Search Results

Search found 18695 results on 748 pages for 'query manipulation'.

Page 446/748 | < Previous Page | 442 443 444 445 446 447 448 449 450 451 452 453  | Next Page >

  • PHP: Join two separate mysql queries into the same json data object

    - by Dan
    I'm trying to mesh the below mysql query results into a single json object, but not quite sure how to do it properly. //return data $sql_result = mysql_query($sql,$connection) or die ("Fail."); $arr = array(); while($obj = mysql_fetch_object($sql_result)) { $arr[] = $obj; } echo json_encode($arr); //return json //plus the selected options $sql_result2 = mysql_query($sql2,$connection) or die ("Fail."); $arr2 = array(); while($obj2 = mysql_fetch_object($sql_result2)) { $arr2[] = $obj2; } echo json_encode($arr2); //return json Here's the current result: [{"po_number":"test","start_date":"1261116000","end_date":"1262239200","description":"test","taa_required":"0","account_overdue":"1","jobs_id":null,"job_number":null,"companies_id":"4","companies_name":"Primacore Inc."}][{"types_id":"37"},{"types_id":"4"}] Notice how the last section [{"types_id":"37"},{"types_id":"4"}] is placed into a separate chunk under root. I'm wanting it to be nested inside the first branch under a name like, "types". I think my question has more to do with Php array manipulation, but I'm not the best with that. Thank you for any guidance.

    Read the article

  • Need Associated ID Added to a While Loop (php)

    - by user319361
    Been trying to get my head around while loops for the last few days but the code seems very inefficient for what Im trying to achieve. I'm assuming I'm overcomplicating this though nothing I've tried seems to work. Each topic in my forum can have related topic IDs stored in a seperate table. A post ID is also stored in this table, as that specific post references why they are considered related. DB Table contains only: topic_id, related_id, post_id // Get related IDs and post IDs for current topic being viewed $result = $db->query('SELECT related_id, post_id FROM related_topics WHERE topic_id='.$id.''); // If related topics found, put both of the IDs into arrays if ($db->num_rows($result)) { while($cur_related = mysql_fetch_array($result)){ $reltopicarray[] = $cur_related['related_id']; $relpost[] = $cur_related['post_id']; } // If the first array isnt empty, get some additional info about each related ID from another table if(!empty($reltopicarray)) { $pieces = $reltopicarray; $glued = "\"".implode('", "', $pieces)."\""; $fetchtopics = $db->query('SELECT id, subject, author, image, etc FROM topics WHERE id IN('.$glued.')'); } // Print each related topic while($related = mysql_fetch_array($fetchtopics)){ ?> <a href="view.php?id=<?php echo $related['id']; ?>"><?php echo $related['subject']; ?></a> by <?php echo $related['author']; ?> // Id like to show the Post ID below (from the array in the first while loop) // The below link doesnt work as Im outside the while loop by this point. <br /><a href="view.php?post_id=<?php echo $cur_related['post_id']; ?>">View Relationship</a> <?php } ?> The above currently works, however I'm trying to also display the post_id link below each related topic link, as shown above. Would be greatful if someone can lend a hand. Thanks :)

    Read the article

  • pure/const functions in C++

    - by Albert
    Hi, I'm thinking of using pure/const functions more heavily in my C++ code. (pure/const attribute in GCC) However, I am curious how strict I should be about it and what could possibly break. The most obvious case are debug outputs (in whatever form, could be on cout, in some file or in some custom debug class). I probably will have a lot of functions, which don't have any side effects despite this sort of debug output. No matter if the debug output is made or not, this will absolutely have no effect on the rest of my application. Or another case I'm thinking of is the use of my own SmartPointer class. In debug mode, my SmartPointer class has some global register where it does some extra checks. If I use such an object in a pure/const function, it does have some slight side effects (in the sense that some memory probably will be different) which should not have any real side effects though (in the sense that the behaviour is in any way different). Similar also for mutexes and other stuff. I can think of many complex cases where it has some side effects (in the sense of that some memory will be different, maybe even some threads are created, some filesystem manipulation is made, etc) but has no computational difference (all those side effects could very well be left out and I would even prefer that). How does it work out in practice? If I mark such functions as pure/const, could it break anything (considering that the code is all correct)?

    Read the article

  • NHibernate unintential lazy property loading

    - by chiccodoro
    I introduced a mapping for a business object which has (among others) a property called "Name": public class Foo : BusinessObjectBase { ... public virtual string Name { get; set; } } For some reason, when I fetch "Foo" objects, NHibernate seems to apply lazy property loading (for simple properties, not associations): The following code piece generates n+1 SQL statements, whereof the first only fetches the ids, and the remaining n fetch the Name for each record: ISession session = ...IQuery query = session.CreateQuery(queryString); ITransaction tx = session.BeginTransaction(); List<Foo> result = new List<Foo>(); foreach (Foo foo in query.Enumerable()) { result.Add(foo); } tx.Commit(); session.Close(); produces: NHibernate: select foo0_.FOO_ID as col_0_0_ from V1_FOO foo0_ NHibernate: SELECT foo0_.FOO_ID as FOO1_2_0_, foo0_.NAME as NAME2_0_ FROM V1_FOO foo0_ WHERE foo0_.FOO_ID=:p0;:p0 = 81 NHibernate: SELECT foo0_.FOO_ID as FOO1_2_0_, foo0_.NAME as NAME2_0_ FROM V1_FOO foo0_ WHERE foo0_.FOO_ID=:p0;:p0 = 36470 NHibernate: SELECT foo0_.FOO_ID as FOO1_2_0_, foo0_.NAME as NAME2_0_ FROM V1_FOO foo0_ WHERE foo0_.FOO_ID=:p0;:p0 = 36473 Similarly, the following code leads to a LazyLoadingException after session is closed: ISession session = ... ITransaction tx = session.BeginTransaction(); Foo result = session.Load<Foo>(id); tx.Commit(); session.Close(); Console.WriteLine(result.Name); Following this post, "lazy properties ... is rarely an important feature to enable ... (and) in Hibernate 3, is disabled by default." So what am I doing wrong? I managed to work around the LazyLoadingException by doing a NHibernateUtil.Initialize(foo) but the even worse part are the n+1 sql statements which bring my application to its knees. This is how the mapping looks like: <class name="Foo" table="V1_FOO"> ... <property name="Name" column="NAME"/> </class> BTW: The abstract "BusinessObjectBase" base class encapsulates the ID property which serves as the internal identifier.

    Read the article

  • Excessive use of Inner Join for more than 3 tables

    - by Archangel08
    Good Day, I have 4 tables on my DB (not the actual name but almost similar) which are the ff: employee,education,employment_history,referrence employee_id is the name of the foreign key from employee table. Here's the example (not actual) data: **Employee** ID Name Birthday Gender Email 1 John Smith 08-15-2014 Male [email protected] 2 Jane Doe 00-00-0000 Female [email protected] 3 John Doe 00-00-0000 Male [email protected] **Education** Employee_ID Primary Secondary Vocation 1 Westside School Westshore H.S SouthernBay College 2 Eastside School Eastshore H.S NorthernBay College 3 Northern School SouthernShore H.S WesternBay College **Employment_History** Employee_ID WorkOne StartDate Enddate 1 StarBean Cafe 12-31-2012 01-01-2013 2 Coffebucks Cafe 11-01-2012 11-02-2012 3 Latte Cafe 01-02-2013 04-05-2013 Referrence Employee_ID ReferrenceOne Address Contact 1 Abraham Lincoln Lincoln Memorial 0000000000 2 Frankie N. Stein Thunder St. 0000000000 3 Peter D. Pan Neverland Ave. 0000000000 NOTE: I've only included few columns though the rest are part of the query. And below are the codes I've been working on for 3 consecutive days: $sql=mysql_query("SELECT emp.id,emp.name,emp.birthday,emp.pob,emp.gender,emp.civil,emp.email,emp.contact,emp.address,emp.paddress,emp.citizenship,educ.employee_id,educ.elementary,educ.egrad,educ.highschool,educ.hgrad,educ.vocational,educ.vgrad,ems.employee_id,ems.workOne,ems.estartDate,ems.eendDate,ems.workTwo,ems.wstartDate,ems.wendDate,ems.workThree,ems.hstartDate,ems.hendDate FROM employee AS emp INNER JOIN education AS educ ON educ.employee_id='emp.id' INNER JOIN employment_history AS ems ON ems.employee_id='emp.id' INNER JOIN referrence AS ref ON ref.employee_id='emp.id' WHERE emp.id='$id'"); Is it okay to use INNER JOIN this way? Or should I modify my query to get the results that I wanted? I've also tried to use LEFT JOIN but still it doesn't return anything .I didn't know where did I go wrong. You see, as I have thought, I've been using the INNER JOIN in correct manner, (since it was placed before the WHILE CLAUSE). So I couldn't think of what could've possible went wrong. Do you guys have a suggestion? Thanks in advance.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Getting random record from database with group by

    - by Saif Bechan
    Hello i have a question on picking random entries from a database. I have 4 tables, products, bids and autobids, and users. Products ------- id 20,21,22,23,24(prime_key) price........... etc........... users ------- id(prim_key) name user1,user2,user3 etc bids ------- product_id user_id created autobids -------- user_id product_id Now a multiple users can have an autobid on an product. So for the next bidder I want to select a random user from the autobid table example of the query in language: for each product in the autobid table I want a random user, which is not the last bidder. On product 20 has user1,user2,user3 an autobidding. On product 21 has user1,user2,user3 an autobidding Then I want a resultset that looks for example like this 20 – user2 21 – user3 Just a random user. I tried miximg the GOUP BY (product_id) and making it RAND(), but I just can't get the right values from it. Now I am getting a random user, but all the values that go with it don't match. Can someone please help me construct this query, I am using php and mysql

    Read the article

  • Creating a Linq->HQL provider

    - by Mike Q
    Hi all, I have a client application that connects to a server. The server uses hibernate for persistence and querying so it has a set of annotated hibernate objects for persistence. The client sends HQL queries to the server and gets responses back. The client has an auto-generated set of objects that match the server hibernate objects for query results and basic persistence. I would like to support using Linq to query as well as Hql as it makes the queries typesafe and quicker to build (no more typos in HQL string queries). I've looked around at the following but I can't see how to get them to fit with what I have. NHibernate's Linq provider - requires using NHibernate ISession and ISessionFactory, which I don't have LinqExtender - requires a lot of annotations on the objects and extending a base type, too invasive What I really want is something that will generate give me a nice easy to process structure to build the HQL queries from. I've read most of a 15 page article written by one of the C# developers on how to create custom providers and it's pretty fraught, mainly because of the complexity of the expression tree. Can anyone suggest an approach for implementing Linq - HQL translation? Perhaps a library that will the cleanup of the expression tree into something more SQL/HQLish. I would like to support select/from/where/group by/order by/joins. Not too worried about subqueries.

    Read the article

  • LINQ-SQL Updating Multiple Rows in a single transaction

    - by RPM1984
    Hi guys, I need help re-factoring this legacy LINQ-SQL code which is generating around 100 update statements. I'll keep playing around with the best solution, but would appreciate some ideas/past experience with this issue. Here's my code: List<Foo> foos; int userId = 123; using (DataClassesDataContext db = new FooDatabase()) { foos = (from f in db.FooBars where f.UserId = userId select f).ToList(); foreach (FooBar fooBar in foos) { fooBar.IsFoo = false; } db.SubmitChanges() } Essentially i want to update the IsFoo field to false for all records that have a particular UserId value. Whats happening is the .ToList() is firing off a query to get all the FooBars for a particular user, then for each Foo object, its executing an UPDATE statement updating the IsFoo property. Can the above code be re-factored to one single UPDATE statement? Ideally, the only SQL i want fired is the below: UPDATE FooBars SET IsFoo = FALSE WHERE UserId = 123 EDIT Ok so looks like it cant be done without using db.ExecuteCommand. Grr...! What i'll probably end up doing is creating another extension method for the DLINQ namespace. Still require some hardcoding (ie writing "WHERE" and "UPDATE"), but at least it hides most of the implementation details away from the actual LINQ query syntax.

    Read the article

  • about c# OBJECTS and the Possibilties it has.

    - by user527825
    As a novice programmer and i always wonder about c# capabilities.i know it is still early to judge that but all i want to know is can c# do complex stuffs or something outside windows OS. 1- I think c# is a proprietary language (i don't know if i said that right) meaning you can't do it outside visual studio or windows. 2-also you cant create your own controller(called object right?) like you are forced to use these available in toolbox and their properties and methods. 3-can c# be used with openGL API or DirectX API . 4-Finally it always bothers me when i think i start doing things in visual studio, i know it sounds arrogant to say but sometimes i feel that i don't like to be forced to use something even if its helpful, like i feel (do i have the right to feel?) that i want to do all things by myself? don't laugh i just feel that this will give me a better understanding. 5- is visual c# is like using MaxScript inside 3ds max in that c# is exclusive to do windows and forms and components that are windows related and maxscript is only for 3d editing and manipulation for various things in the software. If it is too difficult for a beginner i hope you don't answer the fourth question as i don't have enough motivation and i want to keep the little i have. thank you for your time. Note: 1-sorry for my English, i am self taught and never used the language with native speakers so expect so errors. 2-i have a lot of questions regarding many things, what is the daily ratio you think for asking (number of questions) that would not bother the admins of the site and the members here. thank you for your time.

    Read the article

  • PHP & MySQL Image deletion problem?

    - by IMAGE
    I have this script that deletes a users avatar image that is stored in a folder name thumbs and another named images and the image name is stored in a mysql database. But for some reason the script deletes all the users info for example if the users id is 3 all of the users info like first name last name age and so are deleted as well, basically everything is deleted including the user how do I fix this so only the images and image name is deleted? Here is the code. $user_id = '3'; if (isset($_POST['delete_image'])) { $a = "SELECT * FROM users WHERE avatar = '". $avatar ."' AND user_id = '". $user_id ."'"; $r = mysqli_query ($mysqli, $a) or trigger_error("Query: $a\n<br />MySQL Error: " . mysqli_error($mysqli)); if ($r == TRUE) { unlink("../members/" . $user_id . "/images/" . $avatar); unlink("../members/" . $user_id . "/images/thumbs/" . $avatar); $a = "DELETE FROM users WHERE avatar = '". $avatar ."' AND user_id = '". $user_id ."'"; $r = mysqli_query ($mysqli, $a) or trigger_error("Query: $a\n<br />MySQL Error: " . mysqli_error($mysqli)); } }

    Read the article

  • CIE XYZ colorspace: do I have RGBA or XYZA?

    - by Tronic
    I plan to write a painting program based on linear combinations of xy plane points (0,1), (1,0) and (0,0). Such system works identically to RGB, except that the primaries are not within the gamut but at the corners of a triangle that encloses the entire gamut. I have seen the three points being referred to as X, Y and Z (upper case) somewhere, but I cannot find the page anymore (I marked them to the picture myself). My pixel format stores the intensity of each of those three components the same way as RGB does, together with alpha value. This allows using pretty much any image manipulation operation designed for RGBA without modifying the code. What is my format called? Is it XYZA, RGBA or something else? Google doesn't seem to know of XYZA. RGBA will get confused with sRGB + alpha (which I also need to use in the same program). Notice that the primaries X, Y and Z and their intensities have little to do with the x, y and z coordinates (lower case) that are more commonly used.

    Read the article

  • CSS style refresh in IE after dynamic removal of style link

    - by rybz
    Hi! I've got a problem with the dynamic style manipulation in IE7 (IE8 is fine). Using javascript I need to add and remove the < link / node with the definition of css file. Adding and removing the node as a child of < head / works fine under Firefox. Unfortunately, after removing it in the IE, although The tag is removed properly, the page style does not refresh. In the example below a simple css (makes background green) is appended and removed. After the removal in FF the background turns default, but in IE stays green. index.html <html> <head> </head> <script language="javascript" type="text/javascript"> var node; function append(){ var headID = document.getElementsByTagName("head")[0]; node = document.createElement('link'); node.type = 'text/css'; node.rel = 'stylesheet'; node.href = "s.css"; node.media = 'screen'; headID.appendChild(node); } function remove(){ var headID = document.getElementsByTagName("head")[0]; headID.removeChild(node); } </script> <body> <div onClick="append();"> add </div> <div onClick="remove();"> remove </div> </body> </html> And the style sheet: s.css body { background-color:#00CC33 } Here is the live example: http://rlab.pl/dynamic-style/ Is there a way to get it working?

    Read the article

  • sql server mdf file database attachment

    - by jnsohnumr
    hello all i'm having a bear of a time getting visual studio 2010 (ultimate i think) to properly attach to my database. it was moved from original spot to #MYAPP#/#MYAPP#.Web/App_Data/#MDF_FILE#.mdf. I have three instances of sql server running on this machine. i have tried to replace the old mdf file with my new one and cannot get the connectionstring right for it. what i'm really wanting to do is to just open some DB instance, run a DB create script. Then I can have a DB that was generated via my edmx (generate database from model) in silverlight business application (c#) right now, when i go to server explorer in VS, choose add new connection, choose MS SQL Server Database FIle (SqlClient), choose my file location (app_data directory), use windows authentication, and hit the Test Connection button I get the following error: Unable to open the physical file "". Operating system error 5: "5(Access Denied.)". An attempt to attach to an auto-named database for file"" failed. A database with the same name exists, or specified file cannot be opened, or it is located on UNC share. The mdf file was created on the same machine by connecting to (local) on the sql server management studio, getting a new query, pasting in the SQL from the generated ddl file, adding a CREATE DATABASE [NcrCarDatabase]; GO before the pasted SQL, and executing the query. I then disconnected from the DB in management studio, closed management studio, navigated to the DATA directory for that instance, and copying the mdf and ldf files to my application's app_data folder. I am then trying to connect to the same file inside visual studio. I hope that gives more clarity to my problems :). Connection string is: Data Source=.\SQLEXPRESS;AttachDbFilename=C:\SourceCode\NcrCarDatabase\NcrCarDatabase.Web\App_Data\NcrCarDatabase.mdf;Integrated Security=True;Connect Timeout=30;User Instance=True

    Read the article

  • Subset and lagging list data structure R

    - by user1234440
    I have a list that is indexed like the following: >list.stuff [[1]] [[1]]$vector ... [[1]]$matrix .... [[1]]$vector [[2]] null [[3]] [[3]]$vector ... [[3]]$matrix .... [[3]]$vector . . . Each segment in the list is indexed according to another vector of indexes: >index.list 1, 3, 5, 10, 15 In list.stuff, only at each of the indexes 1,3,5,10,15 will there be 2 vectors and one matrix; everything else will be null like [[2]]. What I want to do is to lag like the lag.xts function so that whatever is stored in [[1]] will be pushed to [[3]] and the last one drops off. This also requires subsetting the list, if its possible. I was wondering if there exists some functions that handle list manipulation. My thinking is that for xts, a time series can be extracted based on an index you supply: xts.object[index,] #returns the rows 1,3,5,10,15 From here I can lag it with: lag.xts(xts.object[index,]) Any help would be appreciated thanks: EDIT: Here is a reproducible example: list.stuff<-list() vec<-c(1,2,3,4,5,6,7,8,9) vec2<-c(1,2,3,4,5,6,7,8,9) mat<-matrix(c(1,2,3,4,5,6,7,8),4,2) list.vec.mat<-list(vec=vec,mat=mat,vec2=vec2) ind<-c(2,4,6,8,10) for(i in ind){ list.stuff[[i]]<-list.vec.mat }

    Read the article

  • php paging and the use of limit clause

    - by Average Joe
    Imagine you got a 1m record table and you want to limit the search results down to say 10,000 and not more than that. So what do I use for that? Well, the answer is use the limit clause. example select recid from mytable order by recid asc limit 10000 This is going to give me the last 10,000 records entered into this table. So far no paging. But the limit phrase is already in use. That brings to question to the next level. What if I want to page thru this record particular record set 100 recs at a time? Since the limit phrase is already part of the original query, how do I use it again, this time to take care of the paging? If the org. query did not have a limit clause to begin with, I'd adjust it as limit 0,100 and then adjusting it as 100,100 and then 200,100 and so on while the paging takes it course. But at this time, I cannot. You almost think you'd want to use two limit phrases one after the other - which is not not gonna work. limit 10000 limit 0,1000 for sure it would error out. So what's the solution in this particular case?

    Read the article

  • PDO using singleton stored as class properity

    - by Misiur
    Hi again. OOP drives me crazy. I can't move PDO to work. Here's my DB class: class DB extends PDO { public function &instance($dsn, $username = null, $password = null, $driver_options = array()) { static $instance = null; if($instance === null) { try { $instance = new self($dsn, $username, $password, $driver_options); } catch(PDOException $e) { throw new DBException($e->getMessage()); } } return $instance; } } It's okay when i do something like this: try { $db = new DB(DB_TYPE.':host='.DB_HOST.';dbname='.DB_NAME, DB_USER, DB_PASS); } catch(DBException $e) { echo $e->getMessage(); } But this: try { $db = DB::instance(DB_TYPE.':host='.DB_HOST.';dbname='.DB_NAME, DB_USER, DB_PASS); } catch(DBException $e) { echo $e->getMessage(); } Does nothing. I mean, even when I use wrong password/username, I don't get any exception. Second thing - I have class which is "heart" of my site: class Core { static private $instance; public $db; public function __construct() { if(!self::$instance) { $this->db = DB::instance(DB_TYPE.':hpost='.DB_HOST.';dbname='.DB_NAME, DB_USER, DB_PASS); } return self::$instance; } private function __clone() { } } I've tried to use "new DB" inside class, but this: $r = $core->db->query("SELECT * FROM me_config"); print_r($r->fetch()); Return nothing. $sql = "SELECT * FROM me_config"; print_r($core->db->query($sql)); I get: PDOStatement Object ( [queryString] => SELECT * FROM me_config ) I'm really confused, what am I doing wrong?

    Read the article

  • Refreshing a JPA result list which is bound with a jTable

    - by exhuma
    First off, I hage to write this on my mobile. But I'll try to format it properly. In Netbeans I created a jTable and bound it's values to a JPA result set. This works great. The qery contains a param which i set in the pre-create box of the "query result" component. So just before netbeans creates the query result i write this: myQuery.setParameter("year", "1997"); This works fine. Now, I have an event handler which is supposed to change the param and display the new values in the table. So I do this: myQuery.setParameter("year", "2005"); myResultList.clear(); myResultList.addAll(myQuery.getResultList()); jTable1.updateUI(); This works, but it feels wrong to me. Note: the result set is bound to the table. So I was hoping there was something like this: myQuery.setParameter("year", "2005"); myResultList.refresh(); Is there something like this?

    Read the article

  • Efficiently Serving Dynamic Content in Google App Engine

    - by awegawef
    My app on google app engine returns content items (just text) and comments on them. It works like this (pseudo-ish code): query: get keys of latest content #query to datastore for each item in content if item_dict in memcache: use item_dict else: build_item_dict(item) #by fetching from datastore store item_dict in memcache send all item_dicts to template Sorry if the code isn't understandable. I get all of the content dictionaries and send them to the template, which uses them to create the webpage. My problem is that if the memcache has expired, for each item I want to display, I have to (1) lookup item in memcache, (2) since no memcache exists I must fetch item from the datastore, and (3) store the item in memcache. These calls build up quickly. I don't set an expire time for the entries to the memcache, so this really only happens once in the morning, but the webpage takes long enough to load (~1 sec) that the browser reports it as not existing. Regularly, my webpages take about 50ms to load. This approach works decently for frequent visits, but it has its flaws as shown above. How can I remedy this? The entries are dynamic enough that I don't think it would be in my best interest to cache my initial request. Thanks in advance

    Read the article

  • Why aren't my MySQL Group By Hours vs Half Hours files Not displaying same data?

    - by stogdilla
    I need to be able to display data that I have in 15 minute increments in different display types. I have two queries that are giving me trouble. One shows data by half an hour, the other shows data by hour. The only issue is that the data totals change between queries. It's not counting the data that happens between the time frames, only AT the time frames. Ex: There are 5 things that happen at 7:15am. 2 that happen at 7:30am and 4 that show at 7:00am. The 15 minute view displays all of the data. The half hour view displays the data from 7:00am and from 7:30am but ignores the 7:15am. The hour display only shows the 7:00am data Here are my queries: $query="SELECT * FROM data WHERE startDate='$startDate' and queue='$queue' GROUP BY HOUR(start),floor(minute(start)/30)"; and $query="SELECT * FROM data WHERE startDate='$startDate' and queue='$queue' GROUP BY HOUR(start) "; How can I pull out the data in groups like I have but get all the data included? Is the issue the way the data is stored in the mysql table? Currently I have a column with dates (2010-03-29) and a column with times (00:00) Do I need to convert these into something else?

    Read the article

  • UTF-8 MySQL and Charset, pls help me understand this once and for all!

    - by FFish
    Can someone explain me when I set everything to UTF-8 I keep getting those damn ??? MySQL Server version: 5.1.44 MySQL charset: UTF-8 Unicode (utf8) I create a new database name: utf8test collation: utf8_general_ci MySQL connection collation: utf8_general_ci My SQL looks like this: SET SQL_MODE="NO_AUTO_VALUE_ON_ZERO"; CREATE TABLE IF NOT EXISTS `test_table` ( `test_id` int(11) NOT NULL, `test_text` text NOT NULL, PRIMARY KEY (`test_id`) ) ENGINE=MyISAM DEFAULT CHARSET=utf8; INSERT INTO `test_table` (`test_id`, `test_text`) VALUES (1, 'hééélo'), (2, 'wööörld'); My PHP / HTML: <?php $db_conn = mysql_connect("localhost", "root", "") or die("Can't connect to db"); mysql_select_db("utf8test", $db_conn) or die("Can't select db"); // $result = mysql_query("set names 'utf8'"); // this works... why?? $query = "SELECT * FROM test_table"; $result = mysql_query($query); $output = ""; while($row = mysql_fetch_assoc($result)) { $output .= "id: " . $row['test_id'] . " - text: " . $row['test_text'] . "<br />"; } ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html lang="it" xmlns="http://www.w3.org/1999/xhtml" xml:lang="it"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>UTF-8 test</title> </head> <body> <?php echo $output; ?> </body> </html>

    Read the article

  • Is it a good idea to use an integer column for storing US ZIP codes in a database?

    - by Yadyn
    From first glance, it would appear I have two basic choices for storing ZIP codes in a database table: Text (probably most common), i.e. char(5) or varchar(9) to support +4 extension Numeric, i.e. 32-bit integer Both would satisfy the requirements of the data, if we assume that there are no international concerns. In the past we've generally just gone the text route, but I was wondering if anyone does the opposite? Just from brief comparison it looks like the integer method has two clear advantages: It is, by means of its nature, automatically limited to numerics only (whereas without validation the text style could store letters and such which are not, to my knowledge, ever valid in a ZIP code). This doesn't mean we could/would/should forgo validating user input as normal, though! It takes less space, being 4 bytes (which should be plenty even for 9-digit ZIP codes) instead of 5 or 9 bytes. Also, it seems like it wouldn't hurt display output much. It is trivial to slap a ToString() on a numeric value, use simple string manipulation to insert a hyphen or space or whatever for the +4 extension, and use string formatting to restore leading zeroes. Is there anything that would discourage using int as a datatype for US-only ZIP codes?

    Read the article

  • Access 2007 not allowing user to delete record in subform

    - by Todd McDermid
    Good day... The root of my issue is that there's no context menu allowing the user to delete a row from a form. The "delete" button on the ribbon is also disabled. In Access 2003, apparently this function was available, but since our recent "upgrade" to 2007 (file is still in MDB format) it's no longer there. Please keep in mind I'm not an Access dev, nor did I create this app - I inherited support for it. ;) Now for the details, and what I've tried. The form in question is a subform on a larger form. I've tried turning "AllowDeletes" on on both forms. I've checked the toolbar and ribbon properties on the forms to see if they loaded some custom stuff, but no. I've tried changing the "record locks" to "on edit", no joy. I examined the query to see if it was "too complicated" to permit a delete - as far as I can tell, it's a very simple two (linked) table join. Compared to another form in this app that does permit row deletes, it has a much more complicated (multi-join, built on queries) query. Is there a resource that would describe the required conditions for allowing deletes? Thanks in advance...

    Read the article

  • Warning: cast increases required alignment

    - by dash-tom-bang
    I'm recently working on this platform for which a legacy codebase issues a large number of "cast increases required alignment to N" warnings, where N is the size of the target of the cast. struct Message { int32_t id; int32_t type; int8_t data[16]; }; int32_t GetMessageInt(const Message& m) { return *reinterpret_cast<int32_t*>(&data[0]); } Hopefully it's obvious that a "real" implementation would be a bit more complex, but the basic point is that I've got data coming from somewhere, I know that it's aligned (because I need the id and type to be aligned), and yet I get the message that the cast is increasing the alignment, in the example case, to 4. Now I know that I can suppress the warning with an argument to the compiler, and I know that I can cast the bit inside the parentheses to void* first, but I don't really want to go through every bit of code that needs this sort of manipulation (there's a lot because we load a lot of data off of disk, and that data comes in as char buffers so that we can easily pointer-advance), but can anyone give me any other thoughts on this problem? I mean, to me it seems like such an important and common option that you wouldn't want to warn, and if there is actually the possibility of doing it wrong then suppressing the warning isn't going to help. Finally, can't the compiler know as I do how the object in question is actually aligned in the structure, so it should be able to not worry about the alignment on that particular object unless it got bumped a byte or two?

    Read the article

  • SQL Server 2005 - Building a WHERE clause

    - by user336786
    Hello, I have a stored procedure that is dynamically building a query. The where clause associated with this query is based on filter values selected by a user. No matter what I do though, the where clause does not seem to get set. -- Dynamically build the WHERE clause based on the filters DECLARE @whereClause as nvarchar(1024) IF (@hasSpouse > -1) BEGIN IF (@hasSpouse = 0) SET @whereClause='p.[HasSpouse]=0' ELSE SET @whereClause='(p.[HasSpouse]=1 OR p.[HasSpouse] IS NULL)' END -- Dynamically add the next filter if necessary IF (@isVegan > -1) BEGIN IF (LEN(@whereClause) > 0) BEGIN SET @whereClause = @whereClause + ' AND ' END IF (@isVegan = 0) SET @whereClause = @whereClause + 'c.[IsVegan]=0' ELSE SET @whereClause = @whereClause + '(c.[IsVegan]=1 OR c.[IsVegan] IS NULL)' END PRINT @whereClause The @whereClause never prints anything. In turn, the LEN(@whereClause) is always NULL. The @isVegan and @hasSpouse values are passed into the stored procedure. The values are what I expected. What am I doing wrong? Why is the @whereClause never being set? Thank you for your help! Thank you!

    Read the article

< Previous Page | 442 443 444 445 446 447 448 449 450 451 452 453  | Next Page >