Search Results

Search found 17715 results on 709 pages for 'regular language'.

Page 457/709 | < Previous Page | 453 454 455 456 457 458 459 460 461 462 463 464  | Next Page >

  • PHP editors for Ubuntu

    - by mepo
    What are the Light weight PHP editors available for ubuntu? And is there a ubuntu version of the Notepad++ editor. For those who haven't used Notepad++, do not confuse it with Notepad.exe. Notepad.exe is the lightweight Windows editor by Microsoft. Notepad++ is an Open Source programmer's text editor for Windows based on SciTE. It has syntax highlighting, code collapsing, language recognition, macro recording, regular expression search and replace across line breaks and in files on disk, copy filenames and paths to clipboard, and many other advance text editing tools. Only the more full-featured editors for Linux would be likely to be suitable replacements for Notepad++. Thanks

    Read the article

  • How can I test if an input field contains foreign characters?

    - by zeckdude
    I have an input field in a form. Upon pushing submit, I want to validate to make sure the user entered non-latin characters only, so any foreign language characters, like Chinese among many others. Or at the very least test to make sure it does not contain any latin characters. Could I use a regular expression for this? What would be the best approach for this? I am validating in both javaScript and in PHP. What solutions can I use to check for foreign characters in the input field in both programming languages?

    Read the article

  • why does InnoDB keep on growing without for every update?

    - by Akash Kava
    I have a table which consists of heavy blobs, and I wanted to conduct some tests on it. I know deleted space is not reclaimed by innodb, so I decided to reuse existing records by updating its own values instead of createing new records. But I noticed, whether I delete and insert a new entry, or I do UPDATE on existing ROW, InnoDB keeps on growing. Assuming I have 100 Rows, each Storing 500KB of information, My InnoDB size is 10MB, now when I call UPDATE on all rows (no insert/ no delete), the innodb grows by ~8MB for every run I do. All I am doing is I am storing exactly 500KB of data in each row, with little modification, and size of blob is fixed. What can I do to prevent this? I know about optimize table, but I cant do it because on regular usage, the table is going to be 60-100GB big, and running optimize will just stall entire server.

    Read the article

  • Yet another URL prefix regex question (to be used in C#).

    - by Hamish Grubijan
    Hi, I have seen many regular expressions for Url validation. In my case I want the Url to be simpler, so the regex should be tighter: Valid Url prefixes look like: http[s]://[www.]addressOrIp[.something]/PageName.aspx[?] This describe a prefix. I will be appending ?x=a&y=b&z=c later. I just want to check if the web page is live before accessing it, but even before that I want to make sure that it is properly configured. I want to treat bad url and host is down conditions differently, although when in doubt, I'd rather give a host is down message, because that is an ultimate test anyway. Hopefully that makes sense. I guess what I am trying to say - the regex does not need be too aggressive, I just want it to cover say 95% of the cases. This is C# - centric, so Perl regex extensions are not helpful to me; let's stick to the lowest common denominator. Thanks!

    Read the article

  • Apply a class to a <h1> based on the site url

    - by user1870639
    I'm new to PHP and want to apply a specific class to the title of my page depending on what part of the site the viewer is browsing. For instance, I want to apply the class "blog" to the if the viewer is at domain.com/blog OR domain.com/blog/post-1 so on and so forth BUT apply the class "pics" if they're viewing domain.com/pics or domain.com/pics/gallery-1 etc etc. I found something that could be modified to serve my needs using javascript here but I figured seeing as I'm using PHP already, it'd make more sense to keep this sort of thing server side. As I say, I'm new to PHP. I've experimented with some regular expressions, but to no avail.

    Read the article

  • JQuery create new select option

    - by nav
    Hi I have the below functions in regular javascript creating select options. Is there a way I can do this with JQuery without having to use the form object? function populate(form) { form.options.length = 0; form.options[0] = new Option("Select a city / town in Sweden",""); form.options[1] = new Option("Melbourne","Melbourne"); } Below is how I call the function above: populate(document.form.county); //county is the id of the dropdownlist to populate. Many Thanks,

    Read the article

  • Change selected value of drop down list with jQuery

    - by Phairoh
    I have a drop down list with known values. What I'm trying to do is set the drop down list to a particular value that I know exists using jQuery. Using regular JavaScript, I would do something like: ddl = document.getElementById("ID of element goes here"); ddl.value = 2; // 2 being the value I want to set it to. However, I need to do this with jQuery because I'm using a CSS class for my selector (stupid ASP.NET client ids...). Here are a few things I've tried: $("._statusDDL").val(2); // doesn't find 2 as a value $("._statusDDL").children("option").val(2) // also failed. How can I do it with jQuery?

    Read the article

  • boost test case for function taking user input

    - by oadams
    I have a function that takes in user input via std::cin: std::getline(std::cin, in); and creates a corresponding data structure by matching it with a regular expression. The function then returns this data structure. I'm using boost.test and I want to create a unit test to check that the output data type is correct given some inputs. However I don't know how to go about it since the input isn't passed as an argument to the function. EDIT: Is there a simple way to create a boost test case that feeds the function a string via standard input?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Question in Flex (parser)

    - by shkk
    Hello... I want to ask you a question about Flex, the program for parsing code. Supposing I have an instruction like this one, in the rules part: "=" BEGIN(attribution); <attribution>{var_name} { fprintf(yyout, "="); ECHO; } <attribution>";" BEGIN(INITIAL); {var_name} is a regular expression that matches a variable's name, and all I want to do is to copy at the output all the attribution instructions, such as a = 3; or b = a; My rule though cannot write with fprintf the left member of the attribution, but only = 3; or =a; One solution for that might be that, after I make the match "=" and I am in the attribution state, to go 2 positions back as to get the left operand as well. How can I do that in Flex?

    Read the article

  • Zend Framework: How to handle exceptions in Ajax requests?

    - by understack
    Normally when an exception is thrown, Error controller takes command and displays error page with regular common header and footer. This behavior is not wanted in Ajax request. Because in case of error, whole html page is sent over. And in cases where I'm directly loading the content of http response in a div, this is even more unwanted. Instead in case of Ajax request, I just want to receive 'the actual error' thrown by exception. How can I do this? I think, one dirty way could be: set a var in ajax request and process accordingly. Not a good solution.

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • Just how much do I want to make virtual?

    - by Alex
    I am writing an abstract superclass where literally every method is going to be overridden. There is some default functionality I could implement, but most of the time it's enough to leave the implementation to the subclass writer. Since just about every method is going to be overwritten, how much should I make virtual and how much should I just leave as regular methods? In the current incarnation, everything is virtual, but I still haven't let this loose to anyone to use, so the design is flexible. What advantages/disadvantages are there to virtual functions? Links to good reading material about this would be appreciated.

    Read the article

  • richtextbox font

    - by habbo95
    hi.... I want to change the font color and size for 1 line in richTextBox enter code here String [] Words = {"hi","hello","11111","he","she"}; richTextBox1.SelectionFont = new Font("Verdana", 10, FontStyle.Regular); richTextBox1.SelectionColor = Color.Blue; richTextBox1.SelectedText += Environment.NewLine + wo[0]; richTextBox1.SelectedText += Environment.NewLine + wo[1]; richTextBox1.SelectedText += Environment.NewLine + wo[2]; richTextBox1.SelectedText += Environment.NewLine + wo[3]; richTextBox1.SelectedText += Environment.NewLine + wo[4]; I want to change just the string "11111" and keep the rest lines as default any help

    Read the article

  • Assign RegEx submatches to variables or map (C++/C)

    - by Michael
    I need to extract the SAME type of information (e.g. First name, Last Name, Telephone, ...), from numerous different text sources (each with a different format & different order of the variables of interest). I want a function that does the extraction based on a regular expression and returns the result as DESCRIPTIVE variables. In other words, instead of returning each match result as submatch[0], submatch[1], submatch[2], ..., have it do EITHER of the following: 1.) return std::map so that the submatches can be accessed via: submatch["first_name"], submatch["last_name"], submatch["telephone"] 2.) return a variables with the submatches so that the submatches can be accessed via: submatch_first_name, submatch_last_name, submatch_telephone I can write a wrapper class around boost::regex to do #1, but I was hoping there would be a built-in or a more elegant way to do this in C++/Boost/STL/C.

    Read the article

  • Get seleted text parent tag using regex C#

    - by Aruna Tennakoon
    <SPAN id=spanD121C150D2 style="BACKGROUND-COLOR: antiquewhite" CategoryID="1" MessageID="2316" refSpan=""> <SPAN id=span1CE69EDE12 style="BACKGROUND-COLOR: blue" CategoryID="2" MessageID="2316" refSpan="">platnosci inny srodkiem platnosci. DC - zakup paliwa na stacji benzynowej 101-500 (150 zl). 27 </SPAN> </SPAN> I have a string like above. If the selected text is "srodkiem ", is it possible to get the relevant span tag? Is this possible using a regular expression?

    Read the article

  • Need Regex for to match special situations

    - by Daniel
    I'm desperately searching for regular expressions that match these scenarios: 1) Match alternating chars I've a string like "This is my foobababababaf string" - and I want to match "babababa" Only thing I know is the length of the fragment to search - I don't know what chars/digits that might be - but they are alternating. I've really no clue where to start :( 2) Match combined groups In a string like "This is my foobaafoobaaaooo string" - and I want to match "aaaooo". Like in 1) I don't know what chars/digits that might be. I only know that they will appear in two groups. I experimented using (.)\1\1\1(.)\1\1\1 and things like this...

    Read the article

  • Regex doesn't work properly

    - by oneofthelions
    I am trying to implement a regular expression to allow only one or two digits after a hyphen '-' and it doesn't work properly. It allows as many digits as user types after '-' Please suggest my ExtJS Ext.apply(Ext.form.VTypes, { hyphenText: "Number and hyphen", hyphenMask: /[\d\-]/, hyphenRe: /^\d+-\d{1,2}$/, hyphen: function(v){ return Ext.form.VTypes.hyphenRe.test(v); } }); //Input Field for Issue no var <portlet:namespace/>issueNoField = new Ext.form.TextField({ fieldLabel: 'Issue No', width: 120, valueField:'IssNo', vtype: 'hyphen' }); This works only to the limit that it allows digits and -. But it also has to allow only 1 to 2 digits after - at most. Is something wrong in my regex? hyphenRe: /^\d+-\d{1,2}$/,

    Read the article

  • PHP reg expr. replace ALL URLs except img src URLs

    - by zilveer
    Hi, I have searched but havent been able to find my answer. It follows like: I would like to replace all URL in a string to links except the URLs within img src tag. I have a regular expression for replacing all the URLs to links, but would like it to NOT replace the URLs within img src="" attribute. How can i do this? Here is the code for replacing all URLs: /*** make sure there is an http:// on all URLs ***/ $str = preg_replace("/([^\w\/])(www\.[a-z0-9\-]+\.[a-z0-9\-]+)/i", "$1http://$2",$str); /*** make all URLs links ***/ $str = preg_replace("/([\w]+:\/\/[\w-?&;#~=\.\/\@]+[\w\/])/i","<a target=\"_blank\" href=\"$1\">$1</a>",$str); /Regards

    Read the article

  • Given a user control with a form containing validation can I validate entirely server side?

    - by JoshBaltzell
    We have an existing User Control that was built to dynamically generate a web form for an end user. This form includes required field validators, custom validators that use server side code and Regular Expression validatiors. We now have a need to use all these validators to verify that all the needed data is entered when using a separate ordering process that cannot be validated in the same way, but has the same validation requirements before it is added to the database. I would like to use this user control to validate the input by passing it all the values and checking the validation summary. The only way I know how to do this is to render it to a page on the client side and trigger the form submit. Is there any way to populate and validate a web form entirely on the server side?

    Read the article

  • Java Util Linked List - how to find next?

    - by drozzy
    When using Java LinkedList how do you find out the element's next or previous relationships? I mean, in a regular linked list I would do something like this: Node node1 = new Node(); Node node2 = new Node(); LinkedList list = new LinkedList(); list.add(node1); list.add(node2); //then my node1 will know who it's next is: assertEquals(node2, node1.next()); But in Java's LinkedList, the data does not seem to be modified. So how do I actually find out who the "next" (or "previous" in the case of doubly-linked lists) element is?

    Read the article

  • How do I compute a variable in Javascript if and only if it is used?

    - by LLer
    This is what I'm doing right now. var foo = function() { var x = someComplicatedComputationThatMayTakeMoreTime(); this.foo = function() { return x; }; return x; } It works but only if foo is called as a function like so foo(); But what if I want to call it as a normal variable with a value? I could modify the code to be var foo = function() { var x = someComplicatedComputationThatMayTakeMoreTime(); this.foo = x; return x; } That would allow me to only call it once as a function and after that as a regular variable. But it's still not what I want. Plus it gets complicated if it accidentally gets called as a function again, returning an error. Is this even possible in Javascript?

    Read the article

  • Get "2:35pm" instead of "02:35PM" from Python date/time?

    - by anonymous coward
    I'm still a bit slow with Python, so I haven't got this figured out beyond what's obviously in the docs, etc. I've worked with Django a bit, where they've added some datetime formatting options via template tags, but in regular python code how can I get the 12-hour hour without a leading zero? Is there a straightforward way to do this? I'm looking at the 2.5 and 2.6 docs for "strftime()" and there doesn't seem to be a formatting option there for this case. Should I be using something else? Feel free to include any other time-formatting tips that aren't obvious from the docs. =)

    Read the article

  • Replace non-html links with <A> tags

    - by tombazza
    I have a block of code that will take a block of text like the following: Sample text sample text http://www.google.com sample text Using the preg_replace_callback method and the following regular expression: preg_replace_callback('/http:\/\/([,\%\w.\-_\/\?\=\+\&\~\#\$]+)/', create_function( '$matches', '$url = $matches[1]; $anchorText = ( strlen($url) > 35 ? substr($url, 0, 35).\'...\' : $url); return \'<a href="http://\'. $url .\'">\'. $anchorText .\'</a>\';'), $str); Will convert the sample text to look like: Sample text sample text < a href="http://www.google.com"http://www.google.com< /a sample text My problem now is that we have introduced a rich text editor that can create links before being sent to the script. I need to update this piece of code so that it will ignore any URLs that are already inside an tag.

    Read the article

  • compare date split across colums

    - by alex-tech
    Greetings. I am querying tables from Microsoft SQL 2008 which have date split across 3 columns: day, month and year. Unfortunately, I do not have control over this because data is coming in to the database daily from a 3rd party source in that format. I need to add between to a where clause so user can pull records within a range. Would be easy enough if date was in a single column but finding it nearly impossible when its split across three columns. To display the date, I am doing a CAST( CAST(year as varchar(4)) + '-' + CAST(month as varchar(2)) + '-' + CAST(day as varchar(2)) as date) AS "date"` in a select. I tried to put it as a parameter for datediff function or just the regular between but get no results. Thanks for any help.

    Read the article

< Previous Page | 453 454 455 456 457 458 459 460 461 462 463 464  | Next Page >