Search Results

Search found 42468 results on 1699 pages for 'default program'.

Page 481/1699 | < Previous Page | 477 478 479 480 481 482 483 484 485 486 487 488  | Next Page >

  • How do you stop Eclipse from inserting a certain class in Content-Assist?

    - by fletchgqc.mp
    I'm using SpringSource Tool Suite (Eclipse) to program with Grails, and I'm also using JFreechart in the program. In Grails you log by typing log.info("method worked"). Unfortunately JFrechart has a class called "Log" with Static methods like "info". This means that in STS I type log.info and then when I type space or ( Eclipse "assists" me by importing the JFreechart Log class and changing what I've typed to Log.info(message). Very irritating. I reckon I could turn off the Eclipse option to "insert single proposals automatically", but I like this feature. Can I instruct Eclipse not to give me content assist from this particular JFreechart class?

    Read the article

  • Fastest way to move records from an Oracle database into SQL Server

    - by user347748
    Ok this is the scenario... I have a table in Oracle that acts like a queue... A VB.net program reads the queue and calls a stored proc in SQL Server that processes and then inserts the message into another SQL Server table and then deletes the record from the oracle table. We use a DataReader to read the records from Oracle and then call the stored proc for each of the records. The program seems to be a little slow. The stored procedure itself isn't slow. The SP by itself when called in a loop can process about 2000 records in 20 seconds. But when called from the .Net program, the execution time is about 5 records per second. I have seen that most of the time consumed is in calling the stored procedure and waiting for it to return. Is there a better way of doing this? Here is a snippet of the actual code Function StartDataXfer() As Boolean Dim status As Boolean = False Try SqlConn.Open() OraConn.Open() c.ErrorLog(Now.ToString & "--Going to Get the messages from oracle", 1) If GetMsgsFromOracle() Then c.ErrorLog(Now.ToString & "--Got messages from oracle", 1) If ProcessMessages() Then c.ErrorLog(Now.ToString & "--Finished Processing all messages in the queue", 0) status = True Else c.ErrorLog(Now.ToString & "--Failed to Process all messages in the queue", 0) status = False End If Else status = True End If StartDataXfer = status Catch ex As Exception Finally SqlConn.Close() OraConn.Close() End Try End Function Private Function GetMsgsFromOracle() As Boolean Try OraDataAdapter = New OleDb.OleDbDataAdapter OraDataTable = New System.Data.DataTable OraSelCmd = New OleDb.OleDbCommand GetMsgsFromOracle = False With OraSelCmd .CommandType = CommandType.Text .Connection = OraConn .CommandText = GetMsgSql End With OraDataAdapter.SelectCommand = OraSelCmd OraDataAdapter.Fill(OraDataTable) If OraDataTable.Rows.Count > 0 Then GetMsgsFromOracle = True End If Catch ex As Exception GetMsgsFromOracle = False End Try End Function Private Function ProcessMessages() As Boolean Try ProcessMessages = False PrepareSQLInsert() PrepOraDel() i = 0 Dim Method As Integer Dim OraDataRow As DataRow c.ErrorLog(Now.ToString & "--Going to call message sending procedure", 2) For Each OraDataRow In OraDataTable.Rows With OraDataRow Method = GetMethod(.Item(0)) SQLInsCmd.Parameters("RelLifeTime").Value = c.RelLifetime SQLInsCmd.Parameters("Param1").Value = Nothing SQLInsCmd.Parameters("ID").Value = GenerateTransactionID() ' Nothing SQLInsCmd.Parameters("UID").Value = Nothing SQLInsCmd.Parameters("Param").Value = Nothing SQLInsCmd.Parameters("Credit").Value = 0 SQLInsCmd.ExecuteNonQuery() 'check the return value If SQLInsCmd.Parameters("ReturnValue").Value = 1 And SQLInsCmd.Parameters("OutPutParam").Value = 0 Then 'success 'delete the input record from the source table once it is logged c.ErrorLog(Now.ToString & "--Moved record successfully", 2) OraDataAdapter.DeleteCommand.Parameters("P(0)").Value = OraDataRow.Item(6) OraDataAdapter.DeleteCommand.ExecuteNonQuery() c.ErrorLog(Now.ToString & "--Deleted record successfully", 2) OraDataAdapter.Update(OraDataTable) c.ErrorLog(Now.ToString & "--Committed record successfully", 2) i = i + 1 Else 'failure c.ErrorLog(Now.ToString & "--Failed to exec: " & c.DestIns & "Status: " & SQLInsCmd.Parameters("OutPutParam").Value & " and TrackId: " & SQLInsCmd.Parameters("TrackID").Value.ToString, 0) End If If File.Exists("stop.txt") Then c.ErrorLog(Now.ToString & "--Stop File Found", 1) 'ProcessMessages = True 'Exit Function Exit For End If End With Next OraDataAdapter.Update(OraDataTable) c.ErrorLog(Now.ToString & "--Updated Oracle Table", 1) c.ErrorLog(Now.ToString & "--Moved " & i & " records from Oracle to SQL Table", 1) ProcessMessages = True Catch ex As Exception ProcessMessages = False c.ErrorLog(Now.ToString & "--MoveMsgsToSQL: " & ex.Message, 0) Finally OraDataTable.Clear() OraDataTable.Dispose() OraDataAdapter.Dispose() OraDelCmd.Dispose() OraDelCmd = Nothing OraSelCmd = Nothing OraDataTable = Nothing OraDataAdapter = Nothing End Try End Function Public Function GenerateTransactionID() As Int64 Dim SeqNo As Int64 Dim qry As String Dim SqlTransCmd As New OleDb.OleDbCommand qry = " select seqno from StoreSeqNo" SqlTransCmd.CommandType = CommandType.Text SqlTransCmd.Connection = SqlConn SqlTransCmd.CommandText = qry SeqNo = SqlTransCmd.ExecuteScalar If SeqNo > 2147483647 Then qry = "update StoreSeqNo set seqno=1" SqlTransCmd.CommandText = qry SqlTransCmd.ExecuteNonQuery() GenerateTransactionID = 1 Else qry = "update StoreSeqNo set seqno=" & SeqNo + 1 SqlTransCmd.CommandText = qry SqlTransCmd.ExecuteNonQuery() GenerateTransactionID = SeqNo End If End Function Private Function PrepareSQLInsert() As Boolean 'function to prepare the insert statement for the insert into the SQL stmt using 'the sql procedure SMSProcessAndDispatch Try Dim dr As DataRow SQLInsCmd = New OleDb.OleDbCommand With SQLInsCmd .CommandType = CommandType.StoredProcedure .Connection = SqlConn .CommandText = SQLInsProc .Parameters.Add("ReturnValue", OleDb.OleDbType.Integer) .Parameters("ReturnValue").Direction = ParameterDirection.ReturnValue .Parameters.Add("OutPutParam", OleDb.OleDbType.Integer) .Parameters("OutPutParam").Direction = ParameterDirection.Output .Parameters.Add("TrackID", OleDb.OleDbType.VarChar, 70) .Parameters.Add("RelLifeTime", OleDb.OleDbType.TinyInt) .Parameters("RelLifeTime").Direction = ParameterDirection.Input .Parameters.Add("Param1", OleDb.OleDbType.VarChar, 160) .Parameters("Param1").Direction = ParameterDirection.Input .Parameters.Add("TransID", OleDb.OleDbType.VarChar, 70) .Parameters("TransID").Direction = ParameterDirection.Input .Parameters.Add("UID", OleDb.OleDbType.VarChar, 20) .Parameters("UID").Direction = ParameterDirection.Input .Parameters.Add("Param", OleDb.OleDbType.VarChar, 160) .Parameters("Param").Direction = ParameterDirection.Input .Parameters.Add("CheckCredit", OleDb.OleDbType.Integer) .Parameters("CheckCredit").Direction = ParameterDirection.Input .Prepare() End With Catch ex As Exception c.ErrorLog(Now.ToString & "--PrepareSQLInsert: " & ex.Message) End Try End Function Private Function PrepOraDel() As Boolean OraDelCmd = New OleDb.OleDbCommand Try PrepOraDel = False With OraDelCmd .CommandType = CommandType.Text .Connection = OraConn .CommandText = DelSrcSQL .Parameters.Add("P(0)", OleDb.OleDbType.VarChar, 160) 'RowID .Parameters("P(0)").Direction = ParameterDirection.Input .Prepare() End With OraDataAdapter.DeleteCommand = OraDelCmd PrepOraDel = True Catch ex As Exception PrepOraDel = False End Try End Function WHat i would like to know is, if there is anyway to speed up this program? Any ideas/suggestions would be highly appreciated... Regardss, Chetan

    Read the article

  • Highest value datatype can store in c#

    - by user472832
    I am writing a small program for my assignment to find the primitive roots of a prime number. So far, the program works for smaller prime numbers till 13 and gives correct number of roots. But for higher primes numbers, it is showing only fewer primitive roots. And now i got stuck for the prime number 41, shows no primitive roots for it. I used DOUBLE datatype for the calculation, and again tried with the datatype DECIMAL, but no luck. Does anyone know about this kind of problem??? Thank you.

    Read the article

  • In .NET Xml Serialization, is it possible to serialize a class with an enum property with different

    - by Lasse V. Karlsen
    I have a class, containing a list property, where the list contains objects that has an enum property. When I serialize this, it looks like this: <?xml version="1.0" encoding="ibm850"?> <test> <events> <test-event type="changing" /> <test-event type="changed" /> </events> </test> Is it possible, through attributes, or similar, to get the Xml to look like this? <?xml version="1.0" encoding="ibm850"?> <test> <events> <changing /> <changed /> </events> </test> Basically, use the property value of the enum as a way to determine the tag-name? Is using a class hierarchy (ie. creating subclasses instead of using the property value) the only way? Edit: After testing, it seems even a class-hierarchy won't actually work. If there is a way to structure the classes to get the output I want, even with sub-classes, that is also an acceptable answer. Here's a sample program that will output the above Xml (remember to hit Ctrl+F5 to run in Visual Studio, otherwise the program window will close immediately): using System; using System.Collections.Generic; using System.Xml.Serialization; namespace ConsoleApplication18 { public enum TestEventTypes { [XmlEnum("changing")] Changing, [XmlEnum("changed")] Changed } [XmlType("test-event")] public class TestEvent { [XmlAttribute("type")] public TestEventTypes Type { get; set; } } [XmlType("test")] public class Test { private List<TestEvent> _Events = new List<TestEvent>(); [XmlArray("events")] public List<TestEvent> Events { get { return _Events; } } } class Program { static void Main(string[] args) { Test test = new Test(); test.Events.Add(new TestEvent { Type = TestEventTypes.Changing }); test.Events.Add(new TestEvent { Type = TestEventTypes.Changed }); XmlSerializer serializer = new XmlSerializer(typeof(Test)); XmlSerializerNamespaces ns = new XmlSerializerNamespaces(); ns.Add("", ""); serializer.Serialize(Console.Out, test, ns); } } }

    Read the article

  • Using libraries with different licenses (CPOL + LGPL)

    - by jaens
    I'm developing a program that will be published on my university's website. In this program I use two libraries, one under the LGPL and one under the CPOL (link text). I plan on releasing the complete source code, libraries included (without modification). Do those licenses clash? What do I have to do to "fix" it? Do I have to do anything in particular (put text in source code files, put references in documentation...)? Thanks in advance.

    Read the article

  • C# Console Application Output to .csv file

    - by Zinn
    I am trying to make a program that will show the numbers: 1, 10 +30 2, 40 (the scale goes up in this pattern by adding 20 to the last number added) 3, 90 +50 4, 160 5, 250 +70 So far I have this code: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.IO;// namespace Myloop { class Program { static void Main(string[] args) /// </summary> { StreamWriter myOutputStream = new StreamWriter("loopdata.csv"); int forloop; for (forloop = 1; forloop < 21; forloop++) Console.WriteLine(forloop); Console.ReadLine(); myOutputStream.Close(); } } } This is showing the first sequence of numbers 1 - 20, but could anyone give me any guidance how to do the other sequence next to it in the console application and how I can output these to a .csv file, as the information I have so far doesn't appear in the .csv file

    Read the article

  • soft stoppped working

    - by Jack Morton
    this is might be really weird, but I have no idea what kinda wizardry of this. Basically, my Visual Studio stopped responding to my changes, it stopped building solution. I can comment code, which would completely ruin the logic of program, and Visual Studio will still run program that I guess it has in memory. It's really annoying, and I have no idea what it is. I keep restarting software, but it's still does the same. It's a licensed software. I was wondering If someone knew what was going on. Thanks!

    Read the article

  • C#, working with files, "Unauthorized Access"?

    - by Rob
    Hi, I'm learning about opening and saving files with C# and it seems that vista won't let my program save to a file on the root of C:\ , unless I run it in administrator mode. Any ideas how to allow my program to play around with whatever files it wants? Thanks! string name; private void button2_Click(object sender, EventArgs e) ///// OPEN ///// { if (openFileDialog1.ShowDialog() == DialogResult.OK) { name = openFileDialog1.FileName; textBox1.Clear(); textBox1.Text = File.ReadAllText(name); textBox2.Text = name; } } private void button1_Click(object sender, EventArgs e) ///// SAVE ///// { File.WriteAllText(name, textBox1.Text); }

    Read the article

  • Reason for unintuitive UnboundLocalError behaviour 2

    - by Jonathan
    Following up on Reason for unintuitive UnboundLocalError behaviour (I will assume you've read it). Consider the following Python script: def f(): # a+=1 # 1 aa=a aa+=1 # b+='b' # 2 bb=b bb+='b' c[0]+='c' # 3 c.append('c') cc=c cc.append('c') # 4 a=1 b='b' c=['c'] f() print a print b print c The result of the script is: 1 b ['cc', 'c', 'c'] The commented out lines (marked 1,2) are lines that would through an UnboundLocalError and the SO question I referenced explains why. However, the line marked 3 works! By default, lists are copied by reference in Python, therefore it's understandable that c changes when cc changes. But why should Python allow c to change in the first place, if it didn't allow changes to a and b directly from the method's scope? I don't see how the fact that by default lists are copied by reference in Python should make this design decision inconsistent. What am I missing folks?

    Read the article

  • bash tools for parsing arguments

    - by BCS
    I have a bash script that uses a few variables (call them $foo and $bar). Right now the script defines them at the top with hard coded values like this: foo=fooDefault bar=barDefault .... # use $foo and $bar What I want is to be able to use the script like any of these: myscript # use all defaults myscript -foo=altFoo # use default bar myscript -bar=altBar # use default foo myscript -bar=altBar -foo=altFoo An ideal solution would allow me to just list the variable that I want to check for flags for. Is there a reasonably nice way to do this? I've seen getopt and I think it might do about 70% of what I'm looking for but I'm wondering if there is a tool or indium that builds on it or the like that gets the rest.

    Read the article

  • Execute a line in a text file

    - by apophis
    Hi I have a program that reads text files filled with code designed to be executed line by line by the program, like a script file. The problem is that I don't no how to do the line executing part. Here is my code, I thought using the \r would fool the console. But it just shows me a list of lines in the file. if (tok[0] == "read" && length == 2) { try { StreamReader tr = new StreamReader(@"C:\Users\Public\"+tok[1]+".txt"); while (!tr.EndOfStream) { Console.WriteLine(tr.ReadLine()); } } catch { Console.WriteLine("No such text file.\n"); } Prompt(); If I knew what to search for to fix my problem in Google, I would have. But I've got no idea. Thanks

    Read the article

  • Problem with joining to an empty table

    - by Imran Omar Bukhsh
    I use the following query: select * from A LEFT JOIN B on ( A.t_id != B.t_id) to get all the records in A that are not in B. The results are fine except when table B is completely empty, but then I do not get any records, even from table A. Later It wont work yet! CREATE TABLE IF NOT EXISTS T1 ( id int(11) unsigned NOT NULL AUTO_INCREMENT, title varchar(50) CHARACTER SET utf8 COLLATE utf8_unicode_ci NOT NULL, t_id int(11) NOT NULL, PRIMARY KEY (id) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=3 ; -- -- Dumping data for table T1 INSERT INTO T1 (id, title, t_id) VALUES (1, 'apple', 1), (2, 'orange', 2); -- -- Table structure for table T2 CREATE TABLE IF NOT EXISTS T2 ( id int(11) NOT NULL AUTO_INCREMENT, title varchar(50) CHARACTER SET utf8 COLLATE utf8_unicode_ci NOT NULL, t_id int(11) NOT NULL, PRIMARY KEY (id) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=2 ; -- -- Dumping data for table T2 INSERT INTO T2 (id, title, t_id) VALUES (1, 'dad', 2); Now I want to get all records in T1 that do not have a corresponding records in T2 I try SELECT * FROM T1 LEFT OUTER JOIN T2 ON T1.t_id != T2.t_id and it won't work

    Read the article

  • how to find which libraries to link to? or, how can I create *-config (such as sdl-config, llvm-con

    - by numeric
    Hey, I want to write a program that outputs a list of libraries that I should link to given source code (or object) files (for C or C++ programs). In *nix, there are useful tools such as sdl-config and llvm-config. But, I want my program to work on Windows, too. Usage: get-library-names -l /path/to/lib a.cpp b.cpp c.cpp d.obj Then, get-library-names would get a list of function names that are invoked from a.cpp, b.cpp, c.cpp, and d.obj. And, it'll search all library files in /path/to/lib directory and list libraries that are needed to link properly. Is there such tool already written? Is it not trivial to write a such tool? How do you find what libraries you should link to? Thanks.

    Read the article

  • How can I find out how much memory an instance of a C++ class consumes?

    - by Shadow
    Hi, I am developing a Graph-class, based on boost-graph-library. A Graph-object contains a boost-graph, so to say an adjacency_list, and a map. When monitoring the total memory usage of my program, it consumes quite a lot (checked with pmap). Now, I would like to know, how much of the memory is exactly consumed by a filled object of this Graph-class? With filled I mean when the adjacency_list is full of vertices and edges. I found out, that using sizeof() doesn't bring me far. Using valgrind is also not an alternative as there is quite some memory allocation done previously and this makes the usage of valgrind impractical for this purpose. I'm also not interested in what other parts of the program cost in memory, I want to focus on one single object. Thank you.

    Read the article

  • Python: How to quit CLI when stuck in blocking raw_input?

    - by christianschluchter
    I have a GUI program which should also be controllable via CLI (for monitoring). The CLI is implemented in a while loop using raw_input. If I quit the program via a GUI close button, it hangs in raw_input and does not quit until it gets an input. How can I immediately abort raw_input without entering an input? I run it on WinXP but I want it to be platform independent, it should also work within Eclipse since it is a developer tool. Python version is 2.6. I searched stackoverflow for hours and I know there are many answers to that topic, but is there really no platform independent solution to have a non-blocking CLI reader? If not, what would be the best way to overcome this problem? Thanks

    Read the article

  • Ruby on Rails: Modules vs. Classes

    - by Jack
    I'm trying to add a function that will be accessible throughout all parts of my program. I want something like: def GlobalFunctions.my_function(x,y) puts x + y end to be accessible for all models. Specifically I am trying to use a function like this in my seeds.rb file but I am most likely going to be reusing the code and don't want any redundancy. Now I know I can make a simple class, but I could also make a module. What are some reasons to go in either direction? And once I've decided on which type to use, how do I make it accessible throughout the whole program? I have tried a module, but I keep getting " Expected app/[module file] to define [ModuleName]"

    Read the article

  • problem with exporting a customized form from dll

    - by mavric
    I'm working on an application so i have write an dll which contain a form with some additional work and methods. so in the beginning of my program the thread launch this form (from my dll) to get some informations and then hide it and initialize some components and the application form and then show it. when the thread come the line where it define new instance of the exported form "MyForm inputform = new MyForm();" it throw an Exception called "Top-level control cannot be added to a control." so i don't know what to do ?!!. i tried to take the code of the form from the dll source code and put it in the main program and it works.... .but still i want to know what happen and what impede my application from run that form from my dll. thanks.

    Read the article

  • Python structure mistake

    - by jaddy123
    I'm writing a program in which I can Reverse the sequence and Replace all As with Ts, all Cs with Gs, all Gs with Cs, and all Ts with As. the program is to read a sequence of bases and output the reverse complement sequence. I am having trouble to do it so can anyone please help me with this by having a look on my code: word = raw_input("Enter sequence: ") a = word.replace('A', 'T') b = word.replace('C', 'G') c = word.replace('G', 'C') d = word.replace('T', 'A') if a == word and b == word and c == word and d == word: print "Reverse complement sequence: ", word And I want this sort of output: Enter sequence: CGGTGATGCAAGG Reverse complement sequence: CCTTGCATCACCG Regards

    Read the article

  • Boost Shared Pointers and Memory Management

    - by Izza
    I began using boost rather recently and am impressed by the functionality and APIs provided. In using boost::shared_ptr, when I check the program with Valgrind, I found a considerable number of "Still reachable" memory leaks. As per the documentation of Valgrind, these are not a problem. However, since I used to use the standard C++ library only, I always made sure that any program written is completely free from memory leaks. My question is, are these memory leaks something to worry about? I tried using reset(), however it only decrements the reference count, doesn't deallocate memory. Can I safely ignore these, or any way to forcibly deallocate the memory allocated by boost::shared_ptr? Thank you.

    Read the article

  • Count Clicks in excel

    - by rockbala
    Hi, Can some one recommend any free program which counts the number of clicks Clicked inside a cell. For Example Imagine something like Spreadsheet I click on A1 cell the value shows 1 Then I click A1 cell again the value shows 2 and so on If I click A3 cell somewhere in between the click count on Cell A3 shows 1 and so on If something like this can be achieved as a macro with in excel (2003 please) please suggest or any other free program that you might be aware about, please do let me know. I appreciate all your help and thank you in advance. rockbala

    Read the article

  • Joomla changing menu from Component

    - by Bobz
    My component is always shown on the Default menu, I want to be able to change the menu from my component. I have found that: $currentMenuId = JSite::getMenu()-getActive()-id ; Returns the current active Menu item However, $menu-setActive( $menuitemid ); Does not do anything, Whether I use, $app = JFactory::getApplication(); $menu = $app-getMenu(); $menu-setActive( $menuitemid ); or, $menu = JSite::getMenu(); $menu-setActive( $menuitemid ); How can I change the menu? As I do not want it to always be shown on the default menu.

    Read the article

  • Java Authenticator on a per connection basis?

    - by Martijn Laarman
    I'm building an Eclipse plugin that talks to a REST interface which uses Basic Authentication. When the authentication fails I would like to popup my plugin's settings dialog and retry. Normally I could use the static Authenticator.setDefault() to setup an authenticator for all HttpURLConnection's for this, but since I am writing a plugin I don't want to overwrite Eclipse's default Authenticator (org.eclipse.ui.internal.net.auth); I thought of setting my custom Authenticator before loading and putting Eclipse's default back afterwards, but I imagine this will cause all sorts of race issues with multithreading so I quickly lost that notion. Google searches yield all sorts of results basically telling me it's not possible: The Java URLConnection API should have a setAuthenticator(Authenticator) method for making it easier to use this class in multi-threaded context where authentication is required. Source If applications contains few third party plugins and each plugin use its own Authenticator what we should do? Each invocation of "Authenticator.setDefault()" method rewrite previously defined Authenticator... Source Are there any different approaches that might help me overcome this issue?

    Read the article

  • What's this UI pattern called?

    - by Bears will eat you
    I'm trying to figure out what this sort of thing is called, and eventually how I can create one in a web browser. It looks like this (screenshot of the first app that came to mind): The specific component/pattern I'm looking for is the two list boxes ("Included Gear" and "Excluded Gear") that represent inclusion/exclusion of items from a set. I'm not really looking for the WPF name (if there is one) but it might be helpful. I am looking for the name of this thingy, if there is one, and if you really want to make my day, you can point me toward a jQuery or YUI way of making one of these dealies in a browser. In case you were wondering, the screenshot is a World of Warcraft gear optimization program. Go figure why it was the first program that came to mind when I was trying to think of an example.

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

< Previous Page | 477 478 479 480 481 482 483 484 485 486 487 488  | Next Page >