Search Results

Search found 13788 results on 552 pages for 'instance caging'.

Page 466/552 | < Previous Page | 462 463 464 465 466 467 468 469 470 471 472 473  | Next Page >

• `enable_shared_from_this` has a non-virtual destructor

  - by Shtééf

  I have a pet project with which I experiment with new features of the upcoming C++0x standard. While I have experience with C, I'm fairly new to C++. To train myself into best practices, (besides reading a lot), I have enabled some strict compiler parameters (using GCC 4.4.1): -std=c++0x -Werror -Wall -Winline -Weffc++ -pedantic-errors This has worked fine for me. Until now, I have been able to resolve all obstacles. However, I have a need for enable_shared_from_this, and this is causing me problems. I get the following warning (error, in my case) when compiling my code (probably triggered by -Weffc++): base class ‘class std::enable_shared_from_this<Package>’ has a non-virtual destructor So basically, I'm a bit bugged by this implementation of enable_shared_from_this, because: A destructor of a class that is intended for subclassing should always be virtual, IMHO. The destructor is empty, why have it at all? I can't imagine anyone would want to delete their instance by reference to enable_shared_from_this. But I'm looking for ways to deal with this, so my question is really, is there a proper way to deal with this? And: am I correct in thinking that this destructor is bogus, or is there a real purpose to it?

  Read the article

• How to handle window closed in the middle of a long running operation gracefully?

  - by Marek

  We have the following method called directly from the UI thread: void DoLengthyProcessing() { DoStuff(); var items = DoMoreStuff(); //do even more stuff - 200 lines of code trimmed this.someControl.PrepareForBigThing(); //someControl is a big user control //additional 100 lines of code that access this.someControl this.someControl.Finish(items); } Many of the called methods call Application.DoEvents() (and they do so many times) (do not ask me why, this is black magic written by black magic programmers and it can not be changed because everyone is scared what the impact would be) and there is also an operation running on a background thread involved in the processing. As a result, the window is not fully nonresponsive and can be closed manually during the processing. The Dispose method of the form "releases" the someControl variable by setting it to null. As a result, in case the user closes the window during the lengthy process, a null reference exception is thrown. How to handle this gracefully without just catching and logging the exception caused by disposal? Assigning the someControl instance to a temporary variable in the beginning of the method - but the control contains many subcontrols with similar disposal scheme - sets them to null and this causes null reference exceptions in other place put if (this.IsDisposed) return; calls before every access of the someControl variable. - making the already nasty long method even longer and unreadable. in Closing event, just indicate that we should close and only hide the window. Dispose it at the end of the lengthy operation. This is not very viable because there are many other methods involved (think 20K LOC for a single control) that would need to handle this mechanism as well. How to most effectively handle window disposal (by user action) in the middle of this kind of processing?

  Read the article

• Automatically creating DynaActionForms in Mockrunner via struts-config.xml

  - by T Reddy

  I'm switching from MockStrutsTestCase to Mockrunner and I'm finding that having to manually re-create all of my DynaActionForms in Mockrunner is a pain...there has to be an easier way?! Can somebody offer a tip to simplify this process? For instance, this form bean definition in struts-config.xml: <form-bean name="myForm" type="org.apache.struts.action.DynaActionForm"> <form-property name="property" type="java.lang.String"/> </form-bean> results in this code in Mockrunner: //define form config FormBeanConfig config = new FormBeanConfig(); config.setName("myForm"); config.setType(DynaActionForm.class.getName()); FormPropertyConfig property = new FormPropertyConfig(); property.setName("property"); property.setType("java.lang.String"); config.addFormPropertyConfig(property); //create mockrunner objects ActionMockObjectFactory factory = new ActionMockObjectFactory(); ActionTestModule module = new ActionTestModule(factory); DynaActionForm form = module.createDynaActionForm(config); Now imagine that I have dozens of DynaActionForms with dozens of attributes...that stinks!

  Read the article

• When should I implement globalization and localization in C#?

  - by Geo Ego

  I am cleaning up some code in a C# app that I wrote and really trying to focus on best practices and coding style. As such, I am running my assembly through FXCop and trying to research each message it gives me to decide what should and shouldn't be changed. What I am currently focusing on are locale settings. For instance, the two errors that I have currently are that I should be specifying the IFormatProvider parameter for Convert.ToString(int), and setting the Dataset and Datatable locale. This is something that I've never done, and never put much thought into. I've always just left that overload out. The current app that I am working on is an internal app for a small company that will very likely never need to run in another country. As such, it is my opinion that I do not need to set these at all. On the other hand, doing so would not be such a big deal, but it seems like it is unneccessary and could hinder readability to a degree. I understand that Microsoft's contention is to use it if it's there, period. Well, I'm technically supposed to call Dispose() on every object that implements IDisposable, but I don't bother doing that with Datasets and Datatables, so I wonder what the practice is "in the wild."

  Read the article

• Returning JSON from JavaScript to Python

  - by Chris Lacy

  I'm writing a simple App Engine app. I have a simple page that allows a user to move a marker on a Google map instance. Each time the user drops the marker, I want to return the long/lat to my Python app. function initialize() { ... // Init map var marker = new GMarker(center, {draggable: true}); GEvent.addListener(marker, "dragend", function() { // I want to return the marker.x/y to my app when this function is called .. }); } To my (admittedly limited) knowledge, I should be: 1). Returning a JSON structure with my required data in the listener callback above 2). In my webapp.RequestHandler Handler class, trying to retrieve the JSON structure during the post method. I would very much like to pass this JSOn data back to the app without causing a page reload (which is what has happened when I've used various post/form.submit methods so far). Can anyone provide me with some psuedo code or an example on how I might achieve what I'm after? Thanks.

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Working with PHP and MySQL - need a good and secure design with OO design

  - by Andrew

  I am new to PHP- first time developer. I am working on my web application and it is nearly done; nevertheless, most of my sql was done directly via code using direct mysql requests. This is the way I approached it: In classes_db.php I declared the db settings and created methods that I use to open and close DB connections. I declare those objects on my regular pages: class classes_db { public $dbserver = 'server; public $dbusername = 'user'; public $dbpassword = 'pass'; public $dbname = 'db'; function openDb() { $dbhandle = mysql_connect($this->dbserver, $this->dbusername, $this->dbpassword); if (!$dbhandle) { die('Could not connect: ' . mysql_error()); } $selected = mysql_select_db($this->dbname, $dbhandle) or die("Could not select the database"); return $dbhandle; } function closeDb($con) { mysql_close($con); } } On my regular page, I do this: <?php require 'classes_db.php'; session_start(); //create instance of the DB class $db = new classes_db(); //get dbhandle $dbhandle = $db->openDb(); //process query $result = mysql_query("update user set username = '" . $usernameFromForm . "' where iduser= " . $_SESSION['user']->iduser); //close the connection if (isset($dbhandle)) { $db->closeDb($dbhandle); } ?> My questions is: how to do it right and make it OO and secure? I know that I need incorporate prepared queries- how to do it the best way? Please provide some code

  Read the article

• SQL Server 2008 Stored Proc suddenly returns -1

  - by aaginor

  I use the following stored procedure from my SQL Server 2008 database to return a value to my C#-Program ALTER PROCEDURE [dbo].[getArticleBelongsToCatsCount] @id int AS BEGIN SET NOCOUNT ON; DECLARE @result int; set @result = (SELECT COUNT(*) FROM art_in_cat WHERE child_id = @id); return @result; END I use a SQLCommand-Object to call this Stored Procedure public int ExecuteNonQuery() { try { return _command.ExecuteNonQuery(); } catch (Exception e) { Logger.instance.ErrorRoutine(e, "Text: " + _command.CommandText); return -1; } } Till recently, everything works fine. All of a sudden, the stored procedure returned -1. At first, I suspected, that the ExecuteNonQuery-Command would have caused and Exception, but when stepping through the function, it shows that no Exception is thrown and the return value comes directly from return _command.ExecuteNonQuery(); I checked following parameters and they were as expected: - Connection object was set to the correct database with correct access values - the parameter for the SP was there and contained the right type, direction and value Then I checked the SP via SQLManager, I used the same value for the parameter like the one for which my C# brings -1 as result (btw. I checked some more parameter values in my C' program and they ALL returned -1) but in the manager, the SP returns the correct value. It looks like the call from my C# prog is somehow bugged, but as I don't get any error (it's just the -1 from the SP), I have no idea, where to look for a solution.

  Read the article

• Java constructor using generic types

  - by Beer Me

  I'm having a hard time wrapping my head around Java generic types. Here's a simple piece of code that in my mind should work, but I'm obviously doing something wrong. Eclipse reports this error in BreweryList.java: The method breweryMethod() is undefined for the type <T> The idea is to fill a Vector with instances of objects that are a subclass of the Brewery class, so the invocation would be something like: BreweryList breweryList = new BreweryList(BrewerySubClass.class, list); BreweryList.java package com.beerme.test; import java.util.Vector; public class BreweryList<T extends Brewery> extends Vector<T> { public BreweryList(Class<T> c, Object[] j) { super(); for (int i = 0; i < j.length; i++) { T item = c.newInstance(); // breweryMethod() is an instance method // of Brewery, of which <T> is a subclass (right?) c.breweryMethod(); // "The method breweryMethod() is undefined // for the type <T>" } } } Brewery.java package com.beerme.test; public class Brewery { public Brewery() { super(); } protected void breweryMethod() { } } BrewerySubClass.java package com.beerme.test; public class BrewerySubClass extends Brewery { public BrewerySubClass() { super(); } public void brewerySubClassMethod() { } } I'm sure this is a complete-generics-noob question, but I'm stuck. Thanks for any tips!

  Read the article

• Inversion of control domain objects construction problem

  - by Andrey

  Hello! As I understand IoC-container is helpful in creation of application-level objects like services and factories. But domain-level objects should be created manually. Spring's manual tells us: "Typically one does not configure fine-grained domain objects in the container, because it is usually the responsibility of DAOs and business logic to create/load domain objects." Well. But what if my domain "fine-grained" object depends on some application-level object. For example I have an UserViewer(User user, UserConstants constants) class. There user is domain object which cannot be injected, but UserViewer also needs UserConstants which is high-level object injected by IoC-container. I want to inject UserConstants from the IoC-container, but I also need a transient runtime parameter User here. What is wrong with the design? Thanks in advance! UPDATE It seems I was not precise enough with my question. What I really need is an example how to do this: create instance of class UserViewer(User user, UserService service), where user is passed as the parameter and service is injected from IoC. If I inject UserViewer viewer then how do I pass user to it? If I create UserViewer viewer manually then how do I pass service to it?

  Read the article

• Cast base class object to derived class

  - by Popgalop

  Lets say I have two classes, animal and dog like this. class Animal { }; class Dog : public Animal { }; And I have an animal object named animal, that is actually an instance of dog, how would I cast it back to dog? This may seem like an odd question, but I need it because I am writing a programming language interpreter, and on the stack everything is stored as a BaseObject, and all the other datatypes extend BaseObject. How would I cast the base object from the stack, to a specific data type? I have tried something like this Dog dog = static_cast<Dog>(animal); But it gives me an error 1>------ Build started: Project: StackTests, Configuration: Debug Win32 ------ 1> StackTests.cpp 1>c:\users\owner\documents\visual studio 2012\projects\stacktests\stacktests\stacktests.cpp(173): error C2440: 'static_cast' : cannot convert from 'Animal' to 'Dog' 1> No constructor could take the source type, or constructor overload resolution was ambiguous 1>c:\users\owner\documents\visual studio 2012\projects\stacktests\stacktests\stacktests.cpp(173): error C2512: 'Dog' : no appropriate default constructor available ========== Build: 0 succeeded, 1 failed, 0 up-to-date, 0 skipped ==========

  Read the article

• Scalability 101: How can I design a scalable web application using PHP?

  - by Legend

  I am building a web-application and have a couple of quick questions. From what I learnt, one should not worry about scalability when initially building the app and should only start worrying when the traffic increases. However, this being my first web-application, I am not quite sure if I should take an approach where I design things in an ad-hoc manner and later "fix" them. I have been reading stories about how people start off with an app that gets millions of users in a week or two. Not that I will face the same situation but I can't help but wonder, how do these people do it? Currently, I bought a shared hosting account on Lunarpages and that got me started in building and testing the application. However, I am interested in learning how to build the same application in a scalable-manner using the cloud, for instance, Amazon's EC2. From my understanding, I can see a couple of components: There is a load balancer that first receives requests and then decides where to route each request This request is then handled by a server replica that then processes the request and updates (if required) the database and sends back the response to the client If a similar request comes in, then a caching mechanism like memcached kicks into picture and returns objects from the cache A blackbox that handles database replication Specifically, I am trying to do the following: Setting up a load balancer (my homework revealed that HAProxy is one such load balancer) Setting up replication so that databases can be synchronized Using memcached Configuring Apache to work with multiple web servers Partitioning application to use Amazon EC2 and Amazon S3 (my application is something that will need great deal of storage) Finally, how can I avoid burning myself when using Amazon services? Because this is just a learning phase, I can probably do with 2-3 servers with a simple load balancer and replication but until I want to avoid paying loads of money accidentally. I am able to find resources on individual topics but am unable to find something that starts off from the big picture. Can someone please help me get started?

  Read the article

• Java: Typecasting to Generics

  - by bguiz

  This method that uses method-level generics, that parses the values from a custom POJO, JXlistOfKeyValuePairs (which is exactly that). The only thing is that both the keys and values in JXlistOfKeyValuePairs are Strings. This method wants to taken in, in addition to the JXlistOfKeyValuePairs instance, a Class<T> that defines which data type to convert the values to (assume that only Boolean, Integer and Float are possible). It then outputs a HashMap with the specified type for the values in its entries. This is the code that I have got, and it is obviously broken. private <T extends Object> Map<String, T> fromListOfKeyValuePairs(JXlistOfKeyValuePairs jxval, Class<T> clasz) { Map<String, T> val = new HashMap<String, T>(); List<Entry> jxents = jxval.getEntry(); T value; String str; for (Entry jxent : jxents) { str = jxent.getValue(); value = null; if (clasz.isAssignableFrom(Boolean.class)) { value = (T)(Boolean.parseBoolean(str)); } else if (clasz.isAssignableFrom(Integer.class)) { value = (T)(Integer.parseInt(str)); } else if (clasz.isAssignableFrom(Float.class)) { value = (T)(Float.parseFloat(str)); } else { logger.warn("Unsupported value type encountered in key-value pairs, continuing anyway: " + clasz.getName()); } val.put(jxent.getKey(), value); } return val; } This is the bit that I want to solve: if (clasz.isAssignableFrom(Boolean.class)) { value = (T)(Boolean.parseBoolean(str)); } else if (clasz.isAssignableFrom(Integer.class)) { value = (T)(Integer.parseInt(str)); } I get: Inconvertible types required: T found: Boolean Also, if possible, I would like to be able to do this with more elegant code, avoiding Class#isAssignableFrom. Any suggestions? Sample method invocation: Map<String, Boolean> foo = fromListOfKeyValuePairs(bar, Boolean.class);

  Read the article

• Java program using a class from a JAR file

  - by Myn

  Hi guys, I'll try to phrase this as best I can. I have a program which has an API-like functionality - it uses reflection to dynamically call methods from within a class. In this instance: Server.java public static void main(String[] args) { Class<?> clazz = Class.forName("DiHandler"); StHandler out = (StHandler) clazz; out.read(); DiHandler.java // implements StHandler import edu.ds.*; public void read() { Ds aType = new Ds(); aType = "134"; } So DiHandler has a method read() which can contain anything, it doesn't matter to Server.java after compile time. My problem is: DiHandler.java uses the class Ds from a JAR file. When I'm working on DiHandler.java in Eclipse (in a separate project from the project Server.java is in) I can add this JAR without a problem. But when I move DiHandler.class, after it's compiled, to be used by Server.class, how can it still use the JAR file? I hope this makes some sense, I suppose another way to phrase it would be how can I allow DiHandler to call on a class from the JAR without editing the classpath? Thanks very much in advance and sorry for any confusion or poor phrasing, I can only offer thanks and the customary offer of a pint for any assistance. M

  Read the article

• jqtouch - panels appear on page, class="back" not working in Safari

  - by user564816

  I'm trying to get a demo working that was used in J. Stark's webinar on Safari Books Online (still available for viewing). I think I've followed the code example correctly, but the class="back" objects used to return from the "blog", "contacts", "settings" and "about" panels do not work, though the correct address shows in the nav area at the base of the browser window when I hover the mouse over the respective link. The panels-- which should slide in and out when called by their respective class"arrow" elements-- appear on the main page, nor do they animate correctly. Browser is Safari 5.0.3(6533.19.4); jquery-1.3.2; jqtouch freshly downloaded from the jqt website. Obviously I'm missing something simple. I'd sincerely appreciate anyone's help who sees what I'm doing wrong. Thanks for considering my question. View the app and source code (use view source in your browser) here. Sat 8 January 2011: 1 48 AM UPDATE in response to JS's comments: Most humble thanks for your note. Didn't want to impose on your server, so the URL for jqtouch.min.css points to a version on my server @ fastermac.net. There's something further amiss, I believe. On load, page still shows the elements that should be invisible until called by clicking class="arrow" elements. Animations not yet wiggling. Did get them to wiggle at one point, but "flip," for instance, landed then on a black page-- not the targeted panel. Probably something obvious, but I'm missing it after some considerable due diligence. Again, thanks for your note. Any further illumination would be sincerely appreciated.

  Read the article

• What's the best way to communicate the purpose of a string parameter in a public API?

  - by Dave

  According to the guidance published in New Recommendations for Using Strings in Microsoft .NET 2.0, the data in a string may exhibit one of the following types of behavior: A non-linguistic identifier, where bytes match exactly. A non-linguistic identifier, where case is irrelevant, especially a piece of data stored in most Microsoft Windows system services. Culturally-agnostic data, which still is linguistically relevant. Data that requires local linguistic customs. Given that, I'd like to know the best way to communicate which behavior is expected of a string parameter in a public API. I wasn't able to find an answer in the Framework Design Guidelines. Consider the following methods: f(string this_is_a_linguistic_string) g(string this_is_a_symbolic_identifier_so_use_ordinal_compares) Is variable naming and XML documentation the best I can do? Could I use attributes in some way to mark the requirements of the string? Now consider the following case: h(Dictionary<string, object> dictionary) Note that the dictionary instance is created by the caller. How do I communicate that the callee expects the IEqualityComparer<string> object held by the dictionary to perform, for example, a case-insensitive ordinal comparison?

  Read the article

• Retrieving a unique result set with Core Data

  - by randombits

  I have a core data based app that manages a bunch of entities. I'm looking to be able to do the following. I have an entity "SomeEntity" with the attributes: name, type, rank, foo1, foo2. Now, SomeEntity has several rows if when we're speaking strictly in SQL terms. What I'm trying to accomplish is to retrieve only available types, even though each instance can have duplicate types. I also need them returned in order according to rank. So in SQL, what I'm looking for is the following: SELECT DISTINCT(type) ORDER BY rank ASC Here is the code I have so far that's breaking: NSError *error = NULL; NSFetchRequest *fetchRequest = [[NSFetchRequest alloc] init]; [fetchRequest setReturnsDistinctResults:YES]; [fetchRequest setPropertiesToFetch:[NSArray arrayWithObjects:@"type", @"rank", nil]]; NSEntityDescription *entity = [NSEntityDescription entityForName:@"SomeEntity" inManagedObjectContext:managedObjectContext]; [fetchRequest setEntity:entity]; // sort by rank NSSortDescriptor *rankDescriptor = [[NSSortDescriptor alloc] initWithKey:@"rank" ascending:YES]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:rankDescriptor,nil]; [fetchRequest setSortDescriptors:sortDescriptors]; [sortDescriptors release]; [rankDescriptor release]; NSArray *fetchResults = [managedObjectContext executeFetchRequest:fetchRequest error:&error]; [fetchRequest release]; return fetchResults; Right now that is crashing with the following: Invalid keypath section passed to setPropertiesToFetch:

  Read the article

• Using external SOAP service in Workflow service

  - by whirlwin

  I am using the .NET 4 framework and have made a WCF Workflow Service Application. I want to use a SOAP web service (.NET 3.5) I have running in another instance of VS. The only method that is exposed is the following: [WebMethod] public string Reverse(string input) { char[] chars = input.ToCharArray(); Array.Reverse(chars); return new string(chars); } I have used the following steps to add the service in my Workflow: Add Service Reference Provided the WSDL (the operation shows in the Operations box as expected) Clicked OK Build the solution to ensure that the service shows in my toolbox Drag the service from the toolbox into the workflow However, when I look at the properties of the service in the workflow, there is no way to specify the input argument or where to store the result of the invocation of the service. I only have the option of specifying some obscure parameters such as Body:InArgument<ReverseRequestBody and outBody:OutArgument<ReverseResponseBody (none of which are strings). Here is a screenshot depicting the properties of the service in the workflow: My question is therefore: Is it possible at all to use the SOAP service by specifying a string as the input argument (like it is meant to be used), and also assign the result to a workflow variable?

  Read the article

• a reusable query with modifications?

  - by fusion

  i'm using this mysql query alongwith php to search for multiple keywords: $query = "SELECT cQuotes, vAuthor, cArabic, vReference FROM ".$table." WHERE ("; $countFields = count($arrayFields); while ($a < $countFields) { while ($b < $countSearch) { $query = $query."$arrayFields[$a] LIKE '%$arraySearch[$b]%'"; $b++; if ($b < $countSearch) { $query = $query." AND "; } } $b = 0; $a++; if ($a < $countFields) { $query = $query.") OR ("; } } $query = $query.")"; $result = mysql_query($query, $conn) i'd like to reuse this query with a few modifications to it (for instance, the WHERE clause remains the same, while i query the number of rows using COUNT), but it doesn't seem practical to repeat the code again for a few additions. any suggestions?

  Read the article

• Adding li element only if it not already there?

  - by Legend

  I am constructing an <li> element like this: var element = $("<li></li>") .html(mHTML) .attr('id', "elemid"); I am trying to add this element to a <ul> element only if it doesn't already exist. Any ideas on how to do this? Am I supposed to use contains() to see if the ul element contain the html and then decide? For instance, <ul id="elemul"> <li id="elemli1">Element 1</li> <li id="elemli2">Element 2</li> <li id="elemli3">Element 3</li> </ul> If I try adding Element 1, it should not add it. What should I do if its a longer string (not really long but about 150 characters). Note: I cannot rely on IDs to determine the uniqueness. i.e. I might end up forming something like: <li id="elemli3">Element 1</li> Do I go about using hashmaps?

  Read the article

• How do you calculate div and mod of floating point numbers?

  - by boost

  In Perl, the % operator seems to assume integers. For instance: sub foo { my $n1 = shift; my $n2 = shift; print "perl's mod=" . $n1 % $n2, "\n"; my $res = $n1 / $n2; my $t = int($res); print "my div=$t", "\n"; $res = $res - $t; $res = $res * $n2; print "my mod=" . $res . "\n\n"; } foo( 3044.952963, 7.1 ); foo( 3044.952963, -7.1 ); foo( -3044.952963, 7.1 ); foo( -3044.952963, -7.1 ); gives perl's mod=6 my div=428 my mod=6.15296300000033 perl's mod=-1 my div=-428 my mod=6.15296300000033 perl's mod=1 my div=-428 my mod=-6.15296300000033 perl's mod=-6 my div=428 my mod=-6.15296300000033 Now as you can see, I've come up with a "solution" already for calculating div and mod. However, what I don't understand is what effect the sign of each argument should have on the result. Wouldn't the div always be positive, being the number of times n2 fits into n1? How's the arithmetic supposed to work in this situation?

  Read the article

• NullReferenceExeption when reading from a file

  - by Whitey

  I need to read a file structured like this: 01000 00030 00500 03000 00020 And put it in an array like this: int[,] iMap = new int[iMapHeight, iMapWidth] { {0, 1, 0, 0, 0}, {0, 0, 0, 3, 0}, {0, 0, 5, 0, 0}, {0, 3, 0, 0, 0}, {0, 0, 0, 2, 0}, }; Hopefully you see what I'm trying to do here. I was confused how to do this so I asked here on SO, but the code I got from it gets this error: Object reference not set to an instance of an object. I'm pretty new to this so I have no idea how to fix it... I only barely know the code: protected void ReadMap(string mapPath) { using (var reader = new StreamReader(mapPath)) { for (int i = 0; i < iMapHeight; i++) { string line = reader.ReadLine(); for (int j = 0; j < iMapWidth; j++) { iMap[i, j] = (int)(line[j] - '0'); } } } } The line I get the error on is this: iMap[i, j] = (int)(line[j] - '0'); Can anyone provide a solution? Thank you. :)

  Read the article

• Returning a reference from a Class member?

  - by nebukadnezzar

  Hi, I've a class that basically looks like this: class App { public function newTemplate($filename, $vars=array()) { $smarty = new Smarty; $smarty->compile_dir = $this->template_compile_path; if(count($vars) > 0) { foreach($vars as $v_key => $v_name) { $smarty->assign($v_key, $v_name); } } return $smarty; } } However, when I create a Instance of 'App', the reference to $smarty seems broken, as every call to the membermethods don't seem to do anything: $app = new App; $tpl = $app->newTemplate("index.tmpl"); $tpl->assign("foo", "bar"); // {$foo} does not appear with "bar" in the template Now I wonder why? Of course I tried to use references: ... public function &newTemplate() ... ... But that doesn't work. Variable references don't seem to work either: ... $tpl = &$app->newTemplate("index.tmpl"); ... What is causing PHP here not to return a proper reference? Help is very appreciated!

  Read the article

• Catch a PHP Object Instantiation Error

  - by Rob Wilkerson

  It's really irking me that PHP considers the failure to instantiate an object a Fatal Error (which can't be caught) for the application as a whole. I have set of classes that aren't strictly necessary for my application to function--they're really a convenience. I have a factory object that attempts to instantiate the class variant that's indicated in a config file. This mechanism is being deployed for message storage and will support multiple store types: DatabaseMessageStore FileMessageStore MemcachedMessageStore etc. A MessageStoreFactory class will read the application's preference from a config file, instantiate and return an instance of the appropriate class. It might be easy enough to slap a conditional around the instantiation to ensure that class_exists(), but MemcachedMessageStore extends PHP's Memcached class. As a result, the class_exists() test will succeed--though instantiation will fail--if the memcached bindings for PHP aren't installed. Is there any other way to test whether a class can be instantiated properly? If it can't, all I need to do is tell the user which features won't be available to them, but let them continue one with the application. Thanks.

  Read the article

• which is better: a lying copy constructor or a non-standard one?

  - by PaulH

  I have a C++ class that contains a non-copyable handle. The class, however, must have a copy constructor. So, I've implemented one that transfers ownership of the handle to the new object (as below) class Foo { public: Foo() : h_( INVALID_HANDLE_VALUE ) { }; // transfer the handle to the new instance Foo( const Foo& other ) : h_( other.Detach() ) { }; ~Foo() { if( INVALID_HANDLE_VALUE != h_ ) CloseHandle( h_ ); }; // other interesting functions... private: /// disallow assignment const Foo& operator=( const Foo& ); HANDLE Detach() const { HANDLE h = h_; h_ = INVALID_HANDLE_VALUE; return h; }; /// a non-copyable handle mutable HANDLE h_; }; // class Foo My problem is that the standard copy constructor takes a const-reference and I'm modifying that reference. So, I'd like to know which is better (and why): a non-standard copy constructor: Foo( Foo& other ); a copy-constructor that 'lies': Foo( const Foo& other ); Thanks, PaulH

  Read the article

< Previous Page | 462 463 464 465 466 467 468 469 470 471 472 473  | Next Page >