surprise: it appears that if any of the query string ("instance/user/page.html") happens to contain a plus sign ("+") the BeginRequest method is never called, and a 404 is immediately returned to the user. So my question is two-fold: Am I correct in my belief that a "+" would cause the 404, and if so are there other things that could cause similar problems? Is there a way around that problem (perhaps a different method than BeginRequest)? Is there a better way to preserve relative URL paths for generated content than what I'm using? I'd rather not require site admins to install a 3rd party rewrite tool if I can help it.

    Read the article

  • Performance of VIEW vs. SQL statement

    - by Matt W.
    I have a query that goes something like the following: select <field list> from <table list> where <join conditions> and <condition list> and PrimaryKey in (select PrimaryKey from <table list> where <join list> and <condition list>) and PrimaryKey not in (select PrimaryKey from <table list> where <join list> and <condition list>) The sub-select queries both have multiple sub-select queries of their own that I'm not showing so as not to clutter the statement. One of the developers on my team thinks a view would be better. I disagree in that the SQL statement uses variables passed in by the program (based on the user's login Id). Are there any hard and fast rules on when a view should be used vs. using a SQL statement? What kind of performance gain issues are there in running SQL statements on their own against regular tables vs. against views. (Note that all the joins / where conditions are against indexed columns, so that shouldn't be an issue.) EDIT for clarification... Here's the query I'm working with: select obj_id from object where obj_id in( (select distinct(sec_id) from security where sec_type_id = 494 and ( (sec_usergroup_id = 3278 and sec_usergroup_type_id = 230) or (sec_usergroup_id in (select ug_gi_id from user_group where ug_ui_id = 3278) and sec_usergroup_type_id = 231) ) and sec_obj_id in ( select obj_id from object where obj_ot_id in (select of_ot_id from obj_form left outer join obj_type on ot_id = of_ot_id where ot_app_id = 87 and of_id in (select sec_obj_id from security where sec_type_id = 493 and ( (sec_usergroup_id = 3278 and sec_usergroup_type_id = 230) or (sec_usergroup_id in (select ug_gi_id from user_group where ug_ui_id = 3278) and sec_usergroup_type_id = 231) ) ) and of_usage_type_id = 131 ) ) ) ) or (obj_ot_id in (select of_ot_id from obj_form left outer join obj_type on ot_id = of_ot_id where ot_app_id = 87 and of_id in (select sec_obj_id from security where sec_type_id = 493 and ( (sec_usergroup_id = 3278 and sec_usergroup_type_id = 230) or (sec_usergroup_id in (select ug_gi_id from user_group where ug_ui_id = 3278) and sec_usergroup_type_id = 231) ) ) and of_usage_type_id = 131 ) and obj_id not in (select sec_obj_id from security where sec_type_id = 494) )

    Read the article

  • Multiple inequality conditions (range queries) in NoSQL

    - by pableu
    Hi, I have an application where I'd like to use a NoSQL database, but I still want to do range queries over two different properties, for example select all entries between times T1 and T2 where the noiselevel is smaller than X. On the other hand, I would like to use a NoSQL/Key-Value store because my data is very sparse and diverse, and I do not want to create new tables for every new datatype that I might come across. I know that you cannot use multiple inequality filters for the Google Datastore (source). I also know that this feature is coming (according to this). I know that this is also not possible in CouchDB (source). I think I also more or less understand why this is the case. Now, this makes me wonder.. Is that the case with all NoSQL databases? Can other NoSQL systems make range queries over two different properties? How about, for example, Mongo DB? I've looked in the Documentation, but the only thing I've found was the following snippet in their docu: Note that any of the operators on this page can be combined in the same query document. For example, to find all document where j is not equal to 3 and k is greater than 10, you'd query like so: db.things.find({j: {$ne: 3}, k: {$gt: 10} }); So they use greater-than and not-equal on two different properties. They don't say anything about two inequalities ;-) Any input and enlightenment is welcome :-)

    Read the article

  • How to handle image/gif type response on client side using GWT

    - by user200340
    Hi all, I have a question about how to handle image/gif type response on client side, any suggestion will be great. There is a service which responds for retrieving image (only one each time at the moment) from database. The code is something like, JDBC Connection Construct MYSQL query. Execute query If has ResultSet, retrieve first one { //save image into Blob image, “img” is the only entity in the image table. image = rs.getBlob("img"); } response.setContentType("image/gif"); //set response type InputStream in = image.getBinaryStream(); //output Blob image to InputStream int bufferSize = 1024; //buffer size byte[] buffer = new byte[bufferSize]; //initial buffer int length =0; //read length data from inputstream and store into buffer while ((length = in.read(buffer)) != -1) { out.write(buffer, 0, length); //write into ServletOutputStream } in.close(); out.flush(); //write out The code on client side .... imgform.setAction(GWT.getModuleBaseURL() + "serviceexample/ImgRetrieve"); .... ClickListener { OnClick, then imgform.submit(); } formHandler { onSubmit, form validation onSubmitComplete ??????? //handle response, and display image **Here is my question, i had tried Image img = new Image(GWT.getHostPageBaseURL() +"serviceexample/ImgRetrieve"); mg.setSize("300", "300"); imgpanel.add(img); but i only got a non-displayed image with 300X300 size.** } So, how should i handle the responde in this case? Thanks,

    Read the article

  • LINQ to Entities question about orderby and null collections.

    - by Chevex
    I am currently developing a forum. I am new to LINQ and EF. In my forum I have a display that shows a list of topics with the most recent topics first. The problem is that "most recent" is relative to the topic's replies. So I don't want to order the list by the topic's posted date, rather I want to order the list by the topic's last reply's posted date. So that topics with newer replies pop back to the top of the list. This is rather simple if I knew that every topic had at least one reply; I would just do this: var topicsQuery = from x in board.Topics orderby x.Replies.Last().PostedDate descending select x; However, in many cases the topic has no replies. In which case I would like to use the topic's posted date instead. Is there a way within my linq query to order by x.PostedDate in the event that the topic has no replies? I'm getting confused by this and any help would be appreciated. With the above query, it breaks on topics with no replies because of the x.Replies.Last() which assumes there are replies. LastOrDefault() doesn't work because I need to access the PostedDate property which also assumes a reply exists. Thanks in advance for any insight.

    Read the article

  • MySQL Ratings From Two Tables

    - by DirtyBirdNJ
    I am using MySQL and PHP to build a data layer for a flash game. Retrieving lists of levels is pretty easy, but I've hit a roadblock in trying to fetch the level's average rating along with it's pointer information. Here is an example data set: levels Table: level_id | level_name 1 | Some Level 2 | Second Level 3 | Third Level ratings Table: rating_id | level_id | rating_value 1 | 1 | 3 2 | 1 | 4 3 | 1 | 1 4 | 2 | 3 5 | 2 | 4 6 | 2 | 1 7 | 3 | 3 8 | 3 | 4 9 | 3 | 1 I know this requires a join, but I cannot figure out how to get the average rating value based on the level_id when I request a list of levels. This is what I'm trying to do: SELECT levels.level_id, AVG(ratings.level_rating WHERE levels.level_id = ratings.level_id) FROM levels I know my SQL is flawed there, but I can't figure out how to get this concept across. The only thing I can get to work is returning a single average from the entire ratings table, which is not very useful. Ideal Output from the above conceptually valid but syntactically awry query would be: level_id | level_rating 1| 3.34 2| 1.00 3| 4.54 My main issue is I can't figure out how to use the level_id of each response row before the query has been returned. It's like I want to use a placeholder... or an alias... I really don't know and it's very frustrating. The solution I have in place now is an EPIC band-aid and will only cause me problems long term... please help!

    Read the article

  • [XPATH] Retrieve specific preceding sibling nodes attributes

    - by Matthieu BROUILLARD
    Is there an XPath way of recovering directly one specific attribute of preceding sibling nodes of an XML node using an XPath query? In the following example, I would like to retrieve the values of the alt attribute of each img nodes that precede the div element marked with the id=marker. <content> <img alt="1" src="file.gif" /> <img alt="2" src="file.gif" /> <img alt="3" src="file.gif" /> <img alt="4" src="file.gif" /> <div id='marker'></div> </content> For this example, I want to retrieve the values 1 2 3 4. I use the following XPath query //div[@id='marker']/preceding-sibling::img in order to retrieve the node list I want <img alt="1" src="file.gif"/> <img alt="2" src="file.gif"/> <img alt="3" src="file.gif"/> <img alt="4" src="file.gif"/> As it is a node list I can then iterate on the nodes to retrieve the attribute value I am looking for, but is there an XPath way of doing it? I would have expected to be able to write something like: //div[@id='marker']/preceding-sibling::img@alt or //div[@id='marker']/preceding-sibling@alt::img but I don't even know if it is possible once you have used an XPath Axe like preceding-sibling.

    Read the article

  • Subset and lagging list data structure R

    - by user1234440
    I have a list that is indexed like the following: >list.stuff [[1]] [[1]]$vector ... [[1]]$matrix .... [[1]]$vector [[2]] null [[3]] [[3]]$vector ... [[3]]$matrix .... [[3]]$vector . . . Each segment in the list is indexed according to another vector of indexes: >index.list 1, 3, 5, 10, 15 In list.stuff, only at each of the indexes 1,3,5,10,15 will there be 2 vectors and one matrix; everything else will be null like [[2]]. What I want to do is to lag like the lag.xts function so that whatever is stored in [[1]] will be pushed to [[3]] and the last one drops off. This also requires subsetting the list, if its possible. I was wondering if there exists some functions that handle list manipulation. My thinking is that for xts, a time series can be extracted based on an index you supply: xts.object[index,] #returns the rows 1,3,5,10,15 From here I can lag it with: lag.xts(xts.object[index,]) Any help would be appreciated thanks: EDIT: Here is a reproducible example: list.stuff<-list() vec<-c(1,2,3,4,5,6,7,8,9) vec2<-c(1,2,3,4,5,6,7,8,9) mat<-matrix(c(1,2,3,4,5,6,7,8),4,2) list.vec.mat<-list(vec=vec,mat=mat,vec2=vec2) ind<-c(2,4,6,8,10) for(i in ind){ list.stuff[[i]]<-list.vec.mat }

    Read the article

  • Oracle SQL: ROLLUP not summing correctly

    - by tommy-o-dell
    Hi guys, Rollup seems to be working correcly to count the number of units, but not the number of trains. Any idea what could be causing that? The output from the query looks like this. The sum of the Units column in yellow is 53 but the rollup is showing 51. The number of units adds up correctly though... And here's the oracle SQL query... select t.year, t.week, decode(t.mine_id,NULL,'PF',t.mine_id) as mine_id, decode(t.product,Null,'LF',t.product) as product, decode(t.mine_id||'-'||t.product,'-','PF',t.mine_id||'-'||t.product) as code, count(distinct t.tpps_train_id) as trains, count(1) as units from ( select trn.mine_code as mine_id, trn.train_tpps_id as tpps_train_id, round((con.calibrated_weight_total - con.empty_weight_total),2) as tonnes from widsys.train trn INNER JOIN widsys.consist con USING (train_record_id) where trn.direction = 'N' and (con.calibrated_weight_total-con.empty_weight_total) > 10 and trn.num_cars > 10 and con.consist_no not like '_L%' ) w, ( select to_char(td.datetime_act_comp_dump-7/24, 'IYYY') as year, to_char(td.datetime_act_comp_dump-7/24, 'IW') as week, td.mine_code as mine_id, td.train_id as tpps_train_id, pt.product_type_code as product from tpps.train_details td inner join tpps.ore_products op using (ore_product_key) inner join tpps.product_types pt using (product_type_key) where to_char(td.datetime_act_comp_dump-7/24, 'IYYY') = 2010 and to_char(td.datetime_act_comp_dump-7/24, 'IW') = 12 order by td.datetime_act_comp_dump asc ) t where w.mine_id = t.mine_id and w.tpps_train_id = t.tpps_train_id having t.product is not null or t.mine_id is null group by t.year, t.week, rollup( t.mine_id, t.product)

    Read the article

  • Twitter API Rate Limit - Overcoming on an unauthenticated JSON Get with Objective C?

    - by Cian
    I see the rate limit is 150/hr per IP. This'd be fine, but my application is on a mobile phone network (with shared IP addresses). I'd like to query twitter trends, e.g. GET /trends/1/json. This doesn't require authorization, however what if the user first authorized with my application using OAuth, then hit the JSON API? The request is built as follows: - (void) queryTrends:(NSString *) WOEID { NSString *urlString = [NSString stringWithFormat:@"http://api.twitter.com/1/trends/%@.json", WOEID]; NSURL *url = [NSURL URLWithString:urlString]; NSURLRequest *theRequest=[NSURLRequest requestWithURL:url cachePolicy:NSURLRequestUseProtocolCachePolicy timeoutInterval:10.0]; NSURLConnection *theConnection=[[NSURLConnection alloc] initWithRequest:theRequest delegate:self startImmediately:YES]; if (theConnection) { // Create the NSMutableData to hold the received data. theData = [[NSMutableData data] retain]; } else { NSLog(@"Connection failed in Query Trends"); } //NSData *data = [NSData dataWithContentsOfURL:[NSURL URLWithString:urlString]]; } I have no idea how I'd build this request as an authenticated one however, and haven't seen any examples to this effect online. I've read through the twitter OAuth documentation, but I'm still puzzled as to how it should work. I've experimented with OAuth using Ben Gottlieb's prebuild library, and calling this in my first viewDidLoad: OAuthViewController *oAuthVC = [[OAuthViewController alloc] initWithNibName:@"OAuthTwitterDemoViewController" bundle:[NSBundle mainBundle]]; // [self setViewController:aViewController]; [[self navigationController] pushViewController:oAuthVC animated:YES]; This should store all the keys required in the app's preferences, I just need to know how to build the GET request after authorizing! Maybe this just isn't possible? Maybe I'll have to proxy the requests through a server side application? Any insight would be appreciated!

    Read the article

  • pagination and url encoding help

    - by Sufyan
    <?php $name=$_POST['name']; ?> <form method="POST" action="<?php echo $_SERVER['PHP_SELF']; ?>"> <input type="text" name="name"> <input type="submit" value="GO" name="submit"> </form> <?php include ('db.php'); if(isset($_POST['submit'])) { mysql_query ("INSERT INTO example (name) VALUES('$name')") or die(mysql_error()); } if (!isset($_GET['startrow']) or !is_numeric($_GET['startrow'])) { $startrow = 0; } else { $startrow = (int)$_GET['startrow']; } $query = "SELECT * FROM example ORDER BY id DESC LIMIT $startrow, 20"; $result = mysql_query($query) or die(mysql_error()); while($row = mysql_fetch_array($result)){ echo "<li>"; echo $row['name'] ." "." <a href= 'like.php?quote=" . urlencode( $row['name'] ) . "'>Click Here</a>"; echo "</li>"; } echo '<a href="'.$_SERVER['PHP_SELF'].'?startrow='.($startrow+10).'">Next</a>'; ?> I want to make my page links hidden , how can i make then hidden so that a user cant edit it. 2nd question, currently i am showing total 10 records on each page and then a next page button , but the next button is keep showing even when there is no more records...! how to remove a next page button when records ended. ?? line number 28 is the link to pages which can be easyily editable by any user, i wnat to make them secure (using ID) and line 35 is n'next' page link , this link should not be appear when number of records ended

    Read the article

  • How to eliminate duplicate rows?

    - by Odette
    hi guys im back with my original query and i just have one question please (ps: I know i have to vote and regsiter and I promise I will do that today) With the following query (t-sql) I am getting the correct results, except that there are duplicates now. I have been reading up and think I can use the PARTITION BY syntax - can you please show me how to incorporate the PARTITION BY syntax? WITH CALC1 AS (SELECT OTQUOT, OTIT01 AS ITEMS, ROUND(OQCQ01 * OVRC01,2) AS COST FROM @[email protected] WHERE OTIT01 < '' UNION ALL ... SELECT OTQUOT, OTIT10 AS ITEMS, ROUND(OQCQ10 * OVRC10,2) AS COST FROM @[email protected] WHERE OTIT10 < '' ) SELECT OTQUOT, DESC, ITEMS, RN FROM ( SELECT OTQUOT, ITEMS, B.IXRPGP AS GROUP, C.OTRDSC AS DESC, COST, ROW_NUMBER() OVER (PARTITION BY OTQUOT ORDER BY COST DESC) AS RN FROM CALC1 AS A INNER JOIN @[email protected] AS B ON (A.ITEMS = B.IKITMC) INNER JOIN DATAGRP.GDSGRP AS C ON (B.IXRPGP = C.OKRPGP) ) T RESULTS: 60408169 FENCING GNCPDCTP18BGBG 1 60408169 FENCING CGIFESHPD1795BG 2 60408169 FENCING GTTCGIBG 3 60408169 FENCING GBTCGIBG 4 How do I get rid of the duplicates? thanks Bill and all the others for your help (I am still learning!)

    Read the article

  • PHP: Join two separate mysql queries into the same json data object

    - by Dan
    I'm trying to mesh the below mysql query results into a single json object, but not quite sure how to do it properly. //return data $sql_result = mysql_query($sql,$connection) or die ("Fail."); $arr = array(); while($obj = mysql_fetch_object($sql_result)) { $arr[] = $obj; } echo json_encode($arr); //return json //plus the selected options $sql_result2 = mysql_query($sql2,$connection) or die ("Fail."); $arr2 = array(); while($obj2 = mysql_fetch_object($sql_result2)) { $arr2[] = $obj2; } echo json_encode($arr2); //return json Here's the current result: [{"po_number":"test","start_date":"1261116000","end_date":"1262239200","description":"test","taa_required":"0","account_overdue":"1","jobs_id":null,"job_number":null,"companies_id":"4","companies_name":"Primacore Inc."}][{"types_id":"37"},{"types_id":"4"}] Notice how the last section [{"types_id":"37"},{"types_id":"4"}] is placed into a separate chunk under root. I'm wanting it to be nested inside the first branch under a name like, "types". I think my question has more to do with Php array manipulation, but I'm not the best with that. Thank you for any guidance.

    Read the article

  • LINQ-SQL Updating Multiple Rows in a single transaction

    - by RPM1984
    Hi guys, I need help re-factoring this legacy LINQ-SQL code which is generating around 100 update statements. I'll keep playing around with the best solution, but would appreciate some ideas/past experience with this issue. Here's my code: List<Foo> foos; int userId = 123; using (DataClassesDataContext db = new FooDatabase()) { foos = (from f in db.FooBars where f.UserId = userId select f).ToList(); foreach (FooBar fooBar in foos) { fooBar.IsFoo = false; } db.SubmitChanges() } Essentially i want to update the IsFoo field to false for all records that have a particular UserId value. Whats happening is the .ToList() is firing off a query to get all the FooBars for a particular user, then for each Foo object, its executing an UPDATE statement updating the IsFoo property. Can the above code be re-factored to one single UPDATE statement? Ideally, the only SQL i want fired is the below: UPDATE FooBars SET IsFoo = FALSE WHERE UserId = 123 EDIT Ok so looks like it cant be done without using db.ExecuteCommand. Grr...! What i'll probably end up doing is creating another extension method for the DLINQ namespace. Still require some hardcoding (ie writing "WHERE" and "UPDATE"), but at least it hides most of the implementation details away from the actual LINQ query syntax.

    Read the article

  • multi-shop orders table and sequential order numbers based on shop

    - by imanc
    Hey, I am looking at building a shop solution that needs to be scalable. Currently it retrieves 1-2000 orders on average per day across multiple country based shops (e.g. uk, us, de, dk, es etc.) but this order could be 10x this amount in two years. I am looking at either using separate country-shop databases to store the orders tables, or looking to combine all into one order table. If all orders exist in one table with a global ID (auto num) and country ID (e.g uk,de,dk etc.), each countries orders would also need to have sequential ordering. So in essence, we'd have to have a global ID and a country order ID, with the country order ID being sequential for countries only, e.g. global ID = 1000, country = UK, country order ID = 1000 global ID = 1001, country = DE, country order ID = 1000 global ID = 1002, country = DE, country order ID = 1001 global ID = 1003, country = DE, country order ID = 1002 global ID = 1004, country = UK, country order ID = 1001 THe global ID would be DB generated and not something I would need to worry about. But I am thinking that I'd have to do a query to get the current country order based ID+1 to find the next sequential number. Two things concern me about this: 1) query times when the table has potentially millions of rows of data and I'm doing a read before a write, 2) the potential for ID number clashes due to simultaneous writes/reads. With a MyISAM table the entire table could be locked whilst the last country order + 1 is retrieved, to prevent ID number clashes. I am wondering if anyone knows of a more elegant solution? Cheers, imanc

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Program repeats each time a character is scanned .. How to stop it ?

    - by ZaZu
    Hello there, I have a program that has this code : #include<stdio.h> main(){ int input; char g; do{ printf("Choose a numeric value"); printf(">"); scanf("\n%c",&input); g=input-'0'; }while((g>=-16 && g<=-1)||(g>=10 && g<=42)||(g>=43 && g<=79)); } It basically uses ASCII manipulation to allow the program to accept numbers only .. '0' is given the value 48 by default...the ASCII value - 48 gives a ranges of numbers above (in the while statement) Anyway, whenever a user inputs numbers AND alphabets, such as : abr39293afakvmienb23 The program ignores : a,b,r .. But takes '3' as the first input. For a b and r, the code under the do loop repeats. So for the above example, I get : Choose a numeric value >Choose a numeric value> Choose a numeric value >3 Is there a way I can stop this ??? I tried using \n%c to scan the character and account for whitespace, but that didnt work :( Please help thank you very much !

    Read the article

< Previous Page | 441 442 443 444 445 446 447 448 449 450 451 452  | Next Page >