Search Results

Search found 12765 results on 511 pages for 'format()'.

Page 470/511 | < Previous Page | 466 467 468 469 470 471 472 473 474 475 476 477  | Next Page >

  • clarification on the concept of "web service"

    - by udit
    Im a little confused on the varying definitions and implementations of web services available as implementations. Need some clarification please. Ones I have used till now: If a vendor gives me a specific format of XML that I can send populated with data to request and I make a simple HTTP POST over the internet passing in the XML String as the payload, is this a web service call ? If so, is there a specific name to it, this kind of web service ? Because obviously, it does not use anything like Axis, WSDL or SOAP to establish this connection. A variant of this is If the vendor gives me an XSD, I use JAXB to make a java class out of it and pass in the serialized version of the object, which eventually works out to be the same as option 1. RESTful web service: Vendor gives me a URL like http://restfulservice/products and I can make HTTP Requests to the URL and depending on what HTTP verb I use, the appropropriate action is called and the response sent over the wire. Ones I have only read about\ have a vague idea about SOAP. How does this work?.. Ive read the W3Schools tutorial and I undertsand that there is a very specific form of XML that is standardized according to W3C standards that we use to pass the same kind of messages as we did in option 1. But how does this work in real life? Vendor sends me what? Do I generate classes? Do I serialize some objects and http post them over to an address? Or do the generated objects themselves have connection methods that will do them for me? What about WSDL? When does a vendor send me WSDL and what do I do with it ? I guess I can generate classes from it. If yes, then what do I do with the generated classes ? When do I need that axis jar to generate classes from something that the vendor sends ? As you can see, I have some clear and other mostly vague ideas about the different kinds of web services available. would help if someone ould clarify and\or point to more real-world resources. I've looked a little bit into Java Web Services on the internet and the numerous four letter acronyms that get thrown at me make me dizzy. Thanks

    Read the article

  • Improving performance on data pasting 2000 rows with validations

    - by Lohit
    I have N rows (which could be nothing less than 1000) on an excel spreadsheet. And in this sheet our project has 150 columns like this: Now, our application needs data to be copied (using normal Ctrl+C) and pasted (using Ctrl+V) from the excel file sheet on our GUI sheet. Copy pasting 1000 records takes around 5-6 seconds which is okay for our requirement, but the problem is when we need to make sure the data entered is valid. So we have to validate data in each row generate appropriate error messages and format the data as per requirement. So we need to at runtime parse and evaluate data in each row. Now all the formatting of data and validations come from the back-end database and we have it in a data-table (dtValidateAndFormatConditions). The conditions would be around 50. So you can see how slow this whole process becomes since N X 150 X 50 operations are required to complete this whole process. Initially it took approximately 2-3 minutes but now i have reduced it to 20 - 30 seconds. However i have increased the speed by making an expression parser of my own - and not by any algorithm, is there any other way i can improve performance, by using Divide and Conquer or some other mechanism. Currently i am not really sure how to go about this. Here is what part of my code looks like: public virtual void ValidateAndFormatOnCopyPaste(DataTable DtCopied, int CurRow) { foreach (DataRow dRow in dtValidateAndFormatConditions.Rows) { string Condition = dRow["Condition"]; string FormatValue = Value = dRow["Value"]; GetValidatedFormattedData(DtCopied,ref Condition, ref FormatValue ,iRowIndex); Condition = Parse(Condition); dRow["Condition"] = Condition; FormatValue = Parse(FormatValue ); dRow["Value"] = FormatValue; } } The above code gets called row-wise like this: public override void ValidateAndFormat(DataTable dtChangedRecords, CellRange cr) { int iRowStart = cr.Row, iRowEnd = cr.Row + cr.RowCount; for (int iRow = iRowStart; iRow < iRowEnd; iRow++) { ValidateAndFormatOnCopyPaste(dtChangedRecords,iRow); } } Please know my question needs a more algorithmic solution than code optimization, however any answers containing code related optimizations will be appreciated as well. (Tagged Linq because although not seen i have been using linq in some parts of my code).

    Read the article

  • youtube - video upload failure - unable to convert file - encoding the video wrong?

    - by Anthony
    I am using .NET to create a video uploading application. Although it's communicating with YouTube and uploading the file, the processing of that file fails. YouTube gives me the error message, "Upload failed (unable to convert video file)." This supposedly means that "your video is in a format that our converters don't recognize..." I have made attempts with two different videos, both of which upload and process fine when I do it manually. So I suspect that my code is a.) not encoding the video properly and/or b.) not sending my API request properly. Below is how I am constructing my API PUT request and encoding the video: Any suggestions on what the error could be would be appreciated. Thanks P.S. I'm not using the client library because my application will use the resumable upload feature. Thus, I am manually constructing my API requests. Documentation: http://code.google.com/intl/ja/apis/youtube/2.0/developers_guide_protocol_resumable_uploads.html#Uploading_the_Video_File Code: // new PUT request for sending video WebRequest putRequest = WebRequest.Create(uploadURL); // set properties putRequest.Method = "PUT"; putRequest.ContentType = getMIME(file); //the MIME type of the uploaded video file //encode video byte[] videoInBytes = encodeVideo(file); public static byte[] encodeVideo(string video) { try { byte[] fileInBytes = File.ReadAllBytes(video); Console.WriteLine("\nSize of byte array containing " + video + ": " + fileInBytes.Length); return fileInBytes; } catch (Exception e) { Console.WriteLine("\nException: " + e.Message + "\nReturning an empty byte array"); byte [] empty = new byte[0]; return empty; } }//encodeVideo //encode custom headers in a byte array byte[] PUTbytes = encode(putRequest.Headers.ToString()); public static byte[] encode(string headers) { ASCIIEncoding encoding = new ASCIIEncoding(); byte[] bytes = encoding.GetBytes(headers); return bytes; }//encode //entire request contains headers + binary video data putRequest.ContentLength = PUTbytes.Length + videoInBytes.Length; //send request - correct? sendRequest(putRequest, PUTbytes); sendRequest(putRequest, videoInBytes); public static void sendRequest(WebRequest request, byte[] encoding) { Stream stream = request.GetRequestStream(); // The GetRequestStream method returns a stream to use to send data for the HttpWebRequest. try { stream.Write(encoding, 0, encoding.Length); } catch (Exception e) { Console.WriteLine("\nException writing stream: " + e.Message); } }//sendRequest

    Read the article

  • Renaming nodes and values with xslt

    - by T.K.
    Hello world, I'm new to xslt, and have a task that I'm not really sure where to go with. I want to rename nodes, but maintain the format all node declarations. In the actual context I'll be applying this to, I'll be doing a series of renames like this, but for the sake of brevity, the sample I've written up only involves renaming one node. I am using XSL 1.0. Input: <variables> <var> <RENAME> a </RENAME> </var> <var RENAME='b'/> <var> <DO_NOT_TOUCH> c </DO_NOT_TOUCH> </var> <var DO_NOT_TOUCH='d'/> </variables> Desired Output: <variables> <var> <DONE> a </DONE> </var> <var DONE='b'/> <var> <DO_NOT_TOUCH> c </DO_NOT_TOUCH> </var> <var DO_NOT_TOUCH='d'/> </variables> My xslt: <xsl:template match="RENAME"> <RENAMED> <xsl:apply-templates select="@*|node()"/> </RENAMED> </xsl:template> <xsl:template match="@*|node()"> <xsl:copy> <xsl:apply-templates select="@*|node()"/> </xsl:copy> </xsl:template> Current Output <variables> <var> <RENAMED> a </RENAMED> </var> <var RENAME="b"> </var> <var> <DO_NOT_TOUCH> c </DO_NOT_TOUCH> </var> <var DO_NOT_TOUCH="d"> </var> </variables>

    Read the article

  • using LoadControl with object initializer to create properties

    - by lloydphillips
    In the past I've used UserControls to create email templates which I can fill properties on and then use LoadControl and then RenderControl to get the html for which to use for the body text of my email. This was within asp.net webforms. I'm in the throws of building an mvc website and wanted to do something similar. I've actually considered putting this functionality in a seperate class library and am looking into how I can do this so that in my web layer I can just call EmailTemplate.SubscriptionEmail() which will then generate the html from my template with properties in relevant places (obviously there needs to be parameters for email address etc in there). I wanted to create a single Render control method for which I can pass a string to the path of the UserControl which is my template. I've come across this on the web that kind of suits my needs: public static string RenderUserControl(string path, string propertyName, object propertyValue) { Page pageHolder = new Page(); UserControl viewControl = (UserControl)pageHolder.LoadControl(path); if (propertyValue != null) { Type viewControlType = viewControl.GetType(); PropertyInfo property = viewControlType.GetProperty(propertyName); if (property != null) property.SetValue(viewControl, propertyValue, null); else { throw new Exception(string.Format( "UserControl: {0} does not have a public {1} property.", path, propertyName)); } } pageHolder.Controls.Add(viewControl); StringWriter output = new StringWriter(); HttpContext.Current.Server.Execute(pageHolder, output, false); return output.ToString(); } My issue is that my UserControl(s) may have multiple and differing properties. So SubscribeEmail may require FirstName and EmailAddress where another email template UserControl (lets call it DummyEmail) would require FirstName, EmailAddress and DateOfBirth. The method above only appears to carry one parameter for propertyName and propertyValue. I considered an array of strings that I could put the varying properties into but then I thought it'd be cool to have an object intialiser so I could call the method like this: RenderUserControl("EmailTemplates/SubscribeEmail.ascs", new object() { Firstname="Lloyd", Email="[email protected]" }) Does that make sense? I was just wondering if this is at all possible in the first place and how I'd implement it? I'm not sure if it would be possible to map the properties set on 'object' to properties on the loaded user control and if it is possible where to start in doing this? Has anyone done something like this before? Can anyone help? Lloyd

    Read the article

  • How do I do distributed UML development (à la FOSS)?

    - by James A. Rosen
    I have a UML project (built in IBM's Rational System Architect/Modeler, so stored in their XML format) that has grown quite large. Additionally, it now contains several pieces that other groups would like to re-use. I come from a software development (especially FOSS) background, and am trying to understand how to use that as an analogy here. The problem I am grappling with is similar to the Fragile Base Class problem. Let me start with how it works in an object-oriented (say, Java or Ruby) FOSS ecosystem: Group 1 publishes some "core" package, say "net/smtp version 1.0" Group 2 includes Group 1's net/smtp 1.0 package in the vendor library of their software project At some point, Group 1 creates a new 2.0 branch of net/smtp that breaks backwards compatibility (say, it removes an old class or method, or moves a class from one package to another). They tell users of the 1.0 version that it will be deprecated in one year. Group 2, when they have the time, updates to net/smtp 2.0. When they drop in the new package, their compiler (or test suite, for Ruby) tells them about the incompatibility. They do have to make some manual changes, but all of the changes are in the code, in plain text, a medium with which they are quite familiar. Plus, they can often use their IDE's (or text editor's) "global-search-and-replace" function once they figure out what the fixes are. When we try to apply this model to UML in RSA, we run into some problems. RSA supports some fairly powerful refactorings, but they seem to only work if you have write access to all of the pieces. If I rename a class in one package, RSA can rename the references, but only at the same time. It's very difficult to look at the underlying source (the XML) and figure out what's broken. To fix such a problem in the RSA editor itself means tons of clicking on things -- there is no good equivalent of "global-search-and-replace," at least not after an incomplete refactor. They real sticking point seems to be that RSA assumes that you want to do all your editing using their GUI, but that makes certain operations prohibitively difficult. Does anyone have examples of open-source UML projects that have overcome this problem? What strategies do they use for communicating changes?

    Read the article

  • How to develop a Jquery plugin to find the first child that match with a selector?

    - by Ivan
    I'm trying to make a Jquery plugin (findFirst()) to find the first child with a given characteristics (something in the middle of the find() and children() functions. For instance, given this markup: <div id="start"> <div> <span>Hello world</span> <ul class="valid-result"> ... </ul> <ul class="valid-result"> <li> <ul class="not-a-result"> ... </ul> </li> </ul> <div> <ul class="valid-result"> ... </ul> </div> </div> </div> If you ask for $("#start").findFirst('ul') it should return all ul lists that I have tagged with the valid-result class, but not the ul with class not-a-result. It is, this function has to find the first elements that matches with a given selector, but not the inner elements that match this selector. This is the first time I try to code a Jquery function, and what I've already read doesn't helps me too much with this. The function I have developed is this: jQuery.fn.findFirst = function (sel) { return this.map(function() { return $(this).children().map(function() { if ($(this).is(sel)) { return $(this); } else { return $(this).findFirst(sel); } }); }); } It works in the sense it tries to return the expected result, but the format it returns the result is very rare for me. I suppose the problem is something I don't understand about Jquery. Here you have the JFiddle where I'm testing. EDIT The expected result after $("#start").findFirst('ul') is a set with all UL that have the class 'valid-result' BUT it's not possible to use this class because it doesn't exist in a real case (it's just to try to explain the result). This is not equivalent to first(), because first returns only one element!

    Read the article

  • Mult-line Svg tooltip

    - by John Vaughan
    I have created numerous polygon shapes in SVG format. and grouped them together. When the user hovers over the group a tooltip box appear. I have used ecmascript. What i am looking to do is make the tooltip box a multiline box. Any ideas how to do this? <script type="text/ecmascript"> <![CDATA[ function init(evt) { if ( window.svgDocument == null ) { svgDocument = evt.target.ownerDocument; } tooltip = svgDocument.getElementById('tooltip'); tooltip_bg = svgDocument.getElementById('tooltip_bg'); } function ShowTooltip(evt, mouseovertext) { tooltip.setAttributeNS(null,"x",evt.clientX+17); tooltip.setAttributeNS(null,"y",evt.clientY+14); tooltip.firstChild.data = mouseovertext; tooltip.setAttributeNS(null,"visibility","visible"); length = tooltip.getComputedTextLength(); tooltip_bg.setAttributeNS(null,"width",length+8); tooltip_bg.setAttributeNS(null,"x",evt.clientX+14); tooltip_bg.setAttributeNS(null,"y",evt.clientY+1); tooltip_bg.setAttributeNS(null,"visibility","visibile"); } function HideTooltip(evt) { tooltip.setAttributeNS(null,"visibility","hidden"); tooltip_bg.setAttributeNS(null,"visibility","hidden"); } ]]> </script> <SVG> <g onmousemove="ShowTooltip(evt, 'GHANA 2000')" onmouseout="HideTooltip(evt)"> <path fill="#EEEEEE" d="M250,0c47,0,85.183,10.506,125,33.494L250,250V0z"/> <path id="score" d="M250,57c36.284,0,65.761,8.11,96.5,25.857L250,250V57z"/> <path fill="none" stroke="#FFFFFF" stroke-width="2" stroke-miterlimit="10" d="M250,0c47,0,85.183,10.506,125,33.494L250,250V0z"/> <text transform="matrix(1 0 0 1 283.9883 92.0024)" fill="#FFFFFF" font-family="'WalkwayBlack'" font-size="16">62</text> </g> <rect class="tooltip_bg" id="tooltip_bg" x="0" y="0" width="55" height="17" visibility="hidden"/> <text class="tooltip" id="tooltip" x="0" y="0" visibility="hidden">Tooltip</text> <SVG>

    Read the article

  • Why won't C# accept a (seemingly) perfectly good Sql Server CE Query?

    - by VoidKing
    By perfectly good sql query, I mean to say that, inside WebMatrix, if I execute the following query, it works to perfection: SELECT page AS location, (len(page) - len(replace(UPPER(page), UPPER('o'), ''))) / len('o') AS occurences, 'pageSettings' AS tableName FROM PageSettings WHERE page LIKE '%o%' UNION SELECT pageTitle AS location, (len(pageTitle) - len(replace(UPPER(pageTitle), UPPER('o'), ''))) / len('o') AS occurences, 'ExternalSecondaryPages' AS tableName FROM ExternalSecondaryPages WHERE pageTitle LIKE '%o%' UNION SELECT eventTitle AS location, (len(eventTitle) - len(replace(UPPER(eventTitle), UPPER('o'), ''))) / len('o') AS occurences, 'MainStreetEvents' AS tableName FROM MainStreetEvents WHERE eventTitle LIKE '%o%' Here i am using 'o' as a static search string to search upon. No problem, but not exeactly very dynamic. Now, when I write this query as a string in C# and as I think it should be (and even as I have done before) I get a server-side error indicating that the string was not in the correct format. Here is a pic of that error: And (although I am only testing the output, should I get it to quit erring), here is the actual C# (i.e., the .cshtml) page that queries the database: @{ Layout = "~/Layouts/_secondaryMainLayout.cshtml"; var db = Database.Open("Content"); string searchText = Request.Unvalidated["searchText"]; string selectQueryString = "SELECT page AS location, (len(page) - len(replace(UPPER(page), UPPER(@0), ''))) / len(@0) AS occurences, 'pageSettings' AS tableName FROM PageSettings WHERE page LIKE '%' + @0 + '%' "; selectQueryString += "UNION "; selectQueryString += "SELECT pageTitle AS location, (len(pageTitle) - len(replace(UPPER(pageTitle), UPPER(@0), ''))) / len(@0) AS occurences, 'ExternalSecondaryPages' AS tableName FROM ExternalSecondaryPages WHERE pageTitle LIKE '%' + @0 + '%' "; selectQueryString += "UNION "; selectQueryString += "SELECT eventTitle AS location, (len(eventTitle) - len(replace(UPPER(eventTitle), UPPER(@0), ''))) / len(@0) AS occurences, 'MainStreetEvents' AS tableName FROM MainStreetEvents WHERE eventTitle LIKE '%' + @0 + '%'"; @:beginning <br/> foreach (var row in db.Query(selectQueryString, searchText)) { @:entry @:@row.location &nbsp; @:@row.occurences &nbsp; @:@row.tableName <br/> } } Since it is erring on the foreach (var row in db.Query(selectQueryString, searchText)) line, that heavily suggests that something is wrong with my query, however, everything seems right to me about the syntax here and it even executes to perfection if I query the database (mind you, un-parameterized) directly. Logically, I would assume that I have erred somewhere with the syntax involved in parameterizing this query, however, my double and triple checking (as well as, my past experience at doing this) insists that everything looks fine here. Have I messed up the syntax involved with parameterizing this query, or is something else at play here that I am overlooking? I know I can tell you, for sure, as it has been previously tested, that the value I am getting from the query string is, indeed, what I would expect it to be, but as there really isn't much else on the .cshtml page yet, that is about all I can tell you.

    Read the article

  • MATLAB image corner coordinates & referncing to cell arrays

    - by James
    Hi, I am having some problems comparing the elements in different cell arrays. The context of this problem is that I am using the bwboundaries function in MATLAB to trace the outline of an image. The image is of a structural cross section and I am trying to find if there is continuity throughout the section (i.e. there is only one outline produced by the bwboundaries command). Having done this and found where the is more than one section traced (i.e. it is not continuous), I have used the cornermetric command to find the corners of each section. The code I have is: %% Define the structural section as a binary matrix (Image is an I-section with the web broken) bw(20:40,50:150) = 1; bw(160:180,50:150) = 1; bw(20:60,95:105) = 1; bw(140:180,95:105) = 1; Trace = bw; [B] = bwboundaries(Trace,'noholes'); %Traces the outer boundary of each section L = length(B); % Finds number of boundaries if L > 1 disp('Multiple boundaries') % States whether more than one boundary found end %% Obtain perimeter coordinates for k=1:length(B) %For all the boundaries perim = B{k}; %Obtains perimeter coordinates (as a 2D matrix) from the cell array end %% Find the corner positions C = cornermetric(bw); Areacorners = find(C == max(max(C))) % Finds the corner coordinates of each boundary [rowindexcorners,colindexcorners] = ind2sub(size(Newgeometry),Areacorners) % Convert corner coordinate indexes into subcripts, to give x & y coordinates (i.e. the same format as B gives) %% Put these corner coordinates into a cell array Cornerscellarray = cell(length(rowindexcorners),1); % Initialises cell array of zeros for i =1:numel(rowindexcorners) Cornerscellarray(i) = {[rowindexcorners(i) colindexcorners(i)]}; %Assigns the corner indicies into the cell array %This is done so the cell arrays can be compared end for k=1:length(B) %For all the boundaries found perim = B{k}; %Obtains coordinates for each perimeter Z = perim; % Initialise the matrix containing the perimeter corners Sectioncellmatrix = cell(length(rowindexcorners),1); for i =1:length(perim) Sectioncellmatrix(i) = {[perim(i,1) perim(i,2)]}; end for i = 1:length(perim) if Sectioncellmatrix(i) ~= Cornerscellarray Sectioncellmatrix(i) = []; %Gets rid of the elements that are not corners, but keeps them associated with the relevent section end end end This creates an error in the last for loop. Is there a way I can check whether each cell of the array (containing an x and y coordinate) is equal to any pair of coordinates in cornercellarray? I know it is possible with matrices to compare whether a certain element matches any of the elements in another matrix. I want to be able to do the same here, but for the pair of coordinates within the cell array. The reason I don't just use the cornercellarray cell array itself, is because this lists all the corner coordinates and does not associate them with a specific traced boundary.

    Read the article

  • j2me bluetooth client. Function startInquiry nothing found.

    - by Hugi
    I develop simple j2me bluetooth client and have problem with bluetooth device search. Function startInquiry nothing found. Client : nokia 5220 Server : my pc with bluetooth adapter All bluetooth devices is on. /* * To change this template, choose Tools | Templates * and open the template in the editor. */ import javax.microedition.midlet.*; import javax.bluetooth.*; import java.util.Vector; import javax.microedition.lcdui.*; /** * @author ????????????? */ public class Midlet extends MIDlet implements DiscoveryListener { private static Vector vecDevices=new Vector(); private static String connectionURL=null; private LocalDevice localDevice; private DiscoveryAgent agent; private RemoteDevice remoteDevice; private RemoteDevice[] devList; private Display display; private Form form; public void startApp() { display = Display.getDisplay(this); form = new Form( "Client" ); try { localDevice = LocalDevice.getLocalDevice(); } catch( BluetoothStateException e ) { e.printStackTrace(); } form.append("Address: "+localDevice.getBluetoothAddress()+"\n\n"); form.append("Name: "+localDevice.getFriendlyName()+"\n\n"); try { agent = localDevice.getLocalDevice().getDiscoveryAgent(); form.append("Starting device inquiry... \n\n"); boolean si = agent.startInquiry(DiscoveryAgent.GIAC, this); if ( si ) { form.append("true"); } else { form.append("false"); } } catch( BluetoothStateException e ) { } int deviceCount = vecDevices.size(); if(deviceCount <= 0){ form.append("No Devices Found ."); } else{ //print bluetooth device addresses and names in the format [ No. address (name) ] form.append("Bluetooth Devices: "); for (int i = 0; i < deviceCount; i++) { remoteDevice=(RemoteDevice)vecDevices.elementAt(i); form.append( remoteDevice.getBluetoothAddress() ); } } display.setCurrent(form); } public void pauseApp() { } public void destroyApp(boolean unconditional) { } public void deviceDiscovered(RemoteDevice btDevice, DeviceClass cod) { //add the device to the vector if(!vecDevices.contains(btDevice)){ vecDevices.addElement(btDevice); } } public void inquiryCompleted(int discType) { } //implement this method since services are not being discovered public void servicesDiscovered(int transID, ServiceRecord[] servRecord) { if(servRecord!=null && servRecord.length>0){ connectionURL=servRecord[0].getConnectionURL(0,false); } } //implement this method since services are not being discovered public void serviceSearchCompleted(int transID, int respCode) { } }

    Read the article

  • Use of text() function when using xPath in dom4j

    - by jlawless
    I have inherited an application that parses xml using dom4j and xPath: The xml being parsed is similar to the following: <cache> <content> <transaction> <page> <widget name="PAGE_ID">WRK_REGISTRATION</widget> <widget name="TRANS_DETAIL_ID">77145</widget> <widget name="GRD_ERRORS" /> </page> <page> <widget name="PAGE_ID">WRK_REGISTRATION</widget> <widget name="TRANS_DETAIL_ID">77147</widget> <widget name="GRD_ERRORS" /> </page> <page> <widget name="PAGE_ID">WRK_PROCESSING</widget> <widget name="TRANS_DETAIL_ID">77152</widget> <widget name="GRD_ERRORS" /> </page> </transaction> </content> </cache> Individual Nodes are being searched using the following: String xPathToGridErrorNode = "//cache/content/transaction/page/widget[@name='PAGE_ID'][text()='WRK_DNA_REGISTRATION']/../widget[@name='TRANS_DETAIL_ID'][text()='77147']/../widget[@name='GRD_ERRORS_TEMP']"; org.dom4j.Element root = null; SAXReader reader = new SAXReader(); Document document = reader.read(new BufferedInputStream(new ByteArrayInputStream(xmlToParse.getBytes()))); root = document.getRootElement(); Node gridNode = root.selectSingleNode(xPathToGridErrorNode); where xmlToParse is a String of xml similar to the excerpt provided above. The code is trying to obtain the GRD_ERROR node for the page with the PAGE_ID and TRANS_DETAIL_ID provided in the xPath. I am seeing an intermittent (~1-2%) failure (returned node is null) of this selectSingleNode request even though the requested node is in the xml being searched. I know there are some gotchas associated with using text()= in xPath and was wondering if there was a better way to format the xPath string for this type of search.

    Read the article

  • Activity gets killed while executing the camera intent

    - by BlackRider
    In my app I call the system camera to take a picture, and then handle the result in onActivityResult. You know, the usual. It used to work, but now my calling activity gets killed while I'm taking the picture. Specifically, onDestroy() is called on my activity right after I press the camera shutter. The photo does get taken & saved (I've checked that the file gets written on the SD card). After I accept the photo, instead of returning to the calling activity and invoking onActivityResult, the previous activity in the activity stack gets called. I see no exceptions in the logcat. My custom exception handler doesn't get called. If it matters, my app also includes a service that listens to GPS updates, but I unregister all the receivers in onPause(). Here's the call stack for MyCallingActivity.onDestroy(): Thread [<1> main] (Suspended (breakpoint at line 303 in NewPlaceDetailsActivity)) NewPlaceDetailsActivity.onDestroy() line: 303 ActivityThread.performDestroyActivity(IBinder, boolean, int, boolean) line: 2663 ActivityThread.handleDestroyActivity(IBinder, boolean, int, boolean) line: 2694 ActivityThread.access$2100(ActivityThread, IBinder, boolean, int, boolean) line: 117 BinderProxy(ActivityThread$H).handleMessage(Message) line: 968 ActivityThread$H(Handler).dispatchMessage(Message) line: 99 Looper.loop() line: 130 ActivityThread.main(String[]) line: 3687 Method.invokeNative(Object, Object[], Class, Class[], Class, int, boolean) line: not available [native method] Method.invoke(Object, Object...) line: 507 ZygoteInit$MethodAndArgsCaller.run() line: 842 ZygoteInit.main(String[]) line: 600 NativeStart.main(String[]) line: not available [native method] This is how I start the camera activity, in case you're wondering: protected void startCamera() { createPhotoDirsIfNeeded(); String fileName = "temp.jpg"; ContentValues values = new ContentValues(); values.put(MediaStore.Images.Media.TITLE, fileName); m_capturedImageUri = getContentResolver().insert(MediaStore.Images.Media.EXTERNAL_CONTENT_URI, values); m_photoFileName = APP_PHOTO_PATH + "/" + DateFormat.format(DATE_FORMAT, Calendar.getInstance().getTime()) + ".jpg"; File picFile = new File(m_photoFileName); if(picFile.exists()) { picFile.delete(); } // start the camera activity Intent intent = new Intent(MediaStore.ACTION_IMAGE_CAPTURE); intent.putExtra(MediaStore.EXTRA_OUTPUT, Uri.fromFile(picFile)); startActivityForResult(intent, IntentHelper.REQUEST_TAKE_PHOTO); } How can I find out why does my activity get killed, AND removed from the stack instead of being created again?

    Read the article

  • Internet Explorer 8 + Deflate

    - by Andreas Bonini
    I have a very weird problem.. I really do hope someone has an answer because I wouldn't know where else to ask. I am writing a cgi application in C++ which is executed by Apache and outputs HTML code. I am compressing the HTML output myself - from within my C++ application - since my web host doesn't support mod_deflate for some reason. I tested this with Firefox 2, Firefox 3, Opera 9, Opera 10, Google Chrome, Safari, IE6, IE7, IE8, even wget.. It works with ANYTHING except IE8. IE8 just says "Internet Explorer cannot display the webpage", with no information whatsoever. I know it's because of the compression only because it works if I disable it. Do you know what I'm doing wrong? I use zlib to compress it, and the exact code is: /* Compress it */ int compressed_output_size = content.length() + (content.length() * 0.2) + 16; char *compressed_output = (char *)Alloc(compressed_output_size); int compressed_output_length; Compress(compressed_output, compressed_output_size, (void *)content.c_str(), content.length(), &compressed_output_length); /* Send the compressed header */ cout << "Content-Encoding: deflate\r\n"; cout << boost::format("Content-Length: %d\r\n") % compressed_output_length; cgiHeaderContentType("text/html"); cout.write(compressed_output, compressed_output_length); static void Compress(void *to, size_t to_size, void *from, size_t from_size, int *final_size) { int ret; z_stream stream; stream.zalloc = Z_NULL; stream.zfree = Z_NULL; stream.opaque = Z_NULL; if ((ret = deflateInit(&stream, CompressionSpeed)) != Z_OK) COMPRESSION_ERROR("deflateInit() failed: %d", ret); stream.next_out = (Bytef *)to; stream.avail_out = (uInt)to_size; stream.next_in = (Bytef *)from; stream.avail_in = (uInt)from_size; if ((ret = deflate(&stream, Z_NO_FLUSH)) != Z_OK) COMPRESSION_ERROR("deflate() failed: %d", ret); if (stream.avail_in != 0) COMPRESSION_ERROR("stream.avail_in is not 0 (it's %d)", stream.avail_in); if ((ret = deflate(&stream, Z_FINISH)) != Z_STREAM_END) COMPRESSION_ERROR("deflate() failed: %d", ret); if ((ret = deflateEnd(&stream)) != Z_OK) COMPRESSION_ERROR("deflateEnd() failed: %d", ret); if (final_size) *final_size = stream.total_out; return; }

    Read the article

  • Need help helping in converting jquery, ajax, json and asp.net

    - by Haja Mohaideen
    I am tying out this tutorial, http://www.ezzylearning.com/tutorial.aspx?tid=5869127. It works perfectly. What I am now trying to do is to host the aspx contents as html file. This html file is hosted on my wampserver which is on my laptop. The asp.net code hosted on my test server. When I try to access, I get the following error, Resource interpreted as Script but transferred with MIME type text/html: "http://201.x.x.x/testAjax/Default.aspx/AddProductToCart?callback=jQuery17103264484549872577_1346923699990&{%20pID:%20%226765%22,%20qty:%20%22100%22,%20lblType:%20%2220%22%20}&_=1346923704482". jquery.min.js:4 Uncaught SyntaxError: Unexpected token < I am not sure how to solve this problem. index.html code $(function () { $('#btnAddToCart').click(function () { var result = $.ajax({ type: "POST", url: "http://202.161.45.124/testAjax/Default.aspx/AddProductToCart", crossDomain: true, data: '{ pID: "6765", qty: "100", lblType: "20" }', contentType: "application/json; charset=utf-8", dataType: "jsonp", success: succeeded, failure: function (msg) { alert(msg); }, error: function (xhr, err) { alert(err); } }); }); }); function succeeded(msg) { alert(msg.d); } function btnAddToCart_onclick() { } </script> </head> <body> <form name="form1" method="post"> <div> <input type="button" id="btnAddToCart" onclick="return btnAddToCart_onclick()" value="Button" /> </div> </form> aspx.vb Imports System.Web.Services Imports System.Web.Script.Services <ScriptService()> Public Class WebForm1 Inherits Page Protected Sub Page_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load Session("test") = "" End Sub <WebMethod()> <ScriptMethod(UseHttpGet:=False, ResponseFormat:=ResponseFormat.Json)> Public Shared Function AddProductToCart(pID As String, qty As String, lblType As String) As String Dim selectedProduct As String = String.Format("+ {0} - {1} - {2}", pID, qty, lblType) HttpContext.Current.Session("test") += selectedProduct Return HttpContext.Current.Session("test").ToString() End Function End Class

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • Paging & Sorting grids with ASP.Net MVC

    - by Scott Ivey
    I'm new to MVC, and am not following how you'd do paging and sorting on a grid. I'm used to using the asp.Net GridView control with an ObjectDataSource pointed at objects in our business layer - and in that case the ODS handles all of the paging & sorting using the methods that our ORM generates on the objects. I've looked at using the same ORM with MVC - and things work out fine there - i just loop thru the collections to build the table on the page - but without the ODS to handle the paging & sorting, i'm confused as to how I'd handle that. Would I have a separate controller for the paging and sorting? I'm not sure what the best practices are for this scenario, so if someone can point me in the right direction it would be much appreciated. Edit: Ok, so I understand that I need to roll my own - but where do I start? I've created a CustomerController, and a view that displays a table of customers that looks like below - and I want to sort on FirstName or LastName columns. My Model has a Sort() method on it that'll take a string sort expression in the format that would be used by a GridView/ODS pair. Would I create a new Action on my CustomerController called Sort, and put an ActionLink in my header? <table> <tr> <th> First Name </th> <th> Last Name </th> </tr> <% foreach (var item in Model) { %> <tr> <td> <%= Html.Encode(item.FirstName) %> </td> <td> <%= Html.Encode(item.LastName) %> </td> </tr> <% } %> </table>

    Read the article

  • Generating Unordered List with PHP + CodeIgniter from a MySQL Database

    - by Tim
    Hello Everyone, I am trying to build a dynamically generated unordered list in the following format using PHP. I am using CodeIgniter but it can just be normal php. This is the end output I need to achieve. <ul id="categories" class="menu"> <li rel="1"> Arts &amp; Humanities <ul> <li rel="2"> Photography <ul> <li rel="3"> 3D </li> <li rel="4"> Digital </li> </ul> </li> <li rel="5"> History </li> <li rel="6"> Literature </li> </ul> </li> <li rel="7"> Business &amp; Economy </li> <li rel="8"> Computers &amp; Internet </li> <li rel="9"> Education </li> <li rel="11"> Entertainment <ul> <li rel="12"> Movies </li> <li rel="13"> TV Shows </li> <li rel="14"> Music </li> <li rel="15"> Humor </li> </ul> </li> <li rel="10"> Health </li> And here is my SQL that I have to work with. -- -- Table structure for table `categories` -- CREATE TABLE IF NOT EXISTS `categories` ( `id` mediumint(8) NOT NULL auto_increment, `dd_id` mediumint(8) NOT NULL, `parent_id` mediumint(8) NOT NULL, `cat_name` varchar(256) NOT NULL, `cat_order` smallint(4) NOT NULL, PRIMARY KEY (`id`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=1 ; So I know that I am going to need at least 1 foreach loop to generate the first level of categories. What I don't know is how to iterate inside each loop and check for parents and do that in a dynamic way so that there could be an endless tree of children. Thanks for any help you can offer. Tim

    Read the article

  • gcc optimization? bug? and its practial implication to project

    - by kumar_m_kiran
    Hi All, My questions are divided into three parts Question 1 Consider the below code, #include <iostream> using namespace std; int main( int argc, char *argv[]) { const int v = 50; int i = 0X7FFFFFFF; cout<<(i + v)<<endl; if ( i + v < i ) { cout<<"Number is negative"<<endl; } else { cout<<"Number is positive"<<endl; } return 0; } No specific compiler optimisation options are used or the O's flag is used. It is basic compilation command g++ -o test main.cpp is used to form the executable. The seemingly very simple code, has odd behaviour in SUSE 64 bit OS, gcc version 4.1.2. The expected output is "Number is negative", instead only in SUSE 64 bit OS, the output would be "Number is positive". After some amount of analysis and doing a 'disass' of the code, I find that the compiler optimises in the below format - Since i is same on both sides of comparison, it cannot be changed in the same expression, remove 'i' from the equation. Now, the comparison leads to if ( v < 0 ), where v is a constant positive, So during compilation itself, the else part cout function address is added to the register. No cmp/jmp instructions can be found. I see that the behaviour is only in gcc 4.1.2 SUSE 10. When tried in AIX 5.1/5.3 and HP IA64, the result is as expected. Is the above optimisation valid? Or, is using the overflow mechanism for int not a valid use case? Question 2 Now when I change the conditional statement from if (i + v < i) to if ( (i + v) < i ) even then, the behaviour is same, this atleast I would personally disagree, since additional braces are provided, I expect the compiler to create a temporary built-in type variable and them compare, thus nullify the optimisation. Question 3 Suppose I have a huge code base, an I migrate my compiler version, such bug/optimisation can cause havoc in my system behaviour. Ofcourse from business perspective, it is very ineffective to test all lines of code again just because of compiler upgradation. I think for all practical purpose, these kinds of error are very difficult to catch (during upgradation) and invariably will be leaked to production site. Can anyone suggest any possible way to ensure to ensure that these kind of bug/optimization does not have any impact on my existing system/code base? PS : When the const for v is removed from the code, then optimization is not done by the compiler. I believe, it is perfectly fine to use overflow mechanism to find if the variable is from MAX - 50 value (in my case).

    Read the article

  • disable dates using jquery inside gridview control

    - by bladerunner
    Hi there, I have a gridview which contains a textbox control. I need to show the calendar for the user to pick the date and certain dates are to be disabled using jquery. I found a post on stackoverflow that talked about how to disable certain dates. I am done with that part, except not sure how to pass the textbox control to this jquery function. Here is the code. <script type="text/javascript" language="javascript"> function pageLoad(sender, args) { var enabledDays = ['09/21/2011', '10/05/2011', '10/19/2011', '11/02/2011', '11/16/2011']; /* utility functions */ function editDays(date) { for (var i = 0; i < enabledDays.length; i++) { if (new Date(enabledDays[i]).toString() == date.toString()) { return [true]; } } return [false]; } /* create datepicker */ $(document).ready(function() { $('#<%= txtInHomeDate.ClientID %>').datepicker({ beforeShow: springDate, beforeShowDay: editDays, dateFormat: 'mm/dd/yy', buttonImage: 'images/cal.gif', buttonText: 'Choose date', firstDay: 1, buttonImageOnly: true, showOn: 'both', showAnim: 'fadeIn', onSelect: function() { $(this).trigger("onchange", null); } }); function springDate() { var defaultMin = new Date(); var defaultMax = new Date(); var Min = defaultMin; var Max = defaultMax; // make valid date from hiddenfied value format is MM/dd/yyyy dateMin = $('#<%= hfStDate.ClientID %>').val(); dateMin = new Date(dateMin); dateMax = $('#<%= hfEndDate.ClientID %>').val(); dateMax = new Date(dateMax); if (dateMin && dateMax) { Min = new Date(dateMin.getFullYear(), dateMin.getMonth(), dateMin.getDate()); Max = new Date(dateMax.getFullYear(), dateMax.getMonth(), dateMax.getDate()); } return { minDate: Min, maxDate: Max }; } }); } <.... <asp:TemplateField HeaderText="In-Home Date"> <ItemStyle HorizontalAlign="Center" /> <ItemTemplate> <asp:HiddenField ID="hfStDate" runat="server" Value="09/01/2011" /> <asp:HiddenField ID="hfEndDate" runat="server" Value="11/30/2011" /> <asp:TextBox ID="txtInHomeDate" runat="server" /> </ItemTemplate> </asp:TemplateField> Currently, it errors out since the jquery function won't find the txtInHomeDate. Could I get some help as I am pretty close to get this done? Thanks!!

    Read the article

  • Programmatically created GridView cells don't scale to fit screen

    - by ChrisAshton84
    I've read a ton of other responses about GridView already but almost all deal with the XML format (which I had working). I wanted to learn the programmatic way of designing Android, though, so I'm trying to build most of this app without XML. All I define in XML are the GridView and the first TextView. After that I add the other LinearLayouts in onCreate(). I would like to have a 2 column GridView containing a title and several (4 for now) LinearLayouts. I realize from documentation that the GridView won't scale cells unless they have a gravity set, but no matter how I try to do this I can't get it to work. After adding two cells, my GridView tree would look like: GridView -> TextView (colspan 2) -> LinearLayout (Vertical) -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Vertical) -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView I've tried about every combination of FILL and FILL_HORIZONTAL I could think of on either the outermost LinearLayouts, or also trying on the TextViews and inner LinearLayouts. No matter what I do, the LinearLayouts I add are always sized as small as possible and pushed to the left of the screen. Meanwhile, the first TextView (the colspan 2 one) with only CENTER_HORIZONTAL set is correctly centered in the screen. Its as if that TextView gets one idea of the column widths and the LinearLayouts get another! (If I add the FILL Gravity for it, it also moves all the way left.) I believe I had this working accidentally with 100% XML, but I would prefer not to switch back unless this is known to not work programatically. Any ideas what I can try to get this working?

    Read the article

  • How to put Google adsense in iPhone application?

    - by oksk
    Hi all. I have a question about adsense. I want to put Google adsense in my application to be developed. But after testing my code, It wasn't shown. this is my code self.webView.userInteractionEnabled = NO; NSMutableString *manageableHTML = [[[NSMutableString alloc] init] autorelease]; [manageableHTML appendFormat:@"<html><head></head>"]; [manageableHTML appendFormat:@"<body>"]; [manageableHTML appendFormat:@"<script type=\"text/javascript\"><!--"]; [manageableHTML appendFormat:@"window.googleAfmcRequest = {"]; [manageableHTML appendFormat:@"client: 'ca-mb-pub-7564235160823935',"]; [manageableHTML appendFormat:@"ad_type: 'text_image',"]; [manageableHTML appendFormat:@"output: 'html',"]; [manageableHTML appendFormat:@"channel: '2052458338',"]; [manageableHTML appendFormat:@"format: '320x50_mb',"]; [manageableHTML appendFormat:@"oe: 'utf8',"]; [manageableHTML appendFormat:@"color_border: '336699',"]; [manageableHTML appendFormat:@"color_bg: 'FFFFFF',"]; [manageableHTML appendFormat:@"color_link: '0000FF',"]; [manageableHTML appendFormat:@"color_text: '000000',"]; [manageableHTML appendFormat:@"color_url: '008000',"]; [manageableHTML appendFormat:@"};"]; [manageableHTML appendFormat:@"//--></script>"]; [manageableHTML appendFormat:@"<script type=\"text/javascript\" "]; [manageableHTML appendFormat:@"src=\"http://pagead2.googlesyndication.com/pagead/show_afmc_ads.js\"></script>"]; [manageableHTML appendFormat:@"</body></html>"]; [self.webView loadHTMLString:manageableHTML baseURL:nil]; [self.view addSubview:self.webView]; Bofore testing, this javascript code are well operated in my google blog. I found that this code work at only mobile device. and I checked it through safari of my ipod touch. (It works well.) But Checking in the application, I don't see adsense. what is something wrong?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Application error when drawing to SurfaceView

    - by DKDiveDude
    I'm am doing a simple coding attempt trying to draw on a SurfaceView created on my main.xml layout. I can change background color and display an icon fine, but when I try to draw I get an error. I am a newbie so obvious I am missing something, please lent a helping hint, thanks! main.xml <?xml version="1.0" encoding="utf-8"?> <SurfaceView android:id="@+id/Paper" android:layout_height="fill_parent" android:layout_width="fill_parent"> </SurfaceView> and code here; package com.example.SurfaceViewTest; import android.app.Activity; import android.graphics.Bitmap; import android.graphics.Canvas; import android.graphics.Color; import android.graphics.Paint; import android.os.Bundle; import android.view.SurfaceHolder; import android.view.SurfaceView; public class SurfaceViewTest extends Activity implements SurfaceHolder.Callback { private SurfaceView mSurfaceView; private SurfaceHolder mSurfaceHolder; private Paint paint; private Canvas canvas; Bitmap mDrawing; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); mSurfaceView = (SurfaceView) this.findViewById(R.id.Paper); mSurfaceHolder = mSurfaceView.getHolder(); mSurfaceHolder.addCallback(this); mSurfaceHolder.setType(SurfaceHolder.SURFACE_TYPE_PUSH_BUFFERS); } @Override public void surfaceChanged(SurfaceHolder holder, int format, int width, int height) { // TODO Auto-generated method stub } @Override public void surfaceCreated(SurfaceHolder holder) { mSurfaceView.setBackgroundColor(Color.rgb(0, 255, 0)); //mSurfaceView.setBackgroundResource(R.drawable.icon); canvas = holder.lockCanvas(null); mDrawing = Bitmap.createBitmap(100, 100, Bitmap.Config.RGB_565); canvas.setBitmap(mDrawing); paint = new Paint(); paint.setColor(Color.rgb(255, 255,255)); canvas.drawLine(1,1,200,300, paint); holder.unlockCanvasAndPost(canvas); } @Override public void surfaceDestroyed(SurfaceHolder holder) { // TODO Auto-generated method stub } }

    Read the article

  • XML serialization options in .NET

    - by Borek
    I'm building a service that returns an XML (no SOAP, no ATOM, just plain old XML). Say that I have my domain objects already filled with data and just need to transform them to the XML format. What options do I have on .NET? Requirements: The transformation is not 1:1. Say that I have an Address property of type Address with nested properties like Line1, City, Postcode etc. This may need to result in an XML like <xaddr city="...">Line1, Postcode</xaddr>, i.e. quite different. Some XML elements/attributes are conditional, for example, if a Customer is under 18, the XML needs to contain some additional information. I only need to serialize the objects to XML, the other direction (XML to objects) is not important Some technologies, i.e. Data Contracts use .NET attributes. Other means of configuration (external XML config, buddy classes etc.) would be a plus. Here are the options as I see them as the moment. Corrections / additions will be very welcome. String concatenation - forget it, it was a joke :) Linq 2 XML - complete control but quite a lot of hand written code, would need good suite of unit tests View engines in ASP.NET MVC (or even Web Forms theoretically), the logic being in controllers. It's a question how to structure it, I can have simple rules engine in my controller(s) and one view template per each possible output, or have the decision logic directly in the template. Both have upsides and downsides. XML Serialization - I'm not sure about the flexibility here Data Contracts from WCF - not sure about the flexibility either, plus would they work in a simple ASP.NET MVC app (non-WCF service)? Are they a super-set of the standard XML serialization now? If it exists, some XML-to-object mapper. The more I think about it the more I think I'm looking for something like this but I couldn't find anything appropriate. Any comments / other options?

    Read the article

< Previous Page | 466 467 468 469 470 471 472 473 474 475 476 477  | Next Page >