Search Results

Search found 13948 results on 558 pages for 'document centric'.

Page 471/558 | < Previous Page | 467 468 469 470 471 472 473 474 475 476 477 478  | Next Page >

  • Syntax Error? When parsing XML value

    - by Ace Munim
    I don't know if I'm having a syntax error but the compiler is giving me TypeError: 'undefined' is not an object (evaluating 'xmlDoc.getElementsByTagName("icon")[i].childNodes') Its me giving me this problem when im parsing the XML from my server, my actual javascript code is like this var xmlDoc = Obj.responseXML; var count = 0; if(xmlDoc){ while(count <= xmlDoc.getElementsByTagName("item").length){ document.getElementById("flow").innerHTML += "<div class='item'><img class='content' src='" + xmlDoc.getElementsByTagName("icon")[i].childNodes[0].nodeValue.replace(/\s+$/g,' ') +"' /></div>"; count++; } }else{ alert("Unable to parse!"); } and my XML goes like this. <feed> <item> <title>Given Title</title> <icon> http://i178.photobucket.com/albums/w255/ace003_album/Logo-ETC-RGB-e1353503652739.jpg </icon> </item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> </feed> i just want to parse the image link and to show it.

    Read the article

  • why the main method are not covered? urgent, please help me

    - by Mike.Huang
    main method: public static void main(String[] args) throws Exception { if (args.length != EXPECTED_NUMBER_OF_ARGUMENTS) { System.err.println("Usage - java XFRCompiler ConfigXML PackageXML XFR"); } String configXML = args[0]; String packageXML = args[1]; String xfr = args[2]; AutoConfigCompiler compiler = new AutoConfigCompiler(); compiler.setConfigDocument(loadDocument(configXML)); compiler.setPackageInfoDoc(loadDocument(packageXML)); // compiler.setVisiblityDoc(loadDocument("VisibilityFilter.xml")); compiler.compileModel(xfr); } private static Document loadDocument(String fileName) throws Exception { TXDOMParser parser = (TXDOMParser) ParserFactory.makeParser(TXDOMParser.class.getName()); InputSource source = new InputSource(new FileInputStream(fileName)); parser.parse(source); return parser.getDocument(); } testcase: @Test public void testCompileModel() throws Exception { // construct parameters URL configFile = Thread.currentThread().getContextClassLoader().getResource("Ford_2008_Mustang_Config.xml"); URL packageFile = Thread.currentThread().getContextClassLoader().getResource("Ford_2008_Mustang_Package.xml"); File tmpFile = new File("Ford_2008_Mustang_tmp.xfr"); if(!tmpFile.exists()) { tmpFile.createNewFile(); } String[] args = new String[]{configFile.getPath(),packageFile.getPath(),tmpFile.getPath()}; try { // test main method XFRCompiler.main(args); } catch (Exception e) { assertTrue(true); } try { // test args length is less than 3 XFRCompiler.main(new String[]{"",""}); } catch (Exception e) { assertTrue(true); } tmpFile.delete(); } coverage outputs displayed as the lines from “String configXML = args[0];" in main method are not covered

    Read the article

  • Event type property lost in IE-8

    - by Channel72
    I've noticed a strange Javascript error which only seems to happen on Internet Explorer 8. Basically, on IE-8 if you have an event handler function which captures the event object in a closure, the event "type" property seems to become invalidated from within the closure. Here's a simple code snippet which reproduces the error: <html> <head> <script type = "text/javascript"> function handleClickEvent(ev) { ev = (ev || window.event); alert(ev.type); window.setTimeout(function() { alert(ev.type); // Causes error on IE-8 }, 20); } function foo() { var query = document.getElementById("query"); query.onclick = handleClickEvent; } </script> </head> <body> <input id = "query" type = "submit"> <script type = "text/javascript"> foo(); </script> </body> </html> So basically, what happens here is that within the handleClickEvent function, we have the event object ev. We call alert(ev.type) and we see the event type is "click". So far, so good. But then when we capture the event object in a closure, and then call alert(ev.type) again from within the closure, now all of a sudden Internet Explorer 8 errors, saying "Member not found" because of the expression ev.type. It seems as though the type property of the event object is mysteriously gone after we capture the event object in a closure. I tested this code snippet on Firefox, Safari and Chrome, and none of them report an error condition. But in IE-8, the event object seems to become somehow invalidated after it's captured in the closure. Question: Why is this happening in IE-8, and is there any workaround?

    Read the article

  • Anchor as a Submit button

    - by griegs
    I have an MVC 2 application that has the following on it; <% using( Html.BeginForm("Results","Quote", FormMethod.Post, new { name="Results" })){ %> <% Html.RenderPartial("Needs", Model.needs); %> <div class="But green" style=""> <a href="." onclick="javascript:document.Results.submit();">Go</a> </div> <input type="submit" /> <%} %> Pressing the Submit button or the anchor both post back to the right ActionResult. However, when in the controller I return View(stuff..) only the Submit button will come back to the page. When the call finishes from pressing the anchor, I go to an error page informing me that the resource cannot be found. I suspect it has something to do with href="." but am unsure what to set it to.

    Read the article

  • Servlet receiving data both in ISO-8859-1 and UTF-8. How to URL-decode?

    - by AJPerez
    I've a web application (well, in fact is just a servlet) which receives data from 3 different sources: Source A is a HTML document written in UTF-8, and sends the data via <form method="get">. Source B is written in ISO-8859-1, and sends the data via <form method="get">, too. Source C is written in ISO-8859-1, and sends the data via <a href="http://my-servlet-url?param=value&param2=value2&etc">. The servlet receives the request params and URL-decodes them using UTF-8. As you can expect, A works without problems, while B and C fail (you can't URL-decode in UTF-8 something that's encoded in ISO-8859-1...). I can make slight modifications to B and C, but I am not allowed to change them from ISO-8859-1 to UTF-8, which would solve all the problems. In B, I've been able to solve the problem by adding accept-charset="UTF-8" to the <form>. So the <form> sends the data in UTF-8 even with the page being ISO. What can I do to fix C? Alternatively, is there any way to determine the charset on the servlet, so I can call URL-decode with the right encoding in each case?

    Read the article

  • Embedding XSL Stylesheet into XML

    - by user700996
    I have the following XML: <?xml version="1.0" encoding="ISO-8859-1"?> <?xml-stylesheet type="text/xsl" href="http://www.fakedomain.com/sally.xsl"?> And the following content in sally.xsl: <?xml version="1.0" encoding="ISO-8859-1"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:template match="/"> <html> <body> <xsl:for-each select="documentcollection/document"> <p> <xsl:for-each select="rss/channel/item"> <xsl:value-of select="title"/><br /> <xsl:value-of select="description"/><br /> <xsl:value-of select="link"/><br /> </xsl:for-each> </p> </xsl:for-each> </body> </html> </xsl:template> </xsl:stylesheet> However, the browser displays the XML as though the XSL line is not present. Do you know why the browser is ignoring the XSL stylesheet? Is the style sheet wrong? Thanks

    Read the article

  • Convert XML to TCL Object

    - by pws5068
    Greetings, I'm new to TCL scripting, and I have a very very basic xml file which I need to import information from into tcl. Example of XML Document Structure: <object> <type>Hardware</type> <name>System Name</name> <description>Basic Description of System.</description> <attributes> <vendor>Dell</vendor> <contract>MM/DD/YY</contract> <supportExpiration>MM/DD/YY</supportExpiration> <location>Building 123</location> <serial>xxx-xxx-xxxx</serial> <mac>some-mac-address</mac> </attributes> </object> Etc... I've seen something called TCLXML but I'm not sure if this is the best route or even how to create the package to use it.. Any help will be greatly appreciated.

    Read the article

  • juqery image fading with tabs

    - by StealthRT
    Hey all, i am trying my best to figure out how to go about doing this: I have 2 tabs. When the page loads tab1 is selected automatically. This shows the tab as 1.0 transparency while tab2 stays at 0.7. Once the user clicks on tab2, tab1 goes to 0.7 transparency and tab2 goes to 1.0. However, i can not seem to get it to do that! Here is my code: function checkTab(theTab) { $('#tab1').fadeTo(250, 0.70); $('#tab2').fadeTo(250, 0.70); if ($("#tabActive").val() == theTab) { $(theTab).fadeTo(250, 1); } } $(document).ready(function() { $('#tab1').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab1')}); $('#tab2').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab2')}); $('#tab2').fadeTo(250, 0.70); $('#tabActive').val('tab1'); }); </script> <li class="stats"><img src="images/Stats.png" name="nav1" width="70" height="52" id="tab1" onclick="$('#tabActive').val('tab1');" /></li> <li class="cal"><img src="images/cal.png" name="nav1" width="70" height="52" id="tab2" onclick="$('#tabActive').val('tab2');" /></li> <input name="tabActive" id="tabActive" type="text" /> Any help would be great! :) David

    Read the article

  • How do I use HTML5's localStorage in a Google Chrome extension?

    - by davidkennedy85
    I am trying to develop an extension that will work with Awesome New Tab Page. I've followed the author's advice to the letter, but it doesn't seem like any of the script I add to my background page is being executed at all. Here's my background page: <script> var info = { poke: 1, width: 1, height: 1, path: "widget.html" } chrome.extension.onRequestExternal.addListener(function(request, sender, sendResponse) { if (request === "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-poke") { chrome.extension.sendRequest( sender.id, { head: "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-pokeback", body: info, } ); } }); function initSelectedTab() { localStorage.setItem("selectedTab", "Something"); } initSelectedTab(); </script> Here is manifest.json: { "update_url": "http://clients2.google.com/service/update2/crx", "background_page": "background.html", "name": "Test Widget", "description": "Test widget for mgmiemnjjchgkmgbeljfocdjjnpjnmcg.", "icons": { "128": "icon.png" }, "version": "0.0.1" } Here is the relevant part of widget.html: <script> var selectedTab = localStorage.getItem("selectedTab"); document.write(selectedTab); </script> Every time, the browser just displays null. The local storage isn't being set at all, which makes me think the background page is completely disconnected. Do I have something wired up incorrectly?

    Read the article

  • Multiple dispatching issue

    - by user1440263
    I try to be synthetic: I'm dispatching an event from a MovieClip (customized symbol in library) this way: public function _onMouseDown(e:MouseEvent){ var obj = {targetClips:["tondo"],functionString:"testFF"}; dispatchEvent(new BridgeEvent(BridgeEvent.BRIDGE_DATA,obj)); } The BridgeEvent class is the following: package events { import flash.events.EventDispatcher; import flash.events.Event; public class BridgeEvent extends Event { public static const BRIDGE_DATA:String = "BridgeData"; public var data:*; public function BridgeEvent(type:String, data:*) { this.data = data; super(type, true); } } } The document class listens to the event this way: addEventListener(BridgeEvent.BRIDGE_DATA,eventSwitcher); In eventSwitcher method I have a simple trace("received"). What happens: when I click the MovieClip the trace action gets duplicated and the output window writes many "received" (even if the click is only one). What happens? How do I prevent this behaviour? What is causing this? Any help is appreciated. [SOLVED] I'm sorry, you will not believe this. A colleague, to make me a joke, converted the MOUSE_DOWN handler to MOUSE_OVER.

    Read the article

  • calling java script function then C# function after clicking ASP.NET button

    - by Eyla
    I have this serious: I have ASP.NET page, This page contents Update panel with ASP.NET control. I have Java script function to do validation so when I click the button I will use onclientclick to call the java function to do the validation and after this one done should call then event click button function from code behind. I tried vew methods but they did not work for me. here is sample of my code that after I click the button onclientclick will call the java script function for validation and if the validation is OK should call onclick event. .................... java script function ........................ <script type="text/javascript" > function add(){ if (tag == trye) { document.getElementById('<%=btnInfor.ClientID%>').click(); alert("DataAdded") } else { alert("Requiered Field Missing.") return false; } } </script> ..................... ASP.NET button ................... <asp:Button ID="btnInfor" runat="server" Text="Add Information" Style="position: absolute; top: 1659px; left: 433px;" onclientclick="JavaScript: return myAdd()" /> .................... code behind in C# ...................... protected void btnInfor_Click(object sender, EventArgs e) { \\mycode }

    Read the article

  • How to make HTML layout whitespace-agnostic?

    - by ssg
    If you have consecutive inline-blocks white-space becomes significant. It adds some level of space between elements. What's the "correct" way of avoiding whitespace effect to HTML layout if you want those blocks to look stuck to each other? Example: <span>a</span> <span>b</span> This renders differently than: <span>a</span><span>b</span> because of the space inbetween. I want whitespace-effect to go away without compromising HTML source code layout. I want my HTML templates to stay clean and well-indented. I think these options are ugly: 1) Tweaking text-indent, margin, padding etc. (Because it would be dependent on font-size, default white-space width etc) 2) Putting everything on a single line, next to each other. 3) Zero font-size. That would require overriding font-size in blocks, which would otherwise be inherited. 4) Possible document-wide solutions. I want the solution to stay local for a certain block of HTML. Any ideas, any obvious points which I'm missing?

    Read the article

  • Trying to fadein divs in a sequence, over time, using JQuery

    - by user346602
    Hi, I'm trying to figure out how to make 4 images fade in sequentially when the page loads. The following is my (amateurish) code: Here is the HTML: <div id="outercorners"> <img id="corner1" src="images/corner1.gif" width="6" height="6" alt=""/> <img id="corner2" src="images/corner2.gif" width="6" height="6" alt=""/> <img id="corner3" src="images/corner3.gif" width="6" height="6" alt=""/> <img id="corner4" src="images/corner4.gif" width="6" height="6" alt=""/> </div><!-- end #outercorners--> Here is the JQuery: $(document).ready(function() { $("#corner1").fadeIn("2000", function(){ $("#corner3").fadeIn("4000", function(){ $("#corner2").fadeIn("6000", function(){ $("#corner4").fadeIn("8000", function(){ }); }); }); }); Here is the css: #outercorners { position: fixed; top:186px; left:186px; width:558px; height:372px; } #corner1 { position: fixed; top:186px; left:186px; display: none; } #corner2 { position: fixed; top:186px; left:744px; display: none; } #corner3 { position: fixed; top:558px; left:744px; display: none; } #corner4 { position: fixed; top:558px; left:186px; display: none; } They seem to just wink at me, rather than fade in in the order I've ascribed to them. Should I be using the queue() function? And, if so, how would I implement it in this case? Thank you for any assistance.

    Read the article

  • Rack, FastCGI, Lighttpd configuration

    - by zacsek
    Hi! I want to run a simple application using Rack, FastCGI and Lighttpd, but I cannot get it working. I get the following error: /usr/lib/ruby/1.8/rack/handler/fastcgi.rb:23:in `initialize': Address already in use - bind(2) (Errno::EADDRINUSE) from /usr/lib/ruby/1.8/rack/handler/fastcgi.rb:23:in `new' from /usr/lib/ruby/1.8/rack/handler/fastcgi.rb:23:in `run' from /www/test.rb:7 Here is the application: #!/usr/bin/ruby app = Proc.new do |env| [200, {'Content-Type' => 'text/plain'}, "Hello World!"] end require 'rack' Rack::Handler::FastCGI.run app, :Port => 4000 ... and the lighttpd.conf: server.modules += ( "mod_access", "mod_accesslog", "mod_fastcgi" ) server.port = 80 server.document-root = "/www" mimetype.assign = ( ".html" => "text/html", ".txt" => "text/plain", ".jpg" => "image/jpeg", ".png" => "image/png" ) index-file.names = ( "test.rb" ) fastcgi.debug = 1 fastcgi.server = ( ".rb" => (( "host" => "127.0.0.1", "port" => 4000, "bin-path" => "/www/test.rb", "check-local" => "disable", "max-procs" => 1 )) ) Can someone help me? What am I doing wrong?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How do I use Core Data with the Cocoa Text Input system?

    - by the Joel
    Hobbyist Cocoa programmer here. Have been looking around all the usual places, but this seems relatively under-explained: I am writing something a little out of the ordinary. It is much simpler than, but similar to, a desktop publishing app. I want editable text boxes on a canvas, arbitrarily placed. This is document-based and I’d really like to use Core Data. Now, The cocoa text-handling system seems to deal with a four-class structure: NSTextStorage, NSLayoutManager, NSTextContainer and finally NSTextView. I have looked into these and know how to use them, sort of. Have been making some prototypes and it works for simple apps. The problem arrives when I get into persistency. I don't know how to, by way of Cocoa Bindings or something else, store the contents of NSTextStorage (= the actual text) in my managed object context. I have considered overriding methods pairs like -words, -setWords: in these objects. This would let me link the words to a String, which I know how to store in Core Data. However, I’d have to override any method that affects the text - and that seems a little much. Thankful for any insights.

    Read the article

  • Google Charts - Adding Tooltip to Colorized Column Chart

    - by David K
    I created a column chart with google charts that has a different color assigned to each column using the following posting: Assign different color to each bar in a google chart But now I'm trying to figure out how to customize the tooltips for each column to also include the number of users in addition to the percent, so "raw_data[i][1]" I would like it to look like "70% (80 Users)" I understand that there is "data.addColumn({type:'number',role:'tooltip'});" but I'm having trouble understanding how to implement it for this use-case. function drawAccountsChart() { var data = new google.visualization.DataTable(); var raw_data = [ ['Parents', 80, 160], ['Students', 94, 128], ['Teachers', 78, 90], ['Admins', 68, 120], ['Staff', 97, 111] ]; data.addColumn('string', 'Columns'); for (var i = 0; i < raw_data.length; ++i) { data.addColumn('number', raw_data[i][0]); } data.addRows(1); for (var i = 0; i < raw_data.length; ++i) { data.setValue(0, i+1, raw_data[i][1]/raw_data[i][2]*100); } var options = { height:220, chartArea: { left:30, width: "70%", height: "70%" }, backgroundColor: { fill:"transparent" }, tooltop:{ textStyle: {fontSize: "12px",}}, vAxis: {minValue: 0} }; var formatter = new google.visualization.NumberFormat({ suffix: '%', fractionDigits: 1 }); formatter.format(data, 1); formatter.format(data, 2); formatter.format(data, 3); formatter.format(data, 4); formatter.format(data, 5); var chart = new google.visualization.ColumnChart(document.getElementById('emailAccountsChart')); chart.draw(data, options); }

    Read the article

  • jquery animate from object center

    - by mtwallet
    Hi. I am trying to create a product viewer similar to the one at the bottom of this page http://www.logitech.com/en-gb/. As you can see the product animates from the center rather than top left which I think is Jquery's default. So what I am doing is trying animate the width and height and then also the offset to make it look like it animates from the center. My code looks like this: <style> body { background: black; } .box { background: #fff url('pic.jpg') no-repeat 0 0; width: 200px; height: 200px; margin: 10px 4%; float: left; } </style> <script type="text/javascript"> $(document).ready(function() { $(".box").hover(function() { $(".box").not(this).fadeTo(500, 0.5); $(this).animate({ width: 300, height: 300, left: -100, top: -100 }, 500); }, function() { $(this).animate({ width: 200, height: 200, left: 100, top: 100 }, 500); $(".box").fadeTo(500, 1); }); }); </script> I cannot seem to get this working as I want. Can anyone help with this or suggest a better technique? Many thanks

    Read the article

  • Sharepoint user details not visible to other users

    - by richardoz
    I am managing a SharePoint site that uses Form Based Authentication. We have several generic lists, document libraries and active task lists that users can create update and delete. Users can use the people pickers to select/search for everyone. But the users cannot see other users names, email addresses etc. in display lists or the people pickers. If I log in as the site collection administrator, I can see everyones details. So I know the data is available. Updated details on this problem (non-administrators) SharePoint users cannot see other users information. Example: User A assigns a task to user B. User A creates a new task and uses the people picker to find user B. User B is only visible by the login name “bname” and any information about user B is not visible or searchable within the people picker. Once user B is assigned the task, user A no longer sees the name in the task list – even though user A created it. No modified by, created by, assigned to or owner field data is visible to non-administrator users. Facts: Extranet site is configured to use Forms Based Authentication. Intranet uses windows based authentication Users of both the intranet and extranet have the same problem All databases are local The site uses SSRS integration SharePoint WSS on Windows 2003 Std -- After activating the verbose logging it looks like SharePoint is definately asking SQL server for only the user info for the currently logged in user: SELECT TOP 6 /lots-of-columns/ FROM UserData INNER MERGE JOIN Docs AS t1 ON ( 1 = 1 AND UserData.[tp_RowOrdinal] = 0 AND t1.SiteId = UserData.tp_SiteId AND t1.SiteId = @L2 AND t1.DirName = UserData.tp_DirName AND t1.LeafName = UserData.tp_LeafName AND t1.Level = UserData.tp_Level AND t1.IsCurrentVersion = 1 AND (1 = 1) ) LEFT OUTER JOIN AllUserData AS t2 ON ( UserData.[tp_Author]=t2.[tp_ID] AND UserData.[tp_RowOrdinal] = 0 AND t2.[tp_RowOrdinal] = 0 AND ( (t2.tp_IsCurrent = 1) ) AND t2.[tp_CalculatedVersion] = 0 AND t2.[tp_DeleteTransactionId] = 0x AND t2.tp_ListId = @L3 AND UserData.tp_ListId = @L4 AND t2.[tp_Author]=162 /* this is the currently logged in user */ ) WHERE (UserData.tp_IsCurrent = 1) AND UserData.tp_SiteId=@L2 AND (UserData.tp_DirName=@DN) AND UserData.tp_RowOrdinal=0 AND ( ( (UserData.[datetime1] IS NULL ) OR (UserData.[datetime1] = @L5DTP) ) AND t1.SiteId=@L2 AND (t1.DirName=@DN) ) ORDER BY UserData.[tp_Modified] Desc, UserData.[tp_ID] Asc Again, any ideas would be appreciated.

    Read the article

  • PreparedStatement question in Java against Oracle.

    - by fardon57
    Hi everyone, I'm working on the modification of some code to use preparedStatement instead of normal Statement, for security and performance reason. Our application is currently storing information into an embedded derby database, but we are going to move soon to Oracle. I've found two things that I need your help guys about Oracle and Prepared Statement : 1- I've found this document saying that Oracle doesn't handle bind parameters into IN clauses, so we cannot supply a query like : Select pokemon from pokemonTable where capacity in (?,?,?,?) Is that true ? Is there any workaround ? ... Why ? 2- We have some fields which are of type TIMESTAMP. So with our actual Statement, the query looks like this : Select raichu from pokemonTable where evolution = TO_TIMESTAMP('2500-12-31 00:00:00.000', 'YYYY-MM-DD HH24:MI:SS.FF') What should be done for a prepared Statement ? Should I put into the array of parameters : 2500-12-31 or TO_TIMESTAMP('2500-12-31 00:00:00.000', 'YYYY-MM-DD HH24:MI:SS.FF') ? Thanks for your help, I hope my questions are clear ! Regards,

    Read the article

  • How can click on a java show link programatically?

    - by Jules
    I'm trying to develop a new feature for our vb.net order entry system. At the moment I provide an assisted paypal login which loops through transactions and copies the transactions. My program then looks at this data and copies it into text boxes. The operator then approves and saves the record. So my code uses IHTMLFormElement and loops round form elements and adds values. However I only really use this to log in to paypal. See my code... Dim theObject As Object = Nothing theObject = "https://www.paypal.com/cgi-bin/webscr?cmd=_login-run" WebBrowPayPal.AxWebBrowser1.Navigate2(theObject) While WebBrowPayPal.AxWebBrowser1.ReadyState <> tagREADYSTATE.READYSTATE_COMPLETE Application.DoEvents() End While Dim HtmlDoc As IHTMLDocument2 = CType(WebBrowPayPal.AxWebBrowser1.Document, IHTMLDocument2) Dim FormCol As IHTMLElementCollection = HtmlDoc.forms Dim iForms As Integer = FormCol.length Dim i As Integer Dim x As Integer For i = 0 To iForms - 1 Dim oForm As IHTMLFormElement = CType(FormCol.item(CType(i, Object), CType(i, Object)), IHTMLFormElement) For x = 0 To oForm.length - 1 If oForm.elements(x).tagname = "INPUT" Then If oForm.elements(x).name = "login_email" Then oForm.elements(x).value = "[email protected]" End If If oForm.elements(x).name = "login_password" Then oForm.elements(x).value = "mypassword" End If If oForm.elements(x).type = "submit" Or _ oForm.elements(x).type = "SUBMIT" Then oForm.elements(x).click() End If End If Next Next i I'm now trying this page https://www.paypal.com/uk/cgi-bin/webscr?cmd=_history&nav=0.3.0 Which is the history page, which allows you to search on the paypal transaction id. Unfortunately you need to click on 'find a transaction' which then uses some javascript to shows the post fields. So the problem is that the fields I need to use are hidden. How can I click on this java link in code ?

    Read the article

  • Javascript onclick() event bubbling - working or not?

    - by user1071914
    I have a table in which the table row tag is decorated with an onclick() handler. If the row is clicked anywhere, it will load another page. In one of the elements on the row, is an anchor tag which also leads to another page. The desired behavior is that if they click on the link, "delete.html" is loaded. If they click anywhere else in the row, "edit.html" is loaded. The problem is that sometimes (according to users) both the link and the onclick() are fired at once, leading to a problem in the back end code. They swear they are not double-clicking. I don't know enough about Javascript event bubbling, handling and whatever to even know where to start with this bizarre problem, so I'm asking for help. Here's a fragment of the rendered page, showing the row with the embedded link and associated script tag. Any suggestions are welcomed: <tr id="tableRow_3339_0" class="odd"> <td class="l"></td> <td>PENDING</td> <td>Yabba Dabba Doo</td> <td>Fred Flintstone</td> <td> <a href="/delete.html?requestId=3339"> <div class="deleteButtonIcon"></div> </a> </td> <td class="r"></td> </tr> <script type="text/javascript">document.getElementById("tableRow_3339_0").onclick = function(event) { window.location = '//edit.html?requestId=3339'; };</script>

    Read the article

  • updating multiple nodes in xml with xquery and xdmp:node-replace

    - by morja
    Hi all, I wnat to update an XML document in my xml database (Marklogic). I have xml as input and want to replace each node that exists in the target xml. If a node does not exist it would be great if it gets added, but thats maybe another task. My XML in the database: <user> <username>username</username> <firstname>firstname</firstname> <lastname>lastname</lastname> <email>[email protected]</email> <comment>comment</comment> </user> The value of $user_xml: <user> <firstname>new firstname</firstname> <lastname>new lastname</lastname> </user> My function so far: declare function update-user ( $username as xs:string, $user_xml as node()) as empty-sequence() { let $uri := user-uri($username) return for $node in $user_xml/user return xdmp:node-replace(fn:doc($uri)/user/fn:node-name($node), $node) }; First of all I cannot iterate over $user_xml/user. If I try to iterate over $user_xml I get "arg1 is not of type node()" exception. But maybe its the wrong approach anyway? Does anybody maybe have sample code how to do this?

    Read the article

  • curl post picture multipart/form-data, php cURL need help!

    - by user331071
    I'm trying to upload a picture to a specific website using php cURL but I don't really understand what parameters do I need to send because the data looks a bit weird . Here is what i got with the http analyzer Type : multipart/form-data; boundary=---------------------------182983931283 -----------------------------182983931283 Content-Disposition: form-data; name="file"; filename="Blue hills.jpg" Content-Type: image/jpeg Here appears the souce of the image itself like "ÿØÿàÿØÿàÿØÿàÿØÿàÿØÿàÿØÿà" -----------------------------182983931283 Content-Disposition: form-data; name="action" images -----------------------------182983931283 Content-Disposition: form-data; name="anonymous_email" Y -----------------------------182983931283 Content-Disposition: form-data; name="site_id" 1 -----------------------------182983931283 and so on other parameters. The issue that I have is that I don't understand what is the boundary, where do I get it from (because it doesn't appear in the html document that generates the POST and how should I make the post . If you would give me a simple example to post the above parameters to http://example.com I will definitely get the trick . Currently I'm using the following function to make the post : function processPicturesPage($title, $price, $numbedrooms, $description) { //Set the login parameters and initiate the Login process $fields = array( "changedImages" = "", "site_id" = "1", "posting_id" = "", "current_live_date" = "", "images_loaded" = "", "image_actions" = "", "title" = $title, ); foreach($fields as $key=$value) { $fields_string .= $key.'='.$value.'&'; } rtrim($fields_string,'&'); $URL = "http://www.example.com/cgi-bin/add_posting.pl"; return $this-processCurlrequest($URL, count($fields), $fields_string); } and in the processCurlrequest I have the curl options (cookies etc) and url .

    Read the article

  • php not redirecting

    - by NSchulze
    I'm trying to write the logout of a website. When I do this I want the page to redirect to the login page. I think I'm doing it the correct way, but can't get the right result. Could you guys point me in the right direction? Relevant Code: <button onclick="logout()">Logout</button> function logout() { var xmlhttp; if (window.XMLHttpRequest) {// code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp=new XMLHttpRequest(); } else {// code for IE6, IE5 xmlhttp=new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.onreadystatechange=function() { if (xmlhttp.readyState==4 && xmlhttp.status==200) { document.location=xmlhttp.responseText; } } xmlhttp.open("GET","logout.php",true); xmlhttp.send(); } <?php session_destroy(); header("Location:http://localhost:8888/loginns.html"); mysql_close($con); ?> Thanks!

    Read the article

< Previous Page | 467 468 469 470 471 472 473 474 475 476 477 478  | Next Page >