Search Results

Search found 13948 results on 558 pages for 'document centric'.

Page 472/558 | < Previous Page | 468 469 470 471 472 473 474 475 476 477 478 479  | Next Page >

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Add xml-stylesheet and get standalone = yes.

    - by tumba25
    The code at the bottom is what I have. I removed the creation of all tags. At the top in the xml file I get.<?xml version="1.0" encoding="UTF-8" standalone="no"?> Note that standalone is no, even thou I have it set to yes. The first question: How do I get standalone = yes? I would like to add <?xml-stylesheet type="text/xsl" href="my.stylesheet.xsl"?> at line two in the xml file. Second question: How do I do that? Some useful links? Anything? DocumentBuilderFactory dbfac = DocumentBuilderFactory.newInstance(); DocumentBuilder docBuilder = dbfac.newDocumentBuilder(); Document doc = docBuilder.newDocument(); <cut> TransformerFactory transfac = TransformerFactory.newInstance(); transfac.setAttribute("indent-number", new Integer(2)); Transformer trans = transfac.newTransformer(); trans.setOutputProperty(OutputKeys.OMIT_XML_DECLARATION, "no"); trans.setOutputProperty(OutputKeys.STANDALONE, "yes"); trans.setOutputProperty(OutputKeys.INDENT, "yes"); trans.setOutputProperty(OutputKeys.CDATA_SECTION_ELEMENTS, "name"); FileOutputStream fout = new FileOutputStream(filepath); BufferedOutputStream bout= new BufferedOutputStream(fout); trans.transform(new DOMSource(doc), new StreamResult(new OutputStreamWriter(bout, "utf-8")));

    Read the article

  • updating multiple nodes in xml with xquery and xdmp:node-replace

    - by morja
    Hi all, I wnat to update an XML document in my xml database (Marklogic). I have xml as input and want to replace each node that exists in the target xml. If a node does not exist it would be great if it gets added, but thats maybe another task. My XML in the database: <user> <username>username</username> <firstname>firstname</firstname> <lastname>lastname</lastname> <email>[email protected]</email> <comment>comment</comment> </user> The value of $user_xml: <user> <firstname>new firstname</firstname> <lastname>new lastname</lastname> </user> My function so far: declare function update-user ( $username as xs:string, $user_xml as node()) as empty-sequence() { let $uri := user-uri($username) return for $node in $user_xml/user return xdmp:node-replace(fn:doc($uri)/user/fn:node-name($node), $node) }; First of all I cannot iterate over $user_xml/user. If I try to iterate over $user_xml I get "arg1 is not of type node()" exception. But maybe its the wrong approach anyway? Does anybody maybe have sample code how to do this?

    Read the article

  • Which pdf elements could cause crashes?

    - by Felixyz
    This is a very general question but it's based on a specific problem. I've created a pdf reader app for the iPad and it works fine except for certain pdf pages which always crash the app. We now found out that the very same pages cause Safari to crash as well, so as I had started to suspect the problem is somewhere in Apple's pdf rendering code. From what I have been able to see, the crashing pages cause the rendering libraries to start allocating memory like mad until the app is killed. I have nothing else to help me pinpoint what triggers this process. It doesn't necessarily happen with the largest documents, or the ones with the most shapes. In fact, we haven't found any parameter that helps us predict which pages will crash and which not. Now we just discovered that running the pages through a consumer program that lets you merge docs gets rid of the problem, but I haven't been able to detect which attribute or element it is that is the key. Changing documents by hand is also not an option for us in the long run. We need to run an automated process on our server. I'm hoping someone with deeper knowledge about the pdf file format would be able to point me in a reasonable direction to look for document features that could cause this kind of behavior. All I've found so far is something about JBIG2 images, and I don't think we have any of those.

    Read the article

  • Add an event to HTML elements with a specific class.

    - by Juan C. Rois
    Hello everybody, I'm working on a modal window, and I want to make the function as reusable as possible. Said that, I want to set a few anchor tags with a class equals to "modal", and when a particular anchor tag is clicked, get its Id and pass it to a function that will execute another function based on the Id that was passed. This is what I have so far: // this gets an array with all the elements that have a class equals to "modal" var anchorTrigger = document.getElementsByClassName('modal'); Then I tried to set the addEventListener for each item in the array by doing this: var anchorTotal = anchorTrigger.length; for(var i = 0; i < anchorTotal ; i++){ anchorTrigger.addEventListener('click', fireModal, false); } and then run the last function "fireModal" that will open the modal, like so: function fireModal(){ //some more code here ... } My problem is that in the "for" loop, I get an error saying that anchorTrigger.addEvent ... is not a function. I can tell that the error might be related to the fact that I'm trying to set up the "addEventListener" to an array as oppose to individual elements, but I don't know what I'm supposed to do. Any help would be greatly appreciated.

    Read the article

  • How to select LI except first and second ?

    - by Wazdesign
    Here is the structure of the content, I want to select all LI except the first two (ie no-link) jQuery(document).ready(function(){ var nosubnav = jQuery('.first-level li:not(:has(ul))'); var nosubnavsize = jQuery('.first-level li:not(:has(ul))').size(); jQuery(nosubnav).css('border' , '1px solid red'); alert('List item which does not have submenu '+nosubnavsize); }); div class="navigation-container"> <ul class="first-level"> <li><a href="#">No Link</a></li> <li><a href="#">No Link</a></li> <li><a href="#">Link 1</a></li> <li><a href="#">Link 2</a> <ul> <li><a href="#">Link2.1</a></li> <li><a href="#">Link2.2</a> <ul> <li><a href="#">Link 2.2.1</a></li> </ul> </li> </ul> </li> <li><a href="#">Link </a></li> </ul> </div> related Question : http://stackoverflow.com/questions/2771801/how-to-count-li-which-does-not-have-ul

    Read the article

  • How to emulate mod_rewrite in PHP

    - by Tyler Crompton
    I have a few URLs that I want to map to certain files via PHP. Currently, I am just using mod_rewrite in Apache. However, my application is getting too large for the rewriting to be done with regular expressions. So I created a file router.php that does the rewriting. I understand to do a redirect I could just send the Location: header. However, I don't always want to do a redirect. For example, I may want /api/item/ to map to the file /herp/derp.php relative to the document root. I need to preserve the HTTP method as well. "No problem," I thought. I made my .htaccess have the following snippet. RewriteEngine On RewriteRule ^api/item/$ /cgi-bin/router.php [L] And my router.php file looks as follows: <?php $uri = parse_url($_SERVER['REQUEST_URI']); $query = isset($uri['query']) ? $uri['query'] ? array(); // some code that modifies the query require_once "{$_SERVER['DOCUMENT_ROOT']}/herp/derp.php?" . http_build_query($query); ?> However, this doesn't work, because the OS is looking for a file named derp.php?some=query. How can I simulate a rewrite rule such as RewriteRule ^api/item/$ /herp/derp/ [L] in PHP. In other words, how do I tell the server to process a different URL than requested and preserve the query and HTTP method without causing a redirect? Note: Using variables set in router.php is less than desirable and is bad structure since it's only supposed to be responsible for handling URLs. I am open to using a light-weight third party solution.

    Read the article

  • Google Charts - Adding Tooltip to Colorized Column Chart

    - by David K
    I created a column chart with google charts that has a different color assigned to each column using the following posting: Assign different color to each bar in a google chart But now I'm trying to figure out how to customize the tooltips for each column to also include the number of users in addition to the percent, so "raw_data[i][1]" I would like it to look like "70% (80 Users)" I understand that there is "data.addColumn({type:'number',role:'tooltip'});" but I'm having trouble understanding how to implement it for this use-case. function drawAccountsChart() { var data = new google.visualization.DataTable(); var raw_data = [ ['Parents', 80, 160], ['Students', 94, 128], ['Teachers', 78, 90], ['Admins', 68, 120], ['Staff', 97, 111] ]; data.addColumn('string', 'Columns'); for (var i = 0; i < raw_data.length; ++i) { data.addColumn('number', raw_data[i][0]); } data.addRows(1); for (var i = 0; i < raw_data.length; ++i) { data.setValue(0, i+1, raw_data[i][1]/raw_data[i][2]*100); } var options = { height:220, chartArea: { left:30, width: "70%", height: "70%" }, backgroundColor: { fill:"transparent" }, tooltop:{ textStyle: {fontSize: "12px",}}, vAxis: {minValue: 0} }; var formatter = new google.visualization.NumberFormat({ suffix: '%', fractionDigits: 1 }); formatter.format(data, 1); formatter.format(data, 2); formatter.format(data, 3); formatter.format(data, 4); formatter.format(data, 5); var chart = new google.visualization.ColumnChart(document.getElementById('emailAccountsChart')); chart.draw(data, options); }

    Read the article

  • Trying to fadein divs in a sequence, over time, using JQuery

    - by user346602
    Hi, I'm trying to figure out how to make 4 images fade in sequentially when the page loads. The following is my (amateurish) code: Here is the HTML: <div id="outercorners"> <img id="corner1" src="images/corner1.gif" width="6" height="6" alt=""/> <img id="corner2" src="images/corner2.gif" width="6" height="6" alt=""/> <img id="corner3" src="images/corner3.gif" width="6" height="6" alt=""/> <img id="corner4" src="images/corner4.gif" width="6" height="6" alt=""/> </div><!-- end #outercorners--> Here is the JQuery: $(document).ready(function() { $("#corner1").fadeIn("2000", function(){ $("#corner3").fadeIn("4000", function(){ $("#corner2").fadeIn("6000", function(){ $("#corner4").fadeIn("8000", function(){ }); }); }); }); Here is the css: #outercorners { position: fixed; top:186px; left:186px; width:558px; height:372px; } #corner1 { position: fixed; top:186px; left:186px; display: none; } #corner2 { position: fixed; top:186px; left:744px; display: none; } #corner3 { position: fixed; top:558px; left:744px; display: none; } #corner4 { position: fixed; top:558px; left:186px; display: none; } They seem to just wink at me, rather than fade in in the order I've ascribed to them. Should I be using the queue() function? And, if so, how would I implement it in this case? Thank you for any assistance.

    Read the article

  • Jquery Returning values to original

    - by Cam
    So my script works perfectly, but here is the issue, I have buttons (Sprite action here) that are 40px height, but the top 20 only shows perfectly. When you click the button ie img the bottom 20px show perfecto! but... Issue, i included in my script a way to return all others to there default (only one should be selected) now, how can I fix this issue that I seem unable to correct as I can select multiple of them ** USERS can switch ** The last part of the script that is the issue. Thanks $(document).ready(function() { $('.form_sub').hide(); $('.theader').addClass('active'); $('.theader_t').click(function() { $('.form_header').show(); $('.form_sub').hide(); $('.theader').addClass('active'); $('.sub_theader').removeClass('active'); }); $('.sub_theader_t').click(function() { $('.form_header').hide(); $('.form_sub').show(); $('.theader').removeClass('active'); $('.sub_theader').addClass('active'); }); $('.top_head_img').click(function() { $(this).css({ position: 'relative', bottom: '20px' }).siblings().css( 'bottom', '0' ); }); }); <ul class="top_head"> <li> <a href="javascript:void(0)" onClick="selectPic5('top');"><img src="custom/images/top2.jpg" alt="Left" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('center');"><img src="custom/images/mid2.jpg" alt="Center" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('bottom');"><img src="custom/images/bot2.jpg" alt="Right" border="0" class="top_head_img"/></a> </li> </ul>

    Read the article

  • Why don't copy this dokument attributes from the source xml file??

    - by siegfried storr
    Hi anyone, i'm working the first time with xslt and i really don't understand why this xsl don't copy attributes from the source xml. Perhaps someone can give me a hint?? <xsl:stylesheet version="2.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:output omit-xml-declaration="yes" indent="yes"/> <xsl:variable name="rpl" select="document('ParamInvoice.xml')"/> <xsl:template match="/"> <xsl:copy> <xsl:apply-templates select="* | @*"/> </xsl:copy> </xsl:template> <xsl:template match="*"> <xsl:variable name="vInvoiceElement" select="$rpl/StoraInvoice/*[name()=name(current())]"/> <xsl:copy> <xsl:if test="$vInvoiceElement/Attribute"> <xsl:call-template name="AttributeErzeugen"> <xsl:with-param name="pAttr" select="$vInvoiceElement/Attribute"/> </xsl:call-template> </xsl:if> <xsl:apply-templates/> </xsl:copy> </xsl:template> <xsl:template name="AttributeErzeugen"> <xsl:param name="pAttr"/> <xsl:for-each select="$pAttr"> <xsl:attribute name="{@name}"><xsl:value-of select="."/></xsl:attribute> </xsl:for-each> </xsl:template> </xsl:stylesheet>

    Read the article

  • Can someone tell me why this JavaScript code isn't lining up an array in order?

    - by DarkLightA
    Live code: http://jsfiddle.net/fCUZC/ //INPUT ARRAY: var input = [28,32,21,11,8,2,14,32,64]; //VARIABLE DECLARATION. a = highest number so far, b = position of that number entireLoop: for (var i = 1; i<=input.length; i++) { if(input[i] > input[i-1]) { for(var o = i; o>=0; o--) { if(input[i-1] > input[o]) { input.splice(i,0,input[o]); input.splice((o+1),1); continue entireLoop; } else if(input[o] > input[0]) { input.splice(0,0,input[o]); input.splice((o+1),1); continue entireLoop; } } } } document.write(input); I'm trying to order the array from largest to smallest, but there's a 32 stuck somewhere. I know there's the sort method, but I'm a newbie and want to try this for myself.

    Read the article

  • opening a new page and passing a parameter to it with Javascript

    - by recipriversexclusion
    I have a JS function that processes XML I GET from a server to dynamically create a table as below // Generate table of services by parsing the returned XML service list. function convertServiceXmlDataToTable(xml) { var tbodyElem = document.getElementById("myTbody"); var trElem, tdElem; var j = 0; $(xml).find("Service").each(function() { trElem = tbodyElem.insertRow(tbodyElem.rows.length); trElem.className = "tr" + (j % 2); // first column -> service ID var serviceID = $(this).attr("service__id"); tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col0"; tdElem.innerHTML = serviceID; // second column -> service name tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col1"; tdElem.innerHTML = "<a href=javascript:showServiceInfo(" + serviceID + ")>" + $(this).find("name").text() + "</a>"; j++; }); // each service } where showServiceInfo retrieves more detailed information about each service from the server based on the serviceID and displays it in the same page as the services table. So far so good. But, it turns out that I have to display the detailed service information in another page rather than the same page as the table. I have creates a generic service_info.html with an empty layout template, but I don't understand how to pass serviceID to this new page so that it gets customized with the detailed service info. How can I do this? Or, is there a better way to handle these situations? Thanks!

    Read the article

  • Testing approach for multi-threaded software

    - by Shane MacLaughlin
    I have a piece of mature geospatial software that has recently had areas rewritten to take better advantage of the multiple processors available in modern PCs. Specifically, display, GUI, spatial searching, and main processing have all been hived off to seperate threads. The software has a pretty sizeable GUI automation suite for functional regression, and another smaller one for performance regression. While all automated tests are passing, I'm not convinced that they provide nearly enough coverage in terms of finding bugs relating race conditions, deadlocks, and other nasties associated with multi-threading. What techniques would you use to see if such bugs exist? What techniques would you advocate for rooting them out, assuming there are some in there to root out? What I'm doing so far is running the GUI functional automation on the app running under a debugger, such that I can break out of deadlocks and catch crashes, and plan to make a bounds checker build and repeat the tests against that version. I've also carried out a static analysis of the source via PC-Lint with the hope of locating potential dead locks, but not had any worthwhile results. The application is C++, MFC, mulitple document/view, with a number of threads per doc. The locking mechanism I'm using is based on an object that includes a pointer to a CMutex, which is locked in the ctor and freed in the dtor. I use local variables of this object to lock various bits of code as required, and my mutex has a time out that fires my a warning if the timeout is reached. I avoid locking where possible, using resource copies where possible instead. What other tests would you carry out?

    Read the article

  • ASP.NET - Webservice not being called from javascript

    - by Robert
    Ok I'm stumped on this one. I've got a ASMX web service up and running. I can browse to it (~/Webservice.asmx) and see the .NET generated page and test it out.. and it works fine. I've got a page with a Script Manager with the webservice registered... and i can call it in javascript (Webservice.Method(...)) just fine. However, I want to use this Webservice as part of a jQuery Autocomplete box. So I have use the url...? and the Webservice is never being called. Here's the code. [WebService(Namespace = "http://tempuri.org/")] [WebServiceBinding(ConformsTo = WsiProfiles.BasicProfile1_1)] // To allow this Web Service to be called from script, using ASP.NET AJAX, uncomment the following line. [System.Web.Script.Services.ScriptService] public class User : System.Web.Services.WebService { public User () { //Uncomment the following line if using designed components //InitializeComponent(); } [WebMethod] public string Autocomplete(string q) { StringBuilder sb = new StringBuilder(); //doStuff return sb.ToString(); } web.config <system.web> <webServices> <protocols> <add name="HttpGet"/> <add name="HttpPost"/> </protocols> </webServices> And the HTML $(document).ready(function() { User.Autocomplete("rr", function(data) { alert(data); });//this works ("#<%=txtUserNbr.ClientID %>").autocomplete("/User.asmx/Autocomplete"); //doesn't work $.ajax({ url: "/User.asmx/Autocomplete", success: function() { alert(data); }, error: function(e) { alert(e); } }); //just to test... calls "error" function });

    Read the article

  • JQuery tablesorter - Second click on column header doesn't resort

    - by Jonathan
    I'm using tablesorter in on a table I added to a view in django's admin (although I'm not sure this is relevant). I'm extending the html's header: {% block extrahead %} <script type="text/javascript" src="http://code.jquery.com/jquery-1.4.2.js"></script> <script type="text/javascript" src="http://mysite.com/media/tablesorter/jquery.tablesorter.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#myTable").tablesorter(); } ); </script> {% endblock %} When I click on a column header, it sorts the table using this column in descending order - that's ok. When I click the same column header a second time - it does not reorder to ascending order. What's wrong with it? the table's html looks like: <table id="myTable" border="1"> <thead> <tr> <th>column_name_1</th> <th>column_name_2</th> <th>column_name_3</th> </tr> </thead> <tbody> {% for item in extra.items %} <tr> <td>{{ item.0|safe }} </td> <td>{{ item.1|safe }} </td> <td>{{ item.2|safe }} </td> </tr> {% endfor %} </tbody> </table>

    Read the article

  • Latex multicols. Can I group content so it won't split over cols and/or suggest colbreaks?

    - by valadil
    Hi. I'm trying to learn LaTeX. I've been googling this one for a couple days, but I don't speak enough LaTeX to be able to search for it effectively and what documentation I have found is either too simple or goes way over my head (http://www.uoregon.edu/~dspivak/files/multicol.pdf) I have a document using the multicol package. (I'm actually using multicols* so that the first col fills before the second begins instead of trying to balance them, but I don't think that's relevant here.) The columns output nicely, but I want to be able to indicate that some content won't be broken up into different columns. For instance, aaaaaaaa bbbbbbb aaaaaaaa bbbbbbb aaaaaaaa ccccccc bbbbbbbb ccccccc That poor attempt at ascii art columns is what's happening. I'd like to indicate that the b block is a whole unit that shouldn't be broken up into different columns. Since it doesn't fit under the a block, the entirety of the b block should be moved to the second column. Should b be wrapped in something? Is there a block/float/section/box/minipage/paragraph structure I can use? Something specific to multicol? Alternatively is there a way that I can suggest a columnbreak? I'm thinking of something like \- that suggests a hyphenated line break if its convenient, but this would go between blocks. Thanks!

    Read the article

  • Event type property lost in IE-8

    - by Channel72
    I've noticed a strange Javascript error which only seems to happen on Internet Explorer 8. Basically, on IE-8 if you have an event handler function which captures the event object in a closure, the event "type" property seems to become invalidated from within the closure. Here's a simple code snippet which reproduces the error: <html> <head> <script type = "text/javascript"> function handleClickEvent(ev) { ev = (ev || window.event); alert(ev.type); window.setTimeout(function() { alert(ev.type); // Causes error on IE-8 }, 20); } function foo() { var query = document.getElementById("query"); query.onclick = handleClickEvent; } </script> </head> <body> <input id = "query" type = "submit"> <script type = "text/javascript"> foo(); </script> </body> </html> So basically, what happens here is that within the handleClickEvent function, we have the event object ev. We call alert(ev.type) and we see the event type is "click". So far, so good. But then when we capture the event object in a closure, and then call alert(ev.type) again from within the closure, now all of a sudden Internet Explorer 8 errors, saying "Member not found" because of the expression ev.type. It seems as though the type property of the event object is mysteriously gone after we capture the event object in a closure. I tested this code snippet on Firefox, Safari and Chrome, and none of them report an error condition. But in IE-8, the event object seems to become somehow invalidated after it's captured in the closure. Question: Why is this happening in IE-8, and is there any workaround?

    Read the article

  • Returning an integer from a select box - JavaScript

    - by Ross
    Very simply, I want to be able to access the year from the select box as an integer. In my test, my alertbox is telling me the value is undefined. <form name="form1" method="post" action=""> <label>birth year <select name="birth year" id="dueYear"> <OPTION VALUE='' SELECTED>--Year--</OPTION> <OPTION VALUE='2011'>2011</OPTION> <OPTION VALUE='2010'>2010</OPTION> <OPTION VALUE='2009'>2009</OPTION></SELECT> </select> </label> </form> <script type="text/javascript"> var dueDateYear = parseInt(document.getElementById("dueYear")); </script> <button onclick="alert(dueDateYear)">Click Me!</button> All I want it to do, is tell me the year I have selected -- any help would be appreciated, I am a newbie :(

    Read the article

  • Opening a xul file in response to a toolbar extension button click

    - by Graham
    I'm currently building my first Firefox extension, and am having a little difficulty with one piece of functionality. I'd like to open a new browser tab in response to a button click on the toolbar. The new tab should contain the contents of a webpage, together with some extra buttons. At the moment I've created a separate xul file for the contents of the new tab: <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <window id="myapp-report-window" title="Example 4.5.1" xmlns:html="http://www.w3.org/1999/xhtml" xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul"> <script type="application/x-javascript" src="chrome://myapp/content/main.js" /> <toolbox> <toolbar id="nav-toolbar"> <toolbarbutton label="This-is-going-to-do-some-stuff"/> </toolbar> </toolbox> <iframe id="myapp-report-frame" flex="1"/> <script type="text/javascript"> function loadPage(url){ document.getElementById('myapp-report-frame').setAttribute('src',url); } </script> </window> This xul file is launched via this javascript, referenced from the main myapptoolbar.xul: gBrowser.selectedTab = gBrowser.addTab('chrome://myapp/content/report.xul'); var newTabBrowser = gBrowser.getBrowserForTab(gBrowser.selectedTab); newTabBrowser.addEventListener("load", function(){ loadPage('http://www.somedynamicallysetwebsite.com'); }, true); The problem that I'm having is that the loadPage function is not being found, so the src attribute of the iframe is never set. I'm sure it's some silly scoping problem, but I'm very new to firefox extensions (day 2!) so any help would be much appreciated. Thanks for looking! Graham

    Read the article

  • add dynamic field near his parent field?

    - by Kaps Hasija
    hi in my web page i am using Add Dynamic Field Functionality by using jquery. I am adding new div bu clicking on Existing div Like <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> by clicking on parent div i am creating new daynamic div <div class="divA">DivA2 </div> its coming end of the all div's like that <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> <div class="divA">DivA2 </div> But i need along with his parent div Like that <div class="divA">divA1 </div> <div class="divA">DivA2 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> any idea Thanks. This is My Jquery Code newTextBoxDiv = $(document.createElement('div')) .attr("id", text).attr("class", 'test0 ' + text); newTextBoxDiv.html('<div style=" width:150px; class="DivA" float: left"> </div>'); } newTextBoxDiv.appendTo("#contents"); contents is id of main div

    Read the article

  • Problem uploading app to google app engine

    - by Oberon
    I'm having problems uploading an app to the google-app-engine from my work place. I believe the problem is related to proxy, because I do not see the same problem when following the same procedure from home. (I do not specify HTTP_PROXY from home). These are the commands I run: HTTP_PROXY=http://proxy.<thehostname>.com:8080 HTTP_PROXY=https://proxy.<thehostname>.com:8080 appcfg.py --insecure update myappfolder When running the commands I get prompted for email and password, as expected, but after that it immediately exits with this errormessage: Error 302: --- begin server output --- <HTML> <HEAD> <TITLE>Moved Temporarily</TITLE> </HEAD> <BODY BGCOLOR="#FFFFFF" TEXT="#000000"> <H1>Moved Temporarily</H1> The document has moved <A HREF="https://www.google.com/accounts/ClientLogin">here</A>. </BODY> </HTML> --- end server output --- Note: I added the --insecure option because else it gave a warning of missing ssl module. Any idea how to solve or workaround this problem?

    Read the article

  • Syntax for documenting JSON structure

    - by Roman A. Taycher
    So I'm trying to document the format of the json returned by an api I am writing against and I'd like to know if there is any popular format for the documentation of json structure. Note I'm not trying to to test or validate anything, I'm just using this for documentation. Also some ways to add comments to non-constants(items always returned w/ the same value) would be nice. This the not totally thought out scheme I'm currently using: Plain names refer to identifiers or types. Some types have type-comment Strings that appear to be constant(always returned for that type of request) strings are "str" Constant Numbers would be just the number Constant null is null Booleans are true/false for constant booleans or Boolean otherwise [a,b,c] are lists with 3 items a,b,c [... ...] is a list of repeating elements of some types/constants/patterns {a:A,b:B,c:c} and {... ...} is the same for a dictionary. example: story := [header,footer] header := {"data":realHeader,"kind":"Listing"} realHeader := {"after": null, "before": null, "children": [{"data": realRealHeader, "kind": "t3"}], "modhash": ""} footer := {"data":AlmostComments,"kind":"Listing"} AlmostComments := {"data": {"after": null, "before": null, "children": comments, "modhash": ""}, "kind": "t1"} comments := [...{"data":comment, "kind":"t1"}...] realRealHeader := {"author": string, "clicked": boolean, "created": int, "created_utc": int, "domain": "code.reddit.com", "downs": int, "hidden": boolean, "id": string-id, "is_self": boolean, "levenshtein": null, "likes": null, "media": null, "media_embed": { }, "name": string-id, "num_comments": int, "over_18": false, "permalink": string-urlLinkToStoryStartingFrom/r, "saved": false, "score": int, "selftext": string, "selftext_html": string-html, "subreddit": string-subredditname, "subreddit_id": string-id, "thumbnail": "", "title": string, "ups": int, "url": "http://code.reddit.com/" } comments := { "author": string, "body": string-body_html-wout-html, "body_html": string-html-formated, "created": int, "created_utc": int, "downs": int, "id": string-id, "levenshtein": null, "likes": null, "link_id": string-id, "name": string-id", "parent_id": string-id, "replies": AlmostComments or null, "subreddit": string-subredditname, "subreddit_id": string-id, "ups": int }

    Read the article

  • jQuery - Unchecking checkboxes that act like radio buttons

    - by Cecil
    Hey All, I have the following jQuery code to make my checkboxes act like radio buttons, so that only 1 of the 3 can be checked at a time. <script type="text/javascript" language="javascript"> $(document).ready(function() { $("#testing input:checkbox").change(function(){ var checkname = $(this).attr("name"); $("input:checkbox[name='" + checkname + "']").removeAttr("checked"); this.checked = true; }); }); </script> The checkboxes are layed out like the following: <input type="checkbox" id="testing" name="testing" value="B"> <input type="checkbox" id="testing" name="testing" value="I"> <input type="checkbox" id="testing" name="testing" value="A"> This works exactly how i want it to work, not a problem, except once i click one of the 3, i cant unclick it so that none of them are checked, this is what i want to happen, so along with being only able to click one at a time, im able to uncheck them completely. Any help would be grand :)

    Read the article

  • Can't get jQuery to wokr with Prototype - tried everything....

    - by thinkfuture
    Ok so here is the situation. Been pulling my hair out on this one. I'm a noob at this. Only been using rails for about 6 weeks. I'm using the standard setup package, and my code leverages prototype helpers heavily. Like I said, noob ;) So I'm trying to put in some jQuery effects, like PrettyPhoto. But what happens is that when the page is first loaded, PrettyPhoto works great. However, once someone uses a Prototype helper, like a link created with link_to_remote, Prettyphoto stops working. I've tried jRails, all of the fixes proposed on the JQuery site to stop conflicts... http://docs.jquery.com/Using_jQuery_with_Other_Libraries ...even done some crazy things likes renaming all of the $ in prototype.js to $$$ to no avail. Either the prototype helpers break, or jQuery breaks. Seems nothing I do can get these to work together. Any ideas? Here is part of my application.html.erb <%= javascript_include_tag 'application' %> <%= javascript_include_tag 'tooltip' %> <%= javascript_include_tag 'jquery' %> <%= javascript_include_tag 'jquery-ui' %> <%= javascript_include_tag "jquery.prettyPhoto" %> <%= javascript_include_tag 'prototype' %> <%= javascript_include_tag 'scriptalicious' %> </head> <body> <script type="text/javascript" charset="utf-8"> jQuery(document).ready( function() { jQuery("a[rel^='prettyPhoto']").prettyPhoto(); }); </script> If I put prototype before jquery, the prototype helpers don't work If I put the noconflict clause in, neither works. Thanks in advance! Chris

    Read the article

< Previous Page | 468 469 470 471 472 473 474 475 476 477 478 479  | Next Page >