Search Results

Search found 13948 results on 558 pages for 'document centric'.

Page 471/558 | < Previous Page | 467 468 469 470 471 472 473 474 475 476 477 478  | Next Page >

  • How can click on a java show link programatically?

    - by Jules
    I'm trying to develop a new feature for our vb.net order entry system. At the moment I provide an assisted paypal login which loops through transactions and copies the transactions. My program then looks at this data and copies it into text boxes. The operator then approves and saves the record. So my code uses IHTMLFormElement and loops round form elements and adds values. However I only really use this to log in to paypal. See my code... Dim theObject As Object = Nothing theObject = "https://www.paypal.com/cgi-bin/webscr?cmd=_login-run" WebBrowPayPal.AxWebBrowser1.Navigate2(theObject) While WebBrowPayPal.AxWebBrowser1.ReadyState <> tagREADYSTATE.READYSTATE_COMPLETE Application.DoEvents() End While Dim HtmlDoc As IHTMLDocument2 = CType(WebBrowPayPal.AxWebBrowser1.Document, IHTMLDocument2) Dim FormCol As IHTMLElementCollection = HtmlDoc.forms Dim iForms As Integer = FormCol.length Dim i As Integer Dim x As Integer For i = 0 To iForms - 1 Dim oForm As IHTMLFormElement = CType(FormCol.item(CType(i, Object), CType(i, Object)), IHTMLFormElement) For x = 0 To oForm.length - 1 If oForm.elements(x).tagname = "INPUT" Then If oForm.elements(x).name = "login_email" Then oForm.elements(x).value = "[email protected]" End If If oForm.elements(x).name = "login_password" Then oForm.elements(x).value = "mypassword" End If If oForm.elements(x).type = "submit" Or _ oForm.elements(x).type = "SUBMIT" Then oForm.elements(x).click() End If End If Next Next i I'm now trying this page https://www.paypal.com/uk/cgi-bin/webscr?cmd=_history&nav=0.3.0 Which is the history page, which allows you to search on the paypal transaction id. Unfortunately you need to click on 'find a transaction' which then uses some javascript to shows the post fields. So the problem is that the fields I need to use are hidden. How can I click on this java link in code ?

    Read the article

  • [jquery] multiple resizables acting strange

    - by Noweem
    Hi there everyone, I'm trying to place multiple resizable and draggable div's on one page that move (vertically) inside their own parent div. you can take a look at http://bit.ly/bCutBE However, these div's act really strange when I want to resize them, especially from the north side, they kind of move out of the screen very fast, while they shouldn't be able to get outside the parent div. I only want the div to be able to move and resize vertically inside it's parent, the dragging-part works pretty good, but the resize part give this problem. I can't really describe it better than this, but take a look for yourself and it will be clear immediately when you try to resize one of the coloured div's: move it a little downwards and try to resize it from the north side. the problem seems to be caused by the containment: 'parent', line of the resizable. when I delete this line it works fine, but then the coloured blocks don't stay in their parent, and I want them to stay inside their parent. I hope someone can help me with this... the jquery code I used: $(document).ready(function(){ $(".move") .draggable({ containment: 'parent', grid: [50,50], axis: 'y' }) .resizable({ containment: 'parent', grid: [50,50], handles: 'n, s', minHeight: 50 }); });

    Read the article

  • passing data from a servlet to javascript code in an Ajax application ?

    - by A.S al-shammari
    I have a simple jsp/servlet application and I want to add AJAX feature to this app. I use JQuery , but it doesn't matter what javascript framework I use. This is my code: <script type="text/javascript"> function callbackFunction(data){ $('#content').html(data); } $('document').ready(function(){ $('#x').click(function() { $.post('/ajax_2/servlet',callbackFunction) }); }); </script> <body> <a href="#" id="x">Increase it</a> <div id="content"></div> </body> </html> Servlet HttpSession session = request.getSession(); Integer myInteger = (Integer)session.getAttribute("myInteger"); if(myInteger == null) myInteger = new Integer(0); else myInteger = new Integer(myInteger+1); session.setAttribute("myInteger", myInteger); response.getWriter().println(myInteger); The Question: I use out.print to transfer data from a servlet to javascript code (ajax code) , but If I have a complex structure such as Vector of Object or something like this , what is the best way to transfer the data? what about an XML file , JSON ? Is there any special jsp/servlets library to transfer data from a servlet to ajax application ? How can I parse this data in callbackFunction ?

    Read the article

  • Sharepoint user details not visible to other users

    - by richardoz
    I am managing a SharePoint site that uses Form Based Authentication. We have several generic lists, document libraries and active task lists that users can create update and delete. Users can use the people pickers to select/search for everyone. But the users cannot see other users names, email addresses etc. in display lists or the people pickers. If I log in as the site collection administrator, I can see everyones details. So I know the data is available. Updated details on this problem (non-administrators) SharePoint users cannot see other users information. Example: User A assigns a task to user B. User A creates a new task and uses the people picker to find user B. User B is only visible by the login name “bname” and any information about user B is not visible or searchable within the people picker. Once user B is assigned the task, user A no longer sees the name in the task list – even though user A created it. No modified by, created by, assigned to or owner field data is visible to non-administrator users. Facts: Extranet site is configured to use Forms Based Authentication. Intranet uses windows based authentication Users of both the intranet and extranet have the same problem All databases are local The site uses SSRS integration SharePoint WSS on Windows 2003 Std -- After activating the verbose logging it looks like SharePoint is definately asking SQL server for only the user info for the currently logged in user: SELECT TOP 6 /lots-of-columns/ FROM UserData INNER MERGE JOIN Docs AS t1 ON ( 1 = 1 AND UserData.[tp_RowOrdinal] = 0 AND t1.SiteId = UserData.tp_SiteId AND t1.SiteId = @L2 AND t1.DirName = UserData.tp_DirName AND t1.LeafName = UserData.tp_LeafName AND t1.Level = UserData.tp_Level AND t1.IsCurrentVersion = 1 AND (1 = 1) ) LEFT OUTER JOIN AllUserData AS t2 ON ( UserData.[tp_Author]=t2.[tp_ID] AND UserData.[tp_RowOrdinal] = 0 AND t2.[tp_RowOrdinal] = 0 AND ( (t2.tp_IsCurrent = 1) ) AND t2.[tp_CalculatedVersion] = 0 AND t2.[tp_DeleteTransactionId] = 0x AND t2.tp_ListId = @L3 AND UserData.tp_ListId = @L4 AND t2.[tp_Author]=162 /* this is the currently logged in user */ ) WHERE (UserData.tp_IsCurrent = 1) AND UserData.tp_SiteId=@L2 AND (UserData.tp_DirName=@DN) AND UserData.tp_RowOrdinal=0 AND ( ( (UserData.[datetime1] IS NULL ) OR (UserData.[datetime1] = @L5DTP) ) AND t1.SiteId=@L2 AND (t1.DirName=@DN) ) ORDER BY UserData.[tp_Modified] Desc, UserData.[tp_ID] Asc Again, any ideas would be appreciated.

    Read the article

  • adding an uncertain number of fields using javascript

    - by user306472
    I'm new to javascript and a novice programmer, so this might be a really easy question to answer. I would like to loop over the values of x number of fields and add them up to display the sum in a final field. I can perform this function if I explicitly call each field, but I want to abstract this so I can deal with a flexible number of fields. Here's example code I've come up with (that's not working for me). Where am I going wrong? <html> <head> <script type="text/javascript"> function startAdd(){ interval = setInterval("addfields()",1); } function addfields(){ a = document.addition.total.value; b = getElementByTagName("sum").value; for (i=0; i<=b.length; i++){ a+=i; } return a; } function stopAdd(){ clearInterval(interval); } </script> </head> <body> <form name="addition"> <input type="text" name="sum" onFocus="startAdd();" onBlur="stopAdd;"> + <input type="text" name="sum" onFocus="startAdd();" onBlur="stopAdd;"> = <input type="text" name ="total"> </form> </body> </html>

    Read the article

  • radiobutton checked on condition in jquery

    - by RememberME
    I have the following fields: <label>Company Type:</label> <label for="primary"><input onclick="javascript: $('#sec').hide('slow');$('#primary_company').find('option:first').attr('selected','selected');" type="radio" runat="server" name="companyType" id="primary" />Primary</label> <label for="secondary"><input onclick="javascript: $('#sec').show('slow');" type="radio" runat="server" name="companyType" id="secondary" />Secondary</label> <div id="sec"> <fieldset> <label for="primary_company">Primary Company:</label> <%= Html.DropDownList("primary_company", Model.SelectPrimaryCompanies, "** Select Primary Company **") %> </fieldset> If there is a primary_company, then the secondary radio button should be selected. If there is no primary_company, then the primary radio button should be selected. Here is my jQuery: $(document).ready(function() { if ($('#primary_company').val().length > 0) { $('#secondary').attr({ checked: true }); } else { $("#primary").attr('checked', true ); $('#sec').hide(); } The sec div hides and shows properly, but a radio button is never selected. I've tried .attr('checked', 'checked') and .attr({ checked: true }) and .attr('checked', true) but nothing is ever selected.

    Read the article

  • How can I access a parent DOM from an iframe on a different domain?

    - by Dexter
    I have a website and my domain is registered through Network Solutions. I'm using their Web Forwarding feature which allows me to "mask" my domain so that when a user visits http://lucasmccoy.com they are actually seeing http://lucasmccoy.comlu.com/ through an HTML frame. The advantages of this are that the address bar still shows http://lucasmccoy.com/. The disadvantages are that I cannot directly edit the HTML page in which the frame is owned. For example, I cannot change the page title or favicon. I have tried doing it like so: $(function() { parent.document.title = 'Lucas McCoy'; }); But of course this gives me a JavaScript error: Unsafe JavaScript attempt to access frame with URL http://lucasmccoy.com/ from frame with URL http://lucasmccoy.comlu.com/. Domains, protocols and ports must match. I looked at this question attempting to do the same thing except the OP has access to the other pages HTML whereas I do not. Is there anyway in JavaScript/jQuery to make a cross-domain request to the DOM when you don't have access to that domain? Or is this something browsers just will not let happen for security reasons.

    Read the article

  • Anchor as a Submit button

    - by griegs
    I have an MVC 2 application that has the following on it; <% using( Html.BeginForm("Results","Quote", FormMethod.Post, new { name="Results" })){ %> <% Html.RenderPartial("Needs", Model.needs); %> <div class="But green" style=""> <a href="." onclick="javascript:document.Results.submit();">Go</a> </div> <input type="submit" /> <%} %> Pressing the Submit button or the anchor both post back to the right ActionResult. However, when in the controller I return View(stuff..) only the Submit button will come back to the page. When the call finishes from pressing the anchor, I go to an error page informing me that the resource cannot be found. I suspect it has something to do with href="." but am unsure what to set it to.

    Read the article

  • PreparedStatement question in Java against Oracle.

    - by fardon57
    Hi everyone, I'm working on the modification of some code to use preparedStatement instead of normal Statement, for security and performance reason. Our application is currently storing information into an embedded derby database, but we are going to move soon to Oracle. I've found two things that I need your help guys about Oracle and Prepared Statement : 1- I've found this document saying that Oracle doesn't handle bind parameters into IN clauses, so we cannot supply a query like : Select pokemon from pokemonTable where capacity in (?,?,?,?) Is that true ? Is there any workaround ? ... Why ? 2- We have some fields which are of type TIMESTAMP. So with our actual Statement, the query looks like this : Select raichu from pokemonTable where evolution = TO_TIMESTAMP('2500-12-31 00:00:00.000', 'YYYY-MM-DD HH24:MI:SS.FF') What should be done for a prepared Statement ? Should I put into the array of parameters : 2500-12-31 or TO_TIMESTAMP('2500-12-31 00:00:00.000', 'YYYY-MM-DD HH24:MI:SS.FF') ? Thanks for your help, I hope my questions are clear ! Regards,

    Read the article

  • Hidden youtube player loses its methods

    - by zaius
    I'm controlling a embedded youtube chromeless player with javascript, and I want to hide it occasionally by setting display: none. However, when I show the player again, it loses its youtube methods. For example: <script> swfobject.embedSWF("http://www.youtube.com/apiplayer?enablejsapi=1&playerapiid=player", "player", "425", "356", "8", null, null, {allowScriptAccess: "always"}, {id: 'player'} ); var player = null; function onYouTubePlayerReady(playerId) { player = document.getElementById(playerId); player.addEventListener('onStateChange', 'playerStateChanged'); } function hidePlayer() { player.pauseVideo(); player.style.display = 'none'; } function showPlayer() { player.style.display = 'block'; player.playVideo(); } </script> <a href="#" onClick="hidePlayer();">hide</a> <a href="#" onClick="showPlayer();">show</a> <div id="player"></div> Calling hidePlayer followed by showPlayer gives this error on the playVideo call: Uncaught TypeError: Object #<an HTMLObjectElement> has no method 'playVideo' The only solution I can find is to use visibility: hidden, but that is messing with my page layout. Any other solutions out there?

    Read the article

  • jquery animate from object center

    - by mtwallet
    Hi. I am trying to create a product viewer similar to the one at the bottom of this page http://www.logitech.com/en-gb/. As you can see the product animates from the center rather than top left which I think is Jquery's default. So what I am doing is trying animate the width and height and then also the offset to make it look like it animates from the center. My code looks like this: <style> body { background: black; } .box { background: #fff url('pic.jpg') no-repeat 0 0; width: 200px; height: 200px; margin: 10px 4%; float: left; } </style> <script type="text/javascript"> $(document).ready(function() { $(".box").hover(function() { $(".box").not(this).fadeTo(500, 0.5); $(this).animate({ width: 300, height: 300, left: -100, top: -100 }, 500); }, function() { $(this).animate({ width: 200, height: 200, left: 100, top: 100 }, 500); $(".box").fadeTo(500, 1); }); }); </script> I cannot seem to get this working as I want. Can anyone help with this or suggest a better technique? Many thanks

    Read the article

  • JQuery date picker does not firing in ajax page using Rails

    - by prabu
    Hi Here I have using datepicker from JQueryUI in my public/javascript folder as effects,prototype,control,dragdrop js files. in my public folder contains jqueryui development buddle. (css,js,development-bundle) in layout/application.rhtml <%= stylesheet_link_tag 'application' %> <%=javascript_include_tag :defaults%> <%= stylesheet_link_tag '/jquery-ui/css/custom-theme/jquery-ui-1.8.1.custom.css' %> <%=javascript_include_tag "/jquery-ui/js/jquery-1.4.2.min.js"%> <%=javascript_include_tag "/jquery-ui/js/jquery-ui-1.8.1.custom.min.js"%> <script> $(document).ready(function(){ var $j=jQuery.noConflict(); $j( '#date' ).datepicker({ dateFormat: 'dd-mm-yy' }); }); </script> in home/index.rhtml <%title "Home"%> <%=link_to "Add Details" ,:action=>"add"%> <%=link_to_remote "Ajax Add Details", :update=>"add" , :url=>{ :action=>"add" }%> <div id='add' /> in home/add.rhtml <%title "Add details"%> <%form_tag :action=>"create" do%> Name : <%=text_field_tag "name" ,"",:size=>15%> DOB : <%=text_field_tag "dob","",:id=>"date"%> <%=submit_tag "Save"%> <%end%> the datepicker works when I run home/add.rhtml directly but the datepicker not work when i run ajax page home/index.rhtml Any solutions for that,????

    Read the article

  • How to make HTML layout whitespace-agnostic?

    - by ssg
    If you have consecutive inline-blocks white-space becomes significant. It adds some level of space between elements. What's the "correct" way of avoiding whitespace effect to HTML layout if you want those blocks to look stuck to each other? Example: <span>a</span> <span>b</span> This renders differently than: <span>a</span><span>b</span> because of the space inbetween. I want whitespace-effect to go away without compromising HTML source code layout. I want my HTML templates to stay clean and well-indented. I think these options are ugly: 1) Tweaking text-indent, margin, padding etc. (Because it would be dependent on font-size, default white-space width etc) 2) Putting everything on a single line, next to each other. 3) Zero font-size. That would require overriding font-size in blocks, which would otherwise be inherited. 4) Possible document-wide solutions. I want the solution to stay local for a certain block of HTML. Any ideas, any obvious points which I'm missing?

    Read the article

  • What makes good web form styling for business applications?

    - by ProfK
    Styling forms (form elements) is something that even Eric Meyer prefers to avoid. However, most business forms, and that is where styling is at issue; 'contact us' forms are easy to style, put window estate at a premium, with more 'document level' (e.g. invoice) fields, plus 'detail level' (e.g. invoice line) fields. Factors I often find at play are: At my minimum, at least two horizontally adjacent fieldsets are required. In applications vs. public web pages, fixed positioning vs fluid layout is often better. Quantity of content is important, vs. exaggerated readability. Users know the system, and cues etc. take a back seat. In light of factors like these, is there any available guidence for styling web form based applications? Are there any CSS or JavaScript frameworks that would make my quest to style these applications better than Visual Studios still pathetic 'Auto-format' (what drugs were those people on? I will never take them.)

    Read the article

  • JQuery error in IE, works with FF. Maybe a problem with live.

    - by olve
    Hello. I have an ASP.net MVC2 application. In wich I'm using JQuery to alter all table rows so I can click anywhere in any row to trigger a click event on a link in the clicked row. The tables is created using MVC's built in partialview ajax. Here is my JQuery script. <script type="text/javascript"> $(document).ready(function () { $('table tr').live('click',function (event) { $('#asplink', this).trigger('click'); }) .live('mouseenter',function (event) { this.bgColor = 'lightblue'; }) .live('mouseleave', function (event) { this.bgColor = 'white'; }); }); </script> And this is the first part of the partial view code that creates the table. <% foreach (var item in Model.JobHeaderData) { %> <tr> <td> <a id="asplink" href="http://localhost/sagstyring/EditJob.asp?JobDataID=<%: item.JobDataId %>&JobNumId=<%: item.JobNumID%>&JobNum=<%: item.JobNumID%>&DepId=1&User_Id=<%:ViewData["UserId"]%>" onclick="window.open(this.href,'Rediger sag <%: item.JobNumID %> ', 'status=0, toolbar=0, location=0, menubar=0, directories=0, resizeable=0, scrollbars=0, width=900, height=700'); return false;">Rediger</a> </td> In firefox this works perfectly. In IE, JQuery crashes when I click on a row. If I debug the page in IE. I get this. Out of stack space In jquery-1.4.1.js line 1822 // Trigger the event, it is assumed that "handle" is a function var handle = jQuery.data( elem, "handle" ); if ( handle ) { handle.apply( elem, data ); } I'm no eagle at javascript, so I'm pretty much stuck.

    Read the article

  • How do I use Core Data with the Cocoa Text Input system?

    - by the Joel
    Hobbyist Cocoa programmer here. Have been looking around all the usual places, but this seems relatively under-explained: I am writing something a little out of the ordinary. It is much simpler than, but similar to, a desktop publishing app. I want editable text boxes on a canvas, arbitrarily placed. This is document-based and I’d really like to use Core Data. Now, The cocoa text-handling system seems to deal with a four-class structure: NSTextStorage, NSLayoutManager, NSTextContainer and finally NSTextView. I have looked into these and know how to use them, sort of. Have been making some prototypes and it works for simple apps. The problem arrives when I get into persistency. I don't know how to, by way of Cocoa Bindings or something else, store the contents of NSTextStorage (= the actual text) in my managed object context. I have considered overriding methods pairs like -words, -setWords: in these objects. This would let me link the words to a String, which I know how to store in Core Data. However, I’d have to override any method that affects the text - and that seems a little much. Thankful for any insights.

    Read the article

  • php not redirecting

    - by NSchulze
    I'm trying to write the logout of a website. When I do this I want the page to redirect to the login page. I think I'm doing it the correct way, but can't get the right result. Could you guys point me in the right direction? Relevant Code: <button onclick="logout()">Logout</button> function logout() { var xmlhttp; if (window.XMLHttpRequest) {// code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp=new XMLHttpRequest(); } else {// code for IE6, IE5 xmlhttp=new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.onreadystatechange=function() { if (xmlhttp.readyState==4 && xmlhttp.status==200) { document.location=xmlhttp.responseText; } } xmlhttp.open("GET","logout.php",true); xmlhttp.send(); } <?php session_destroy(); header("Location:http://localhost:8888/loginns.html"); mysql_close($con); ?> Thanks!

    Read the article

  • Javascript JQUERY AJAX: When Are These Implemented

    - by Michael Moreno
    I'm learning javascript. Poked around this excellent site to gather intel. Keep coming across questions / answers about javascript, JQUERY, JQUERY with AJAX, javascript with JQUERY, AJAX alone. My conclusion: these are all individually powerful and useful. My confusion: how does one determine which/which combination to use ? I've concluded that javascript is readily available on most browsers. For example, I can extend a simple HTML page with <html> <body> <script type="text/javascript"> document.write("Hello World!"); </script> </body> </html> However, within the scope of Python/DJANGO, many of these questions are JQUERY and AJAX related. At which point or under what development circumstances would I conclude that javascript alone isn't going to "cut it", and I need to implement JQUERY and/or AJAX and/or some other permutation ?

    Read the article

  • jQuery UI - Sortable isn't firing?

    - by Kenny Bones
    Hi, I'm trying to get the jQuery UI sortable plugin to work and I've created a list that looks like this: <ul id="sortable"> <li>Item 1</li> <li>Item 2</li> <li>Item 3</li> <li>Item 4</li> <li>Item 5</li> </ul> And I've included the plugin script files: $(function() { $("#sortable").sortable(); alert('test'); $("#sortable").disableSelection(); }); So I just tried putting the alert box before .sortable is run and the alertbox is showing. But putting it after .sortable isn't working. Which means that .sortable is failing right? I've included the scripts and put them in the head of the html document. <script type="text/javascript" src="js/jquery.ui.core.min.js"></script> <script type="text/javascript" src="js/jquery.ui.mouse.min.js"></script> <script type="text/javascript" src="js/jquery.ui.sortable.min.js"></script> <script type="text/javascript" src="js/jquery.ui.widget.min.js"></script> Which is correct right? And the function that actually runs .sortable is in a merged js file along with all other js snippets and plugins.

    Read the article

  • Indexing and Searching Over Word Level Annotation Layers in Lucene

    - by dmcer
    I have a data set with multiple layers of annotation over the underlying text, such as part-of-tags, chunks from a shallow parser, name entities, and others from various natural language processing (NLP) tools. For a sentence like The man went to the store, the annotations might look like: Word POS Chunk NER ==== === ===== ======== The DT NP Person man NN NP Person went VBD VP - to TO PP - the DT NP Location store NN NP Location I'd like to index a bunch of documents with annotations like these using Lucene and then perform searches across the different layers. An example of a simple query would be to retrieve all documents where Washington is tagged as a person. While I'm not absolutely committed to the notation, syntactically end-users might enter the query as follows: Query: Word=Washington,NER=Person I'd also like to do more complex queries involving the sequential order of annotations across different layers, e.g. find all the documents where there's a word tagged person followed by the words arrived at followed by a word tagged location. Such a query might look like: Query: "NER=Person Word=arrived Word=at NER=Location" What's a good way to go about approaching this with Lucene? Is there anyway to index and search over document fields that contain structured tokens?

    Read the article

  • How to report progress of a JavaScript function?

    - by LambyPie
    I have a JavaScript function which is quite long and performs a number of tasks, I would like to report progress to the user by updating the contents of a SPAN element with a message as I go. I tried adding document.getElementById('spnProgress').innerText = ... statements throughout the function code. However, whilst the function is executing the UI will not update and so you only ever see the last message written to the SPAN which is not very helpful. My current solution is to break the task up into a number of functions, at the end of each I set the SPAN message and then "trigger" the next one with a window.setTimeout call with a very short delay (say 10ms). This yields control and allows the browser to repaint the SPAN with the updated message before starting the next step. However I find this very messy and difficult to follow the code, I'm thinking there must be a better way. Does anyone have any suggestions? Is there any way to force the SPAN to repaint without having to leave the context of the function? Thanks

    Read the article

  • How do I get NHibernate to work with .NET Framework 2.0?

    - by Daniel Dolz
    I can not make NHibernate 2.1 work in machines without framework 3.X (basically, windows 2000 SP4, although it happens with XP too). NHibernate doc do not mention this. Maybe you can help? I NEED to make NHibernate 2.1 work in Windows 2000 PCs, do you think this can be done? PD: DataBase is SQL 2000/2005. Error is: NHibernate.MappingException: Could not compile the mapping document: Datos.NH_VEN_ComprobanteBF.hbm.xml ---> NHibernate.HibernateException: Could not instantiate dialect class NHibernate.Dialect.MsSql2000Dialect ---> System.Reflection.TargetInvocationException: Se produjo una excepción en el destino de la invocación. ---> System.TypeInitializationException: Se produjo una excepción en el inicializador de tipo de 'NHibernate.NHibernateUtil'. ---> System.TypeLoadException: No se puede cargar el tipo 'System.DateTimeOffset' del ensamblado'mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089'. en NHibernate.Type.DateTimeOffsetType.get_ReturnedClass() en NHibernate.NHibernateUtil..cctor() --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect..ctor() en NHibernate.Dialect.MsSql2000Dialect..ctor() --- Fin del seguimiento de la pila de la excepción interna --- en System.RuntimeTypeHandle.CreateInstance(RuntimeType type, Boolean publicOnly, Boolean noCheck, Boolean& canBeCached, RuntimeMethodHandle& ctor, Boolean& bNeedSecurityCheck) en System.RuntimeType.CreateInstanceSlow(Boolean publicOnly, Boolean fillCache) en System.RuntimeType.CreateInstanceImpl(Boolean publicOnly, Boolean skipVisibilityChecks, Boolean fillCache) en System.Activator.CreateInstance(Type type, Boolean nonPublic) en NHibernate.Bytecode.ActivatorObjectsFactory.CreateInstance(Type type) en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) en NHibernate.Dialect.Dialect.GetDialect(IDictionary`2 props) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Cfg.Configuration.LogAndThrow(Exception exception) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) en NHibernate.Cfg.Configuration.ProcessMappingsQueue() and continues...

    Read the article

  • Loading a CSV file using jQuery GET returns the header but no data

    - by Cees Meijer
    When reading a CSV file from a server using the jQuery 'GET' function I do not get any data. When I look at the code using FireBug I can see the GET request is sent and the return value is '200 OK'. Also I see that the header is returned correctly so the request is definitely made, and data is returned. This is also what I see in Wireshark. Here I see the complete contents of the CSV file is returned as a standard HTTP response. But the actual data is not there in my script. Firebug shows an empty response and the 'success' function is never called. What could be wrong ? <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title>New Web Project</title> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <script src="jquery.js" type="text/javascript" charset="utf-8"></script> <script type="text/javascript"> var csvData; $(document).ready(function() { $("#btnGET").click(function() { csvData = $.ajax({ type: "GET", url: "http://www.mywebsite.com/data/sample_file.csv", dataType: "text/csv", success: function () { alert("done!"+ csvData.getAllResponseHeaders()) } }); }); }) </script> </head> <body> <h1>New Web Project Page</h1> <button id="btnGET">GET Data</button> </body> </html>

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Browser freezes when try to call a JS function along with submission of a form.

    - by Waseem
    I have form in my view like following 1 <div> 2 <% form_tag facebook_user_path do %> 3 <label>Use my photo and name from facebook?</label><br /> 4 <%= check_box_tag 'use_name_and_photo', 'yes', true %> 5 <img src="<%= @user.pic %>" /><% @user.name %> 6 7 <%= submit_tag "Finish", :id => "use_name_and_photo_submit" %> 8 <% end %> 9 </div> I have attached some JS handlers using Jquery to this form. 1 var fb = { 2 extendedPermissions: function () { 3 $("#use_name_and_photo_submit").click(function (event) { 4 FB.Connect.showPermissionDialog("email,read_stream,publish_stream", function (perms) { 5 if (!perms) { 6 alert("You have to grant facebook extended permissions to further browse the application."); 7 } else { 8 $("form").submit(function () { 9 $.post($(this).attr("action"), $(this).serialize(), null, "script"); 10 }); 11 } 12 }); 13 event.preventDefault(); 14 return false; 15 }); 16 } 17 }; 18 19 $(document).ready(function () { 20 fb.extendedPermissions(); 21 }); What I want is that when the user clicks on the "Finish" button, he is prompted for the facebook permissions dialogue and when he gives the permissions, the form is submitted to FacebookUsersController. Right now when I click the "Finish" button, facebook permissions dialogue is initiated but before I am prompted for the actual permission submission window, the browser freezes. Just like I have pressed Esc during the process. In fact status bar of the browser says "Stopped". Any help is highly appreciated.

    Read the article

< Previous Page | 467 468 469 470 471 472 473 474 475 476 477 478  | Next Page >