Search Results

Search found 12765 results on 511 pages for 'format'.

Page 471/511 | < Previous Page | 467 468 469 470 471 472 473 474 475 476 477 478  | Next Page >

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • Programmatically created GridView cells don't scale to fit screen

    - by ChrisAshton84
    I've read a ton of other responses about GridView already but almost all deal with the XML format (which I had working). I wanted to learn the programmatic way of designing Android, though, so I'm trying to build most of this app without XML. All I define in XML are the GridView and the first TextView. After that I add the other LinearLayouts in onCreate(). I would like to have a 2 column GridView containing a title and several (4 for now) LinearLayouts. I realize from documentation that the GridView won't scale cells unless they have a gravity set, but no matter how I try to do this I can't get it to work. After adding two cells, my GridView tree would look like: GridView -> TextView (colspan 2) -> LinearLayout (Vertical) -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Vertical) -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView I've tried about every combination of FILL and FILL_HORIZONTAL I could think of on either the outermost LinearLayouts, or also trying on the TextViews and inner LinearLayouts. No matter what I do, the LinearLayouts I add are always sized as small as possible and pushed to the left of the screen. Meanwhile, the first TextView (the colspan 2 one) with only CENTER_HORIZONTAL set is correctly centered in the screen. Its as if that TextView gets one idea of the column widths and the LinearLayouts get another! (If I add the FILL Gravity for it, it also moves all the way left.) I believe I had this working accidentally with 100% XML, but I would prefer not to switch back unless this is known to not work programatically. Any ideas what I can try to get this working?

    Read the article

  • j2me bluetooth client. Function startInquiry nothing found.

    - by Hugi
    I develop simple j2me bluetooth client and have problem with bluetooth device search. Function startInquiry nothing found. Client : nokia 5220 Server : my pc with bluetooth adapter All bluetooth devices is on. /* * To change this template, choose Tools | Templates * and open the template in the editor. */ import javax.microedition.midlet.*; import javax.bluetooth.*; import java.util.Vector; import javax.microedition.lcdui.*; /** * @author ????????????? */ public class Midlet extends MIDlet implements DiscoveryListener { private static Vector vecDevices=new Vector(); private static String connectionURL=null; private LocalDevice localDevice; private DiscoveryAgent agent; private RemoteDevice remoteDevice; private RemoteDevice[] devList; private Display display; private Form form; public void startApp() { display = Display.getDisplay(this); form = new Form( "Client" ); try { localDevice = LocalDevice.getLocalDevice(); } catch( BluetoothStateException e ) { e.printStackTrace(); } form.append("Address: "+localDevice.getBluetoothAddress()+"\n\n"); form.append("Name: "+localDevice.getFriendlyName()+"\n\n"); try { agent = localDevice.getLocalDevice().getDiscoveryAgent(); form.append("Starting device inquiry... \n\n"); boolean si = agent.startInquiry(DiscoveryAgent.GIAC, this); if ( si ) { form.append("true"); } else { form.append("false"); } } catch( BluetoothStateException e ) { } int deviceCount = vecDevices.size(); if(deviceCount <= 0){ form.append("No Devices Found ."); } else{ //print bluetooth device addresses and names in the format [ No. address (name) ] form.append("Bluetooth Devices: "); for (int i = 0; i < deviceCount; i++) { remoteDevice=(RemoteDevice)vecDevices.elementAt(i); form.append( remoteDevice.getBluetoothAddress() ); } } display.setCurrent(form); } public void pauseApp() { } public void destroyApp(boolean unconditional) { } public void deviceDiscovered(RemoteDevice btDevice, DeviceClass cod) { //add the device to the vector if(!vecDevices.contains(btDevice)){ vecDevices.addElement(btDevice); } } public void inquiryCompleted(int discType) { } //implement this method since services are not being discovered public void servicesDiscovered(int transID, ServiceRecord[] servRecord) { if(servRecord!=null && servRecord.length>0){ connectionURL=servRecord[0].getConnectionURL(0,false); } } //implement this method since services are not being discovered public void serviceSearchCompleted(int transID, int respCode) { } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Does CakePHP treat all INT fields as ID's for join tables?

    - by Jonnie
    I am trying to save a User, their Profile, and some tags and my join table that links the profile and the tags keeps getting messed up. The profile model is called Instructor, the tag model is called Subject. The Instructor has a phone number and a zip code and for some reason CakePHP thinks these are the fields it should use when creating entries in my join table. My Join table always comes out as: id | instructor_id | subject_id | 1 | 90210 | 1 | // thinks that the zip code is an instructor_id 2 | 1112223333 | 1 | // thinks that the phone number is an instructor_id 3 | 1 | 1 | // thinks that user_id is an instructor_id 4 | 1 | 1 | // the actual instructor_id, this one's correct 5 | 90210 | 2 | 6 | 1112223333 | 2 | 3 | 1 | 2 | 4 | 1 | 2 | My Models: class Instructor extends AppModel { var $name = 'Instructor'; var $belongsTo = array('User', 'State'); var $hasAndBelongsToMany = array( 'Subject' = array( 'className' = 'Subject', 'joinTable' = 'instructors_subjects', 'foreignKey' = 'instructor_id', 'associationForeignKey' = 'subject_id', 'unique' = true, 'conditions' = '', 'fields' = '', 'order' = '', 'limit' = '', 'offset' = '', 'finderQuery' = '', 'deleteQuery' = '', 'insertQuery' = '' ) ); } class Subject extends AppModel { var $name = 'Subject'; var $hasAndBelongsToMany = array( 'Instructor' = array( 'className' = 'Instructor', 'joinTable' = 'instructors_subjects', 'foreignKey' = 'subject_id', 'associationForeignKey' = 'instructor_id', 'unique' = true, 'conditions' = '', 'fields' = '', 'order' = '', 'limit' = '', 'offset' = '', 'finderQuery' = '', 'deleteQuery' = '', 'insertQuery' = '' ) ); } My Model Associations: User hasOne Instructor Instructor belongsTo User Instructor hasAndBelongsToMany Subject Subject hasAndBelongsToMany Instructor My form data looks like: Array ( [User] = Array ( [username] = MrInstructor [password] = cddb06c93c72f34eb9408610529a34645c29c55d [group_id] = 2 ) [Instructor] = Array ( [name] = Jimmy Bob [email] = [email protected] [phone] = 1112223333 [city] = Beverly Hills [zip_code] = 90210 [states] = 5 [website] = www.jimmybobbaseballschool.com [description] = Jimmy Bob is an instructor. [user_id] = 1 [id] = 1 ) [Subject] = Array ( [name] = hitting, pitching ) ) My function for processing the form looks like: function instructor_register() { $this-set('groups', $this-User-Group-find('list')); $this-set('states', $this-User-Instructor-State-find('list')); if (!empty($this-data)) { // Set the group to Instructor $this-data['User']['group_id'] = 2; // Save the user data $user = $this-User-save($this-data, true, array( 'username', 'password', 'group_id' )); // If the user was saved, save the instructor's info if (!empty($user)) { $this-data['Instructor']['user_id'] = $this-User-id; $instructor = $this-User-Instructor-save($this-data, true, array( 'user_id', 'name', 'email', 'phone', 'city', 'zip_code', 'state_id', 'website', 'description' )); // If the instructor was saved, save the rest if(!empty($instructor)) { $instructorId = $this-User-Instructor-id; $this-data['Instructor']['id'] = $instructorId; // Save each subject seperately $subjects = explode(",", $this-data['Subject']['name']); foreach ($subjects as $_subject) { // Get the correct subject format $_subject = strtolower(trim($_subject)); $this-User-Instructor-Subject-create($this-data); $this-User-Instructor-Subject-set(array( 'name' = $_subject )); $this-User-Instructor-Subject-save(); echo ''; print_r($this-data); echo ''; } } } } }

    Read the article

  • How to put Google adsense in iPhone application?

    - by oksk
    Hi all. I have a question about adsense. I want to put Google adsense in my application to be developed. But after testing my code, It wasn't shown. this is my code self.webView.userInteractionEnabled = NO; NSMutableString *manageableHTML = [[[NSMutableString alloc] init] autorelease]; [manageableHTML appendFormat:@"<html><head></head>"]; [manageableHTML appendFormat:@"<body>"]; [manageableHTML appendFormat:@"<script type=\"text/javascript\"><!--"]; [manageableHTML appendFormat:@"window.googleAfmcRequest = {"]; [manageableHTML appendFormat:@"client: 'ca-mb-pub-7564235160823935',"]; [manageableHTML appendFormat:@"ad_type: 'text_image',"]; [manageableHTML appendFormat:@"output: 'html',"]; [manageableHTML appendFormat:@"channel: '2052458338',"]; [manageableHTML appendFormat:@"format: '320x50_mb',"]; [manageableHTML appendFormat:@"oe: 'utf8',"]; [manageableHTML appendFormat:@"color_border: '336699',"]; [manageableHTML appendFormat:@"color_bg: 'FFFFFF',"]; [manageableHTML appendFormat:@"color_link: '0000FF',"]; [manageableHTML appendFormat:@"color_text: '000000',"]; [manageableHTML appendFormat:@"color_url: '008000',"]; [manageableHTML appendFormat:@"};"]; [manageableHTML appendFormat:@"//--></script>"]; [manageableHTML appendFormat:@"<script type=\"text/javascript\" "]; [manageableHTML appendFormat:@"src=\"http://pagead2.googlesyndication.com/pagead/show_afmc_ads.js\"></script>"]; [manageableHTML appendFormat:@"</body></html>"]; [self.webView loadHTMLString:manageableHTML baseURL:nil]; [self.view addSubview:self.webView]; Bofore testing, this javascript code are well operated in my google blog. I found that this code work at only mobile device. and I checked it through safari of my ipod touch. (It works well.) But Checking in the application, I don't see adsense. what is something wrong?

    Read the article

  • XML serialization options in .NET

    - by Borek
    I'm building a service that returns an XML (no SOAP, no ATOM, just plain old XML). Say that I have my domain objects already filled with data and just need to transform them to the XML format. What options do I have on .NET? Requirements: The transformation is not 1:1. Say that I have an Address property of type Address with nested properties like Line1, City, Postcode etc. This may need to result in an XML like <xaddr city="...">Line1, Postcode</xaddr>, i.e. quite different. Some XML elements/attributes are conditional, for example, if a Customer is under 18, the XML needs to contain some additional information. I only need to serialize the objects to XML, the other direction (XML to objects) is not important Some technologies, i.e. Data Contracts use .NET attributes. Other means of configuration (external XML config, buddy classes etc.) would be a plus. Here are the options as I see them as the moment. Corrections / additions will be very welcome. String concatenation - forget it, it was a joke :) Linq 2 XML - complete control but quite a lot of hand written code, would need good suite of unit tests View engines in ASP.NET MVC (or even Web Forms theoretically), the logic being in controllers. It's a question how to structure it, I can have simple rules engine in my controller(s) and one view template per each possible output, or have the decision logic directly in the template. Both have upsides and downsides. XML Serialization - I'm not sure about the flexibility here Data Contracts from WCF - not sure about the flexibility either, plus would they work in a simple ASP.NET MVC app (non-WCF service)? Are they a super-set of the standard XML serialization now? If it exists, some XML-to-object mapper. The more I think about it the more I think I'm looking for something like this but I couldn't find anything appropriate. Any comments / other options?

    Read the article

  • basic operations for modifying a source document with XSLT

    - by SpliFF
    All the tutorials and examples I've found of XSLT processing seem to assume your destination will be a significantly different format/structure to your source and that you know the structure of the source in advance. I'm struggling with finding out how to perform simple "in-place" modifications to a HTML document without knowing anything else about its existing structure. Could somebody show me a clear example that, given an arbitrary unknown HTML source will: 1.) delete the classname 'foo' from all divs 2.) delete a node if its empty (ie <p></p>) 3.) delete a <p> node if its first child is <br> 4.) add newattr="newvalue" to all H1 5.) replace 'heading' in text nodes with 'title' 6.) wrap all <u> tags in <b> tags (ie, <u>foo</u> -> <b><u>foo</u></b>) 7.) output the transformed document without changing anything else The above examples are the primary types of transform I wish to accomplish. Understanding how to do the above will go a long way towards helping me build more complex transforms. To help clarify/test the examples here is a sample source and output, however I must reiterate that I want to work with arbitrary samples without rewriting the XSLT for each source: <!doctype html> <html> <body> <h1>heading</h1> <p></p> <p><br>line</p> <div class="foo bar"><u>baz</u></div> <p>untouched</p> </body> </html> output: <!doctype html> <html> <body> <h1 newattr="newvalue">title</h1> <div class="bar"><b><u>baz</u></b></div> <p>untouched</p> </body> </html>

    Read the article

  • How to convert m4a file to aac adts file in Xcode?

    - by Bird Hsuie
    I have a mp4 file copied from iPod lib and saved to my Document for my next step, I need it to convert to .mp3 or .aac(ADTS type) I use this code and failed... -(IBAction)compressFile:(id)sender{ NSLog (@"handleConvertToPCMTapped"); // open an ExtAudioFile NSLog (@"opening %@", exportURL); ExtAudioFileRef inputFile; CheckResult (ExtAudioFileOpenURL((__bridge CFURLRef)exportURL, &inputFile), "ExtAudioFileOpenURL failed"); // prepare to convert to a plain ol' PCM format AudioStreamBasicDescription myPCMFormat; myPCMFormat.mSampleRate = 44100; // todo: or use source rate? myPCMFormat.mFormatID = kAudioFormatMPEGLayer3 ; myPCMFormat.mFormatFlags = kAudioFormatFlagsCanonical; myPCMFormat.mChannelsPerFrame = 2; myPCMFormat.mFramesPerPacket = 1; myPCMFormat.mBitsPerChannel = 16; myPCMFormat.mBytesPerPacket = 4; myPCMFormat.mBytesPerFrame = 4; CheckResult (ExtAudioFileSetProperty(inputFile, kExtAudioFileProperty_ClientDataFormat, sizeof (myPCMFormat), &myPCMFormat), "ExtAudioFileSetProperty failed"); // allocate a big buffer. size can be arbitrary for ExtAudioFile. // you have 64 KB to spare, right? UInt32 outputBufferSize = 0x10000; void* ioBuf = malloc (outputBufferSize); UInt32 sizePerPacket = myPCMFormat.mBytesPerPacket; UInt32 packetsPerBuffer = outputBufferSize / sizePerPacket; // set up output file NSString *outputPath = [myDocumentsDirectory() stringByAppendingPathComponent:@"m_export.mp3"]; NSURL *outputURL = [NSURL fileURLWithPath:outputPath]; NSLog (@"creating output file %@", outputURL); AudioFileID outputFile; CheckResult(AudioFileCreateWithURL((__bridge CFURLRef)outputURL, kAudioFileCAFType, &myPCMFormat, kAudioFileFlags_EraseFile, &outputFile), "AudioFileCreateWithURL failed"); // start convertin' UInt32 outputFilePacketPosition = 0; //in bytes while (true) { // wrap the destination buffer in an AudioBufferList AudioBufferList convertedData; convertedData.mNumberBuffers = 1; convertedData.mBuffers[0].mNumberChannels = myPCMFormat.mChannelsPerFrame; convertedData.mBuffers[0].mDataByteSize = outputBufferSize; convertedData.mBuffers[0].mData = ioBuf; UInt32 frameCount = packetsPerBuffer; // read from the extaudiofile CheckResult (ExtAudioFileRead(inputFile, &frameCount, &convertedData), "Couldn't read from input file"); if (frameCount == 0) { printf ("done reading from file"); break; } // write the converted data to the output file CheckResult (AudioFileWritePackets(outputFile, false, frameCount, NULL, outputFilePacketPosition / myPCMFormat.mBytesPerPacket, &frameCount, convertedData.mBuffers[0].mData), "Couldn't write packets to file"); NSLog (@"Converted %ld bytes", outputFilePacketPosition); // advance the output file write location outputFilePacketPosition += (frameCount * myPCMFormat.mBytesPerPacket); } // clean up ExtAudioFileDispose(inputFile); AudioFileClose(outputFile); // show size in label NSLog (@"checking file at %@", outputPath); [self transMitFile:outputPath]; if ([[NSFileManager defaultManager] fileExistsAtPath:outputPath]) { NSError *fileManagerError = nil; unsigned long long fileSize = [[[NSFileManager defaultManager] attributesOfItemAtPath:outputPath error:&fileManagerError] fileSize]; } any suggestion?.......thanks for your great help!

    Read the article

  • inline and member initializers

    - by Alexander
    When should I inline a member function and when should I use member initializers? My code is below.. I would like to modify it so I could make use some inline when appropriate and member initializers: #include "Books.h" Book::Book(){ nm = (char*)""; thck = 0; wght = 0; } Book::Book(const char *name, int thickness, int weight){ nm = strdup(name); thck = thickness; wght = weight; } Book::~Book(){ } const char* Book::name(){ return nm; } int Book::thickness(){ return thck; } int Book::weight(){ return wght; } // // Prints information about the book using this format: // "%s (%d mm, %d dg)\n" // void Book::print(){ printf("%s (%d mm, %d dg)\n", nm, thck, wght); } Bookcase::Bookcase(int id){ my_id = id; no_shelf = 0; } int Bookcase::id(){ return my_id; } Bookcase::~Bookcase(){ for (int i = 0; i < no_shelf; i++) delete my_shelf[i]; } bool Bookcase::addShelf(int width, int capacity){ if(no_shelf == 10) return false; else{ my_shelf[no_shelf] = new Shelf(width, capacity); no_shelf++; return true; } } bool Bookcase::add(Book *bp){ int index = -1; int temp_space = -1; for (int i = 0; i < no_shelf; i++){ if (bp->weight() + my_shelf[i]->curCapacity() <= my_shelf[i]->capacity()){ if (bp->thickness() + my_shelf[i]->curWidth() <= my_shelf[i]->width() && temp_space < (my_shelf[i]->width() - my_shelf[i]->curWidth())){ temp_space = (my_shelf[i]->width()- my_shelf[i]->curWidth()); index = i; } } } if (index != -1){ my_shelf[index]->add(bp); return true; }else return false; } void Bookcase::print(){ printf("Bookcase #%d\n", my_id); for (int i = 0; i < no_shelf; i++){ printf("--- Shelf (%d mm, %d dg) ---\n", my_shelf[i]->width(), my_shelf[i]->capacity()); my_shelf[i]->print(); } }

    Read the article

  • gcc optimization? bug? and its practial implication to project

    - by kumar_m_kiran
    Hi All, My questions are divided into three parts Question 1 Consider the below code, #include <iostream> using namespace std; int main( int argc, char *argv[]) { const int v = 50; int i = 0X7FFFFFFF; cout<<(i + v)<<endl; if ( i + v < i ) { cout<<"Number is negative"<<endl; } else { cout<<"Number is positive"<<endl; } return 0; } No specific compiler optimisation options are used or the O's flag is used. It is basic compilation command g++ -o test main.cpp is used to form the executable. The seemingly very simple code, has odd behaviour in SUSE 64 bit OS, gcc version 4.1.2. The expected output is "Number is negative", instead only in SUSE 64 bit OS, the output would be "Number is positive". After some amount of analysis and doing a 'disass' of the code, I find that the compiler optimises in the below format - Since i is same on both sides of comparison, it cannot be changed in the same expression, remove 'i' from the equation. Now, the comparison leads to if ( v < 0 ), where v is a constant positive, So during compilation itself, the else part cout function address is added to the register. No cmp/jmp instructions can be found. I see that the behaviour is only in gcc 4.1.2 SUSE 10. When tried in AIX 5.1/5.3 and HP IA64, the result is as expected. Is the above optimisation valid? Or, is using the overflow mechanism for int not a valid use case? Question 2 Now when I change the conditional statement from if (i + v < i) to if ( (i + v) < i ) even then, the behaviour is same, this atleast I would personally disagree, since additional braces are provided, I expect the compiler to create a temporary built-in type variable and them compare, thus nullify the optimisation. Question 3 Suppose I have a huge code base, an I migrate my compiler version, such bug/optimisation can cause havoc in my system behaviour. Ofcourse from business perspective, it is very ineffective to test all lines of code again just because of compiler upgradation. I think for all practical purpose, these kinds of error are very difficult to catch (during upgradation) and invariably will be leaked to production site. Can anyone suggest any possible way to ensure to ensure that these kind of bug/optimization does not have any impact on my existing system/code base? PS : When the const for v is removed from the code, then optimization is not done by the compiler. I believe, it is perfectly fine to use overflow mechanism to find if the variable is from MAX - 50 value (in my case).

    Read the article

  • Converting a list into a select with jquery

    - by Davemof
    I'm trying to convert the following list into a select list so it can be submitted via a form - the element within the lists will become the value of each option: <ul class="selected connected-list ui-sortable" style="height: 279px;"> <li class="ui-helper-hidden-accessible" style=""></li> <li title="Owner Name 1 - " class="ui-state-default ui-element ui-draggable" style="display: block; position: relative; top: 0px; left: 0px;"><span class="ui-icon-arrowthick-2-n-s ui-icon"></span>Owner Name 1 - <em class="thenumber">4.4796E+11</em><a class="action" href="#"><span class="ui-corner-all ui-icon ui-icon-minus"></span></a></li> <li title="David Moffat - " class="ui-state-default ui-element" style="display: block; position: relative; top: 0px; left: 0px;"><span class="ui-icon ui-icon-arrowthick-2-n-s"></span>David Moffat - <em class="thenumber">07730423005</em><a class="action" href="#"><span class="ui-corner-all ui-icon ui-icon-minus"></span></a></li> </ul> This should convert to the following format: <select style="display:none" class="selectoption" name="p_num[]" multiple="multiple"> <option value="">4.4796E+11</option> <option value="">07730423007</option> </select> I have tried the following jquery code, but after many hours I'm pulling my hair out: $('a.sendform').click(function(){ $('ul.selected').each(function() { var $select = $('<select />'); $(this).find('li').each(function() { var $option = $('<option />'); $option.attr('value', $(this).('em')).html($(this).html()); $select.append($option); }); $(this).replaceWith($select); }); }); Any help might save my remaining hair. Many thanks David

    Read the article

  • .NET Extension Objects with XSLT -- how to iterate over a collection?

    - by Pandincus
    Help me, Stackoverflow! I have a simple .NET 3.5 console app that reads some data and sends emails. I'm representing the email format in an XSLT stylesheet so that we can easily change the wording of the email without needing to recompile the app. We're using Extension Objects to pass data to the XSLT when we apply the transformation: <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:msxsl="urn:schemas-microsoft-com:xslt" exclude-result-prefixes="msxsl" xmlns:EmailNotification="ext:EmailNotification"> -- this way, we can have statements like: <p> Dear <xsl:value-of select="EmailNotification:get_FullName()" />: </p> The above works fine. I pass the object via code like this (some irrelevant code omitted for brevity): // purely an example structure public struct EmailNotification { public string FullName { get; set; } } // Somewhere in some method ... var notification = new Notification("John Smith"); // ... XsltArgumentList xslArgs = new XsltArgumentList(); xslArgs.AddExtensionObject("ext:EmailNotification", notification); // ... // The part where it breaks! (This is where we do the transformation) xslt.Transform(fakeXMLDocument.CreateNavigator(), xslArgs, XmlWriter.Create(transformedXMLString)); So, all of the above code works. However, I wanted to get a little fancy (always my downfall) and pass a collection, so that I could do something like this: <p>The following accounts need to be verified:</p> <xsl:for-each select="EmailNotification:get_SomeCollection()"> <ul> <li> <xsl:value-of select="@SomeAttribute" /> </li> </ul> <xsl:for-each> When I pass the collection in the extension object and attempt to transform, I get the following error: "Extension function parameters or return values which have Clr type 'String[]' are not supported." or List, or IEnumerable, or whatever I try to pass in. So, my questions are: How can I pass in a collection to my XSLT? What do I put for the xsl:value-of select="" inside the xsl:for-each ? Is what I am trying to do impossible?

    Read the article

  • How do you programmatically set a Style on a View?

    - by Greg
    I would like to do something like this: <Button android:id="@+id/button" android:layout_width="wrap_content" android:layout_height="wrap_cotent" style="@style/SubmitButtonType" /> But in code The xml approach works fine provided that SubmitButtonType is defined. Now what I assume happens is that the appt parser runs through this xml, generates an AttributeSet. That AttributeSet when passed to context/theme#obtainStyledAttributes() will have the style ref mask anything that is not written inline in this tag. Great that's fine! Now how do we do this programmatically. Button, as well as other View types, has a constructor that has the form: <Widget>(Context context, AttributeSet set, int defStyle). So I thought this would work. Button button = new Button(context, null, R.style.SubmitButtonType); However, I am finding that defStyle is badly documented as it really should be written to be a resourceId to an attribute (from R.attrs) that will be passed to obtainStyledAttributes() as the attribute resource, and not the style resource. After looking at the code, all the view implementations seem to pass 0 as the styleRef. I don't see the harm in having it passed as both the attr and the style resource (more flexible and negligible overhead) However I might be approaching this all wrong. How do you do this in code then other than by setting each individual element of the style to the specific widget you want to style (only possible by looking a the code to see what param maps to which method or set of methods). The only way I have found to do this is: <declare-styleable> <attr name="totallyAdhoc_attribute_just_for_this_case" format="reference"> </declare-styleable> <style name="MyAlreadyExistantTheme" > ... ... <item name="totallyAdhoc_attribute_just_for_this_case">@style/SubmitButtonType</item> </style> And instead of passing R.style.SubmitButtonType as defStyle, I pass the new R.attr.totallyAdhoc_attribute_just_for_this_case. Button button = new Button(context, null, R.attr.totallyAdhoc_attribute_just_for_this_case); This works but sounds way too complicated.

    Read the article

  • Haskell data serialization of some data implementing a common type class

    - by Evan
    Let's start with the following data A = A String deriving Show data B = B String deriving Show class X a where spooge :: a -> Q [ Some implementations of X for A and B ] Now let's say we have custom implementations of show and read, named show' and read' respectively which utilize Show as a serialization mechanism. I want show' and read' to have types show' :: X a => a -> String read' :: X a => String -> a So I can do things like f :: String -> [Q] f d = map (\x -> spooge $ read' x) d Where data could have been [show' (A "foo"), show' (B "bar")] In summary, I wanna serialize stuff of various types which share a common typeclass so I can call their separate implementations on the deserialized stuff automatically. Now, I realize you could write some template haskell which would generate a wrapper type, like data XWrap = AWrap A | BWrap B deriving (Show) and serialize the wrapped type which would guarantee that the type info would be stored with it, and that we'd be able to get ourselves back at least an XWrap... but is there a better way using haskell ninja-ery? EDIT Okay I need to be more application specific. This is an API. Users will define their As, and Bs and fs as they see fit. I don't ever want them hacking through the rest of the code updating their XWraps, or switches or anything. The most i'm willing to compromise is one list somewhere of all the A, B, etc. in some format. Why? Here's the application. A is "Download a file from an FTP server." B is "convert from flac to mp3". A contains username, password, port, etc. information. B contains file path information. A and B are Xs, and Xs shall be called "Tickets." Q is IO (). Spooge is runTicket. I want to read the tickets off into their relevant data types and then write generic code that will runTicket on the stuff read' from the stuff on disk. At some point I have to jam type information into the serialized data.

    Read the article

  • Problem in suspending 2 threads at the same time in MFC!

    - by kiddo
    I am learning about threading and multithreading..so i just created a small application in which i will update the progressbar and a static text using threading.I vl get two inputs from the user, start and end values for how long the loop should rotate.I have 2threads in my application. Thread1- to update the progressbar(according to the loop) the static text which will show the count(loop count). Thread2 - to update the another static text which will just diplay a name Basically if the user clicks start, the progressbar steps up and at the same time filecount and the name are displayed parallely. There's is another operation where if the user clicks pause it(thread) has to suspend until the user clicks resume. The problem is,the above will not work(will not suspend and resume) for both thread..but works for a singlw thread. Please check the code to get an idea and reply me what can done! on button click start void CThreadingEx3Dlg::OnBnClickedStart() { m_ProgressBar.SetRange(start,end); myThread1 = AfxBeginThread((AFX_THREADPROC)MyThreadFunction1,this); myThread2 = AfxBeginThread((AFX_THREADPROC)MyThreadFunction2,this); } thread1 UINT MyThreadFunction1(LPARAM lparam) { CThreadingEx3Dlg* pthis = (CThreadingEx3Dlg*)lparam; for(int intvalue =pthis->start;intvalue<=pthis->end; ++intvalue) { pthis->SendMessage(WM_MY_THREAD_MESSAGE1,intvalue); } return 0; } thread1 function LRESULT CThreadingEx3Dlg::OnThreadMessage1(WPARAM wparam,LPARAM lparam) { int nProgress= (int)wparam; m_ProgressBar.SetPos(nProgress); CString strStatus; strStatus.Format(L"Thread1:Processing item: %d", nProgress); m_Static.SetWindowText(strStatus); Sleep(100); return 0; } thread2 UINT MyThreadFunction2(LPARAM lparam) { CThreadingEx3Dlg* pthis = (CThreadingEx3Dlg*)lparam; for(int i =pthis->start;i<=pthis->end;i++) { pthis->SendMessage(WM_MY_THREAD_MESSAGE2,i); } return 0; } thread2 function LRESULT CThreadingEx3Dlg::OnThreadMessage2(WPARAM wparam,LPARAM lparam) { m_Static1.GetDlgItem(IDC_STATIC6); m_Static1.SetWindowTextW(L"Thread2 Running"); Sleep(100); m_Static1.SetWindowTextW(L""); Sleep(100); return TRUE; } void CThreadingEx3Dlg::OnBnClickedPause() { // TODO: Add your control notification handler code here if(!m_Track) { m_Track = TRUE; GetDlgItem(IDCANCEL)->SetWindowTextW(L"Resume"); myThread1->SuspendThread(); WaitForSingleObject(myThread1->m_hThread,INFINITE); myThread2->SuspendThread(); m_Static.SetWindowTextW(L"Paused.."); } else { m_Track = FALSE; GetDlgItem(IDCANCEL)->SetWindowTextW(L"Pause"); myThread1->ResumeThread(); myThread2->ResumeThread(); /*myEventHandler.SetEvent(); WaitForSingleObject(myThread1->m_hThread,INFINITE);*/ } }

    Read the article

  • populate CoreData data model from JSON files prior to app start

    - by johannes_d
    I am creating an iPad App that displays data I got from an API in JSON format. My Core Data model has several entities(Countries, Events, Talks, ...). For each entity I have one .json file that contains all instances of the entity and its attributes as well as its relationships. I would like to populate my Core Data data model with these entities before the start of the App (otherwise it takes about 15 minutes for the iPad to create all the instances of the entities from the several JSON files using factory methods). I am currently importing the data into CoreData like this: -(void)fetchDataIntoDocument:(UIManagedDocument *)document { dispatch_queue_t dataQ = dispatch_queue_create("Data import", NULL); dispatch_async(dataQ, ^{ //Fetching data from application bundle NSURL *tedxgroupsurl = [[NSBundle mainBundle] URLForResource:@"contries" withExtension:@"json"]; NSURL *tedxeventsurl = [[NSBundle mainBundle] URLForResource:@"events" withExtension:@"json"]; //converting the JSON files to NSDictionaries NSError *error = nil; NSDictionary *countries = [NSJSONSerialization JSONObjectWithData:[NSData dataWithContentsOfURL:countriesurl] options:kNilOptions error:&error]; countries = [countries objectForKey:@"countries"]; NSDictionary *events = [NSJSONSerialization JSONObjectWithData:[NSData dataWithContentsOfURL:eventsurl] options:kNilOptions error:&error]; events = [events objectForKey:@"events"]; //creating entities using factory methods in NSManagedObject Subclasses (Country / Event) [document.managedObjectContext performBlock:^{ NSLog(@"creating countries"); for (NSDictionary *country in countries) { [Country countryWithCountryInfo:country inManagedObjectContext:document.managedObjectContext]; //creating Country entities } NSLog(@"creating events"); for (NSDictionary *event in events) { [Event eventWithEventInfo:event inManagedObjectContext:document.managedObjectContext]; // creating Event entities } NSLog(@"done creating, saving document"); [document saveToURL:document.fileURL forSaveOperation:UIDocumentSaveForOverwriting completionHandler:NULL]; }]; }); dispatch_release(dataQ); } This combines the different JSON files into one UIManagedDocument which i can then perform fetchRequests on to populate tableViews, mapView, etc. I'm looking for a way to create this document outside my application & add it to the mainBundle. Then I could copy it once to the apps DocumentsDirectory and be able I use it (instead of creating the Document within the app from the original JSON files). Any help is appreciated!

    Read the article

  • CRUD Question with Codeigniter

    - by Brad
    I have a database with blog entries in it. The desired output I am trying to acheive is 3 entrys displayed using the css3 multi paragraph and then another 3(or more) formatted with the codeigniter Character_limiter. So I need 3 displays formatted one way and 3+ formatted another way on the same page. So far this is what I have, but i do not know how to format the sql to achieve what I want. I can call all posts in descending order like I want, but dont know how to separate the code to achieve my output Controller: $this->db->order_by('id', 'DESC'); $this->db->limit('2'); $query = $this->db->get('posts'); if($query->result()) $data = array(); { $data['blog'] = $query->result(); } $data['title'] = 'LemonRose'; $data['content'] = 'home/home_content'; $this->load->view('template1', $data); View: <?php if (isset($blog)): foreach ($blog as $row): ?> <span class="title"><?php echo $row->title; ?> </span> <?php echo $row->date; ?> <div class="split"><?php echo $row->post =$this->typography->auto_typography($row->post); ?></div> <?php echo 'Post #',$row->id; ?> <p> Trackback URL: <? echo base_url()."trackbacks/track/$row->id";?></p> <hr /> <?php endforeach; endif; ?> The split class is multiple columns. I tried 2 different querys but dont know how to separate all the post displays. Also one query always overides the second and produces all split or all character limited paragraphs. Im lost here lol. Thanks

    Read the article

  • Safely escaping and reading back a file path in ruby

    - by user336851
    I need to save a few informations about some files. Nothing too fancy so I thought I would go with a simple one line per item text file. Something like this : # write io.print "%i %s %s\n" % [File.mtime(fname), fname, Digest::SHA1.file(fname).hexdigest] # read io.each do |line| mtime, name, hash = line.scanf "%i %s %s" end Of course this doesn't work because a file name can contain spaces (breaking scanf) and line breaks (breaking IO#each). The line break problem can be avoided by dropping the use of each and going with a bunch of gets(' ') while not io.eof? mtime = Time.at(io.gets(" ").to_i) name = io.gets " " hash = io.gets "\n" end Dealing with spaces in the names is another matter. Now we need to do some escaping. note : I like space as a record delimiter but I'd have no issue changing it for one easier to use. In the case of filenames though, the only one that could help is ascii nul "\0" but a nul delimited file isn't really a text file anymore... I initially had a wall of text detailing the iterations of my struggle to make a correct escaping function and its reciprocal but it was just boring and not really useful. I'll just give you the final result: def write_name(io, val) io << val.gsub(/([\\ ])/, "\\\\\\1") # yes that' 6 backslashes ! end def read_name(io) name, continued = "", true while continued continued = false name += io.gets(' ').gsub(/\\(.)/) do |c| if c=="\\\\" "\\" elsif c=="\\ " continued=true " " else raise "unexpected backslash escape : %p (%s %i)" % [c, io.path, io.pos] end end end return name.chomp(' ') end I'm not happy at all with read_name. Way too long and akward, I feel it shouldn't be that hard. While trying to make this work I tried to come up with other ways : the bittorrent encoded / php serialize way : prefix the file name with the length of the name then just io.read(name_len.to_i). It works but it's a real pita to edit the file by hand. At this point we're halfway to a binary format. String#inspect : This one looks expressly made for that purpose ! Except it seems like the only way to get the value back is through eval. I hate the idea of eval-ing a string I didn't generate from trusted data. So. Opinions ? Isn't there some lib which can do all this ? Am I missing something obvious ? How would you do that ?

    Read the article

  • ASP.NET Repeater Control Not Working in FireFox

    - by Robert Hyland
    everyone: I have an ASP.NET Application that uses a Repeater control to display a thumbnail gallery. When the user mouses over one of the thumbnails, the main image will present that thumbnail. It uses a Repeater control in a UserControl like this: <asp:Image ID="pictureImage" runat="server" Visible="true" Width="200px" /> <asp:Repeater ID="rpProductImages" runat="server" Visible="false"> <ItemTemplate> <div> <div style="float: left" id="smallImage" runat="server"> <div class="smallAltImage" onmouseover="showImage();" style="border: 1px solid #999999; margin: 5px 5px 5px 4px; width: 45px; height: 45px; background-position: center; background-repeat: no-repeat; background-image: url('<%#ResolveClientUrl(productImagesPath)%><%# String.Format("{0}", DataBinder.Eval(Container.DataItem, "ImageName")) %>');"> </div> <asp:Label ID="lblImageName" runat="server" Visible="false"><%# Eval("ImageName")%></asp:Label> </div> </div> </ItemTemplate> </asp:Repeater> Then, in a javascript file, this: function showImage(){ // Get thumbnail path. var img = (this.style.backgroundImage).substring(4, (this.style.backgroundImage).length - 1); $('#ctl00_ContentPlaceHolder1_ProductDetails1_pictureImage').attr('src', img); } It works fine in IE9, displaying the fully-qualified path for the image. In FireFox8, however, the img src looks like this: ""ProductImages/K42JY_500.jpg"" ... with two-sets of quotes! I think that the Repeater control is the central cause of the problem but I Googled and Googled again and could not find anyone that has experienced this similar situation! In fact, I'll PayPal anyone who can help me solve this with $50.00 (can't you tell I'm in the XMAS spirit, here?!) Any help is appreciated and "Thank You" in advance!

    Read the article

  • Why do I get a WCF timeout even though my service call and callback are successful?

    - by KallDrexx
    I'm playing around with hooking up an in-game console to a WCF interface, so an external application can send console commands and receive console output. To accomplish this I created the following service contracts: public interface IConsoleNetworkCallbacks { [OperationContract(IsOneWay = true)] void NewOutput(IEnumerable<string> text, string category); } [ServiceContract(SessionMode = SessionMode.Required, CallbackContract = typeof(IConsoleNetworkCallbacks))] public interface IConsoleInterface { [OperationContract] void ProcessInput(string input); [OperationContract] void ChangeCategory(string category); } On the server I implemented it with: public class ConsoleNetworkInterface : IConsoleInterface, IDisposable { public ConsoleNetworkInterface() { ConsoleManager.Instance.RegisterOutputUpdateHandler(OutputHandler); } public void Dispose() { ConsoleManager.Instance.UnregisterOutputHandler(OutputHandler); } public void ProcessInput(string input) { ConsoleManager.Instance.ProcessInput(input); } public void ChangeCategory(string category) { ConsoleManager.Instance.UnregisterOutputHandler(OutputHandler); ConsoleManager.Instance.RegisterOutputUpdateHandler(OutputHandler, category); } protected void OutputHandler(IEnumerable<string> text, string category) { var callbacks = OperationContext.Current.GetCallbackChannel<IConsoleNetworkCallbacks>(); callbacks.NewOutput(text, category); } } On the client I implemented the callback with: public class Callbacks : IConsoleNetworkCallbacks { public void NewOutput(IEnumerable<string> text, string category) { MessageBox.Show(string.Format("{0} lines received for '{1}' category", text.Count(), category)); } } Finally, I establish the service host with the following class: public class ConsoleServiceHost : IDisposable { protected ServiceHost _host; public ConsoleServiceHost() { _host = new ServiceHost(typeof(ConsoleNetworkInterface), new Uri[] { new Uri("net.pipe://localhost") }); _host.AddServiceEndpoint(typeof(IConsoleInterface), new NetNamedPipeBinding(), "FrbConsolePipe"); _host.Open(); } public void Dispose() { _host.Close(); } } and use the following code on my client to establish the connection: protected Callbacks _callbacks; protected IConsoleInterface _proxy; protected void ConnectToConsoleServer() { _callbacks = new Callbacks(); var factory = new DuplexChannelFactory<IConsoleInterface>(_callbacks, new NetNamedPipeBinding(), new EndpointAddress("net.pipe://localhost/FrbConsolePipe")); _proxy = factory.CreateChannel(); _proxy.ProcessInput("Connected"); } So what happens is that my ConnectToConsoleServer() is called and then it gets all the way to _proxy.ProcessInput("Connected");. In my game (on the server) I immediately see the output caused by the ProcessInput call, but the client is still stalled on the _proxy.ProcessInput() call. After a minute my client gets a JIT TimeoutException however at the same time my MessageBox message appears. So obviously not only is my command being sent immediately, my callback is being correctly called. So why am I getting a timeout exception? Note: Even removing the MessageBox call, I still have this issue, so it's not an issue of the GUI blocking the callback response.

    Read the article

  • Thread sleep and thread join.

    - by Dhruv Gairola
    hi guys, if i put a thread to sleep in a loop, netbeans gives me a caution saying Invoking Thread.sleep in loop can cause performance problems. However, if i were to replace the sleep with join, no such caution is given. Both versions compile and work fine tho. My code is below (check the last few lines for "Thread.sleep() vs t.join()"). public class Test{ //Display a message, preceded by the name of the current thread static void threadMessage(String message) { String threadName = Thread.currentThread().getName(); System.out.format("%s: %s%n", threadName, message); } private static class MessageLoop implements Runnable { public void run() { String importantInfo[] = { "Mares eat oats", "Does eat oats", "Little lambs eat ivy", "A kid will eat ivy too" }; try { for (int i = 0; i < importantInfo.length; i++) { //Pause for 4 seconds Thread.sleep(4000); //Print a message threadMessage(importantInfo[i]); } } catch (InterruptedException e) { threadMessage("I wasn't done!"); } } } public static void main(String args[]) throws InterruptedException { //Delay, in milliseconds before we interrupt MessageLoop //thread (default one hour). long patience = 1000 * 60 * 60; //If command line argument present, gives patience in seconds. if (args.length > 0) { try { patience = Long.parseLong(args[0]) * 1000; } catch (NumberFormatException e) { System.err.println("Argument must be an integer."); System.exit(1); } } threadMessage("Starting MessageLoop thread"); long startTime = System.currentTimeMillis(); Thread t = new Thread(new MessageLoop()); t.start(); threadMessage("Waiting for MessageLoop thread to finish"); //loop until MessageLoop thread exits while (t.isAlive()) { threadMessage("Still waiting..."); //Wait maximum of 1 second for MessageLoop thread to //finish. /*******LOOK HERE**********************/ Thread.sleep(1000);//issues caution unlike t.join(1000) /**************************************/ if (((System.currentTimeMillis() - startTime) > patience) && t.isAlive()) { threadMessage("Tired of waiting!"); t.interrupt(); //Shouldn't be long now -- wait indefinitely t.join(); } } threadMessage("Finally!"); } } As i understand it, join waits for the other thread to complete, but in this case, arent both sleep and join doing the same thing? Then why does netbeans throw the caution?

    Read the article

  • ASP.Net / MySQL : Translating content into several languages

    - by philwilks
    I have an ASP.Net website which uses a MySQL database for the back end. The website is an English e-commerce system, and we are looking at the possibility of translating it into about five other languages (French, Spanish etc). We will be getting human translators to perform the translation - we've looked at automated services but these aren't good enough. The static text on the site (e.g. headings, buttons etc) can easily be served up in multiple languages via .Net's built in localization features (resx files etc). The thing that I'm not so sure about it how best to store and retrieve the multi-language content in the database. For example, there is a products table that includes these fields... productId (int) categoryId (int) title (varchar) summary (varchar) description (text) features (text) The title, summary, description and features text would need to be available in all the different languages. Here are the two options that I've come up with... Create additional field for each language For example we could have titleEn, titleFr, titleEs etc for all the languages, and repeat this for all text columns. We would then adapt our code to use the appropriate field depending on the language selected. This feels a bit hacky, and also would lead to some very large tables. Also, if we wanted to add additional languages in the future it would be time consuming to add even more columns. Use a lookup table We could create a new table with the following format... textId | languageId | content ------------------------------- 10 | EN | Car 10 | FR | Voiture 10 | ES | Coche 11 | EN | Bike 11 | FR | Vélo We'd then adapt our products table to reference the appropriate textId for the title, summary, description and features instead of having the text stored in the product table. This seems much more elegant, but I can't think of a simple way of getting this data out of the database and onto the page without using complex SQL statements. Of course adding new languages in the future would be very simple compared to the previous option. I'd be very grateful for any suggestions about the best way to achieve this! Is there any "best practice" guidance out there? Has anyone done this before?

    Read the article

  • jquery validation plugin doesn't seem to work ....

    - by Pandiya Chendur
    asp.net mvc's Html.BeginForm() seems to work with jquery validation plugin but the validation plugin doesn't seem to work with a form which i ve added to a page.... This works, <% using (Html.BeginForm("Login", "Registration", FormMethod.Post, new { id = "Loginform" })) {%> <fieldset> <legend>Login</legend> <p> <label for="EmailId">EmailId:</label> <%= Html.TextBox("EmailId", null, new { @class = "text_box_height_14_width_150" })%> </p> <div class="status"></div> <p> <label for="Password">Password:</label> <%= Html.Password("Password",null, new { @class = "text_box_height_14_width_150" }) %> </p> <div class="status"></div> <p> <input type="submit" value="Login" id="login" /> </p> </fieldset> <% } %> But this doesn't work, <form id="Loginform" method="post" action="Registration/Login"> <table cellpadding="0" cellspacing="0" width="100%" style="border:none;"> <tr> <td width="12%">Email Id&nbsp;:&nbsp;</td><td width="15%"> <input id="EmailId" type="text" class="text_box_height_14_width_150 name="EmailId" /></td><td width="20%" class="status"></td> <td width="12%">Password&nbsp;:&nbsp;<td width="15%"><input id="Password" type="password" class="text_box_height_14_width_150 name="Password" /></td> <td width="20%" class="status"></td> <td width="5%"><input type="submit" value="Login" id="BtnLogin" /></td> </tr> </table> </form> and my jquery function has this, $(document).ready(function() { var validator = $("#Loginform").validate({ rules: { EmailId: "required", Password: { required: true, minlength: 6 } }, messages: { EmailId: "Enter your EMail ID", Password: { required: "Please Provide a password", rangelength: jQuery.format("Enter at least {0} characters") } }, // the errorPlacement has to take the table layout into account errorPlacement: function(error, element) { error.appendTo(element.parent().next()); }, // set this class to error-labels to indicate valid fields success: function(label) { // set &nbsp; as text for IE label.html("&nbsp;").addClass("checked"); } }); }); Any suggestion... Am i missing something?

    Read the article

  • Which is the "best" data access framework/approach for C# and .NET?

    - by Frans
    (EDIT: I made it a community wiki as it is more suited to a collaborative format.) There are a plethora of ways to access SQL Server and other databases from .NET. All have their pros and cons and it will never be a simple question of which is "best" - the answer will always be "it depends". However, I am looking for a comparison at a high level of the different approaches and frameworks in the context of different levels of systems. For example, I would imagine that for a quick-and-dirty Web 2.0 application the answer would be very different from an in-house Enterprise-level CRUD application. I am aware that there are numerous questions on Stack Overflow dealing with subsets of this question, but I think it would be useful to try to build a summary comparison. I will endeavour to update the question with corrections and clarifications as we go. So far, this is my understanding at a high level - but I am sure it is wrong... I am primarily focusing on the Microsoft approaches to keep this focused. ADO.NET Entity Framework Database agnostic Good because it allows swapping backends in and out Bad because it can hit performance and database vendors are not too happy about it Seems to be MS's preferred route for the future Complicated to learn (though, see 267357) It is accessed through LINQ to Entities so provides ORM, thus allowing abstraction in your code LINQ to SQL Uncertain future (see Is LINQ to SQL truly dead?) Easy to learn (?) Only works with MS SQL Server See also Pros and cons of LINQ "Standard" ADO.NET No ORM No abstraction so you are back to "roll your own" and play with dynamically generated SQL Direct access, allows potentially better performance This ties in to the age-old debate of whether to focus on objects or relational data, to which the answer of course is "it depends on where the bulk of the work is" and since that is an unanswerable question hopefully we don't have to go in to that too much. IMHO, if your application is primarily manipulating large amounts of data, it does not make sense to abstract it too much into objects in the front-end code, you are better off using stored procedures and dynamic SQL to do as much of the work as possible on the back-end. Whereas, if you primarily have user interaction which causes database interaction at the level of tens or hundreds of rows then ORM makes complete sense. So, I guess my argument for good old-fashioned ADO.NET would be in the case where you manipulate and modify large datasets, in which case you will benefit from the direct access to the backend. Another case, of course, is where you have to access a legacy database that is already guarded by stored procedures. ASP.NET Data Source Controls Are these something altogether different or just a layer over standard ADO.NET? - Would you really use these if you had a DAL or if you implemented LINQ or Entities? NHibernate Seems to be a very powerful and powerful ORM? Open source Some other relevant links; NHibernate or LINQ to SQL Entity Framework vs LINQ to SQL

    Read the article

< Previous Page | 467 468 469 470 471 472 473 474 475 476 477 478  | Next Page >