Search Results

Search found 13469 results on 539 pages for 'avoid trouble'.

Page 507/539 | < Previous Page | 503 504 505 506 507 508 509 510 511 512 513 514  | Next Page >

  • System.Threading.Timer Doesn't Trigger my TimerCallBack Delegate

    - by Tom Kong
    Hi, I am writing my first Windows Service using C# and I am having some trouble with my Timer class. When the service is started, it runs as expected but the code will not execute again (I want it to run every minute) Please take a quick look at the attached source and let me know if you see any obvious mistakes! TIA using System; using System.Collections.Generic; using System.ComponentModel; using System.Data; using System.Diagnostics; using System.Linq; using System.ServiceProcess; using System.Text; using System.Threading; using System.IO; namespace CXO001 { public partial class Service1 : ServiceBase { public Service1() { InitializeComponent(); } /* * Aim: To calculate and update the Occupancy values for the different Sites * * Method: Retrieve data every minute, updating a public value which can be polled */ protected override void OnStart(string[] args) { Daemon(); } public void Daemon() { TimerCallback tcb = new TimerCallback(On_Tick); TimeSpan duetime = new TimeSpan(0, 0, 1); TimeSpan interval = new TimeSpan(0, 1, 0); Timer querytimer = new Timer(tcb, null, duetime, interval); } protected override void OnStop() { } static int[] floorplanids = new int[] { 115, 114, 107, 108 }; public static List<Record> Records = new List<Record>(); static bool firstrun = true; public static void On_Tick(object timercallback) { //Update occupancy data for the last minute //Save a copy of the public values to HDD with a timestamp string starttime; if (Records.Count > 0) { starttime = Records.Last().TS; firstrun = false; } else { starttime = DateTime.Today.AddHours(7).ToString(); firstrun = true; } DateTime endtime = DateTime.Now; GetData(starttime, endtime); } public static void GetData(string starttime, DateTime endtime) { string connstr = "Data Source = 192.168.1.123; Initial Catalog = Brickstream_OPS; User Id = Brickstream; Password = bstas;"; DataSet resultds = new DataSet(); //Get the occupancy for each Zone foreach (int zone in floorplanids) { SQL s = new SQL(); string querystr = "SELECT SUM(DIRECTIONAL_METRIC.NUM_TO_ENTER - DIRECTIONAL_METRIC.NUM_TO_EXIT) AS 'Occupancy' FROM REPORT_OBJECT INNER JOIN REPORT_OBJ_METRIC ON REPORT_OBJECT.REPORT_OBJ_ID = REPORT_OBJ_METRIC.REPORT_OBJECT_ID INNER JOIN DIRECTIONAL_METRIC ON REPORT_OBJ_METRIC.REP_OBJ_METRIC_ID = DIRECTIONAL_METRIC.REP_OBJ_METRIC_ID WHERE (REPORT_OBJ_METRIC.M_START_TIME BETWEEN '" + starttime + "' AND '" + endtime.ToString() + "') AND (REPORT_OBJECT.FLOORPLAN_ID = '" + zone + "');"; resultds = s.Go(querystr, connstr, zone.ToString(), resultds); } List<Record> result = new List<Record>(); int c = 0; foreach (DataTable dt in resultds.Tables) { Record r = new Record(); r.TS = DateTime.Now.ToString(); r.Zone = dt.TableName; if (!firstrun) { r.Occupancy = (dt.Rows[0].Field<int>("Occupancy")) + (Records[c].Occupancy); } else { r.Occupancy = dt.Rows[0].Field<int>("Occupancy"); } result.Add(r); c++; } Records = result; MrWriter(); } public static void MrWriter() { StringBuilder output = new StringBuilder("Time,Zone,Occupancy\n"); foreach (Record r in Records) { output.Append(r.TS); output.Append(","); output.Append(r.Zone); output.Append(","); output.Append(r.Occupancy.ToString()); output.Append("\n"); } output.Append(firstrun.ToString()); output.Append(DateTime.Now.ToFileTime()); string filePath = @"C:\temp\CXO.csv"; File.WriteAllText(filePath, output.ToString()); } } }

    Read the article

  • jQuery AJAX POST gives undefined index

    - by Sebastian
    My eventinfo.php is giving the following output: <br /> <b>Notice</b>: Undefined index: club in <b>/homepages/19/d361310357/htdocs/guestvibe/wp-content/themes/yasmin/guestvibe/eventinfo.php</b> on line <b>11</b><br /> [] HTML (index.php): <select name="club" class="dropdown" id="club"> <?php getClubs(); ?> </select> jQuery (index.php): <script type="text/javascript"> $(document).ready(function() { $.ajax({ type: "POST", url: "http://www.guestvibe.com/wp-content/themes/yasmin/guestvibe/eventinfo.php", data: $('#club').serialize(), success: function(data) { $('#rightbox_inside').html('<h2>' + $('#club').val() + '<span style="font-size: 14px"> (' + data[0].day + ')</h2><hr><p><b>Entry:</b> ' + data[0].entry + '</p><p><b>Queue jump:</b> ' + data[0].queuejump + '</p><br><p><i>Guestlist closes at ' + data[0].closing + '</i></p>'); }, dataType: "json" }); }); $('#club').change(function(event) { $.ajax({ type: "POST", url: "http://www.guestvibe.com/wp-content/themes/yasmin/guestvibe/eventinfo.php", data: $(this).serialize(), success: function(data) { $('#rightbox_inside').hide().html('<h2>' + $('#club').val() + '<span style="font-size: 14px"> (' + data[0].day + ')</h2><hr><p><b>Entry:</b> ' + data[0].entry + '</p><p><b>Queue jump:</b> ' + data[0].queuejump + '</p><br><p><i>Guestlist closes at ' + data[0].closing + '</i></p>').fadeIn('500'); }, dataType: "json" }); }); </script> I can run alerts from the jQuery, so it is active. I've copied this as is from an old version of the website, but I've changed the file structure (through to move to WordPress) so I suspect the variables might not even be reaching eventinfo.php in the first place... index.php is in wp-content/themes/cambridge and eventinfo.php is in wp-content/themes/yasmin/guestvibe but I've tried to avoid structuring issues by referencing the URL in full. Any ideas?

    Read the article

  • jQuery pop up problems

    - by user327137
    Hi all, I am creating a site from a template i purchased from TM for a beauty salon! I want to create an online booking form with the validations of name number service type but i'm having trouble getting a link to open that will pop up also using jquery NOT html how do i fix this... what is the code i have to insert so that when you click "BOOK NOW" a jquery pop up appears in the centre of the page and it has a booking form on it.... i have googled and googled but it is all new to me as in a NOOB at jquery.... here is a live demo of the template (template link for demo http://osc4.template-help.com/wt_31562/index.html#) and here is the code for where i am trying to place a pop up jquery <dt class="dt3"><a href="#"></a><img src="images/shadow.png" alt="" class="shadow"></dt> <dd id="page3"> <div class="inner"> <div class="content"> <section class="col-1"> <h2>our services</h2> <p>Vintage Beauty</p> <p class="dark">We offer Free Consultation for Botox, Fillers, Medical Skin Peels, Cosmetic Surgery <br> & also specialise n body and skin care. </p> <img src="images/page2-img1.png" alt="" class="p2"> <a href="#" class="more">view more</a> </section> <section class="col-2"> <h2>services</h2> <ul class="list p2"> <li><a href="#">Fish Pedicures</a></li> <li><a href="#">Manicures</a></li> <li><a href="#">Pedicures</a></li> <li><a href="#">Waxing</a></li> <li><a href="#">Threading</a></li> <li><a href="#">Tanning</a></li> <li><a href="#">Body Massage</a></li> <li><a href="#">Nail/Eye Extensions</a></li> <li><a href="#">Eye Lash/Brow Tinting</a></li> <li><a href="#">Twinkle Toes</a></li> <li><a href="#">Teeth Whitening Kits</a></li> <li><a href="#">Hot Wax Specialists</a></li> </ul> **<a href="#" class="more">BOOK ONLINE NOW</a> </section>** </div> </div> </dd>

    Read the article

  • Java - is this an idiom or pattern, behavior classes with no state

    - by Berlin Brown
    I am trying to incorporate more functional programming idioms into my java development. One pattern that I like the most and avoids side effects is building classes that have behavior but they don't necessarily have any state. The behavior is locked into the methods but they only act on the parameters passed in. The code below is code I am trying to avoid: public class BadObject { private Map<String, String> data = new HashMap<String, String>(); public BadObject() { data.put("data", "data"); } /** * Act on the data class. But this is bad because we can't * rely on the integrity of the object's state. */ public void execute() { data.get("data").toString(); } } The code below is nothing special but I am acting on the parameters and state is contained within that class. We still may run into issues with this class but that is an issue with the method and the state of the data, we can address issues in the routine as opposed to not trusting the entire object. Is this some form of idiom? Is this similar to any pattern that you use? public class SemiStatefulOOP { /** * Private class implies that I can access the members of the <code>Data</code> class * within the <code>SemiStatefulOOP</code> class and I can also access * the getData method from some other class. * * @see Test1 * */ class Data { protected int counter = 0; public int getData() { return counter; } public String toString() { return Integer.toString(counter); } } /** * Act on the data class. */ public void execute(final Data data) { data.counter++; } /** * Act on the data class. */ public void updateStateWithCallToService(final Data data) { data.counter++; } /** * Similar to CLOS (Common Lisp Object System) make instance. */ public Data makeInstance() { return new Data(); } } // End of Class // Issues with the code above: I wanted to declare the Data class private, but then I can't really reference it outside of the class: I can't override the SemiStateful class and access the private members. Usage: final SemiStatefulOOP someObject = new SemiStatefulOOP(); final SemiStatefulOOP.Data data = someObject.makeInstance(); someObject.execute(data); someObject.updateStateWithCallToService(data);

    Read the article

  • Helping linqtosql datacontext use implicit conversion between varchar column in the database and tab

    - by user213256
    I am creating an mssql database table, "Orders", that will contain a varchar(50) field, "Value" containing a string that represents a slightly complex data type, "OrderValue". I am using a linqtosql datacontext class, which automatically types the "Value" column as a string. I gave the "OrderValue" class implicit conversion operators to and from a string, so I can easily use implicit conversion with the linqtosql classes like this: // get an order from the orders table MyDataContext db = new MyDataContext(); Order order = db.Orders(o => o.id == 1); // use implicit converstion to turn the string representation of the order // value into the complex data type. OrderValue value = order.Value; // adjust one of the fields in the complex data type value.Shipping += 10; // use implicit conversion to store the string representation of the complex // data type back in the linqtosql order object order.Value = value; // save changes db.SubmitChanges(); However, I would really like to be able to tell the linqtosql class to type this field as "OrderValue" rather than as "string". Then I would be able to avoid complex code and re-write the above as: // get an order from the orders table MyDataContext db = new MyDataContext(); Order order = db.Orders(o => o.id == 1); // The Value field is already typed as the "OrderValue" type rather than as string. // When a string value was read from the database table, it was implicity converted // to "OrderValue" type. order.Value.Shipping += 10; // save changes db.SubmitChanges(); In order to achieve this desired goal, I looked at the datacontext designer and selected the "Value" field of the "Order" table. Then, in properties, I changed "Type" to "global::MyApplication.OrderValue". The "Server Data Type" property was left as "VarChar(50) NOT NULL" The project built without errors. However, when reading from the database table, I was presented with the following error message: Could not convert from type 'System.String' to type 'MyApplication.OrderValue'. at System.Data.Linq.DBConvert.ChangeType(Object value, Type type) at Read_Order(ObjectMaterializer1 ) at System.Data.Linq.SqlClient.ObjectReaderCompiler.ObjectReader2.MoveNext() at System.Linq.Buffer1..ctor(IEnumerable1 source) at System.Linq.Enumerable.ToArray[TSource](IEnumerable`1 source) at Example.OrdersProvider.GetOrders() at ... etc From the stack trace, I believe this error is happening while reading the data from the table. When presented with converting a string to my custom data type, even though the implicit conversion operators are present, the DBConvert class gets confused and throws an error. Is there anything I can do to help it not get confused and do the implicit conversion? Thanks in advance, and apologies if I have posted in the wrong forum. cheers / Ben

    Read the article

  • Replace conditional with polymorphism refactoring or similar?

    - by Anders Svensson
    Hi, I have tried to ask a variant of this question before. I got some helpful answers, but still nothing that felt quite right to me. It seems to me this shouldn't really be that hard a nut to crack, but I'm not able to find an elegant simple solution. (Here's my previous post, but please try to look at the problem stated here as procedural code first so as not to be influenced by the earlier explanation which seemed to lead to very complicated solutions: http://stackoverflow.com/questions/2772858/design-pattern-for-cost-calculator-app ) Basically, the problem is to create a calculator for hours needed for projects that can contain a number of services. In this case "writing" and "analysis". The hours are calculated differently for the different services: writing is calculated by multiplying a "per product" hour rate with the number of products, and the more products are included in the project, the lower the hour rate is, but the total number of hours is accumulated progressively (i.e. for a medium-sized project you take both the small range pricing and then add the medium range pricing up to the number of actual products). Whereas for analysis it's much simpler, it is just a bulk rate for each size range. How would you be able to refactor this into an elegant and preferably simple object-oriented version (please note that I would never write it like this in a purely procedural manner, this is just to show the problem in another way succinctly). I have been thinking in terms of factory, strategy and decorator patterns, but can't get any to work well. (I read Head First Design Patterns a while back, and both the decorator and factory patterns described have some similarities to this problem, but I have trouble seeing them as good solutions as stated there. The decorator example seems very complicated for just adding condiments, but maybe it could work better here, I don't know. And the factory pattern example with the pizza factory...well it just seems to create such a ridiculous explosion of classes, at least in their example. I have found good use for factory patterns before, but I can't see how I could use it here without getting a really complicated set of classes) The main goal would be to only have to change in one place (loose coupling etc) if I were to add a new parameter (say another size, like XSMALL, and/or another service, like "Administration"). Here's the procedural code example: public class Conditional { private int _numberOfManuals; private string _serviceType; private const int SMALL = 2; private const int MEDIUM = 8; public int GetHours() { if (_numberOfManuals <= SMALL) { if (_serviceType == "writing") return 30 * _numberOfManuals; if (_serviceType == "analysis") return 10; } else if (_numberOfManuals <= MEDIUM) { if (_serviceType == "writing") return (SMALL * 30) + (20 * _numberOfManuals - SMALL); if (_serviceType == "analysis") return 20; } else //i.e. LARGE { if (_serviceType == "writing") return (SMALL * 30) + (20 * (MEDIUM - SMALL)) + (10 * _numberOfManuals - MEDIUM); if (_serviceType == "analysis") return 30; } return 0; //Just a default fallback for this contrived example } } All replies are appreciated! I hope someone has a really elegant solution to this problem that I actually thought from the beginning would be really simple... Regards, Anders

    Read the article

  • How do I get a button to show on mouseover using jQuery?

    - by sharataka
    I am trying to get a button to appear over an image when there is a mouseover event over the image. I have multiple images on the screen that I would like to have the same functionality. I'm having trouble getting this to work as the button is always present. Any advice on how to get it to work? Below is the rendered html and javascript. javascript <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.5.1/jquery.min.js"></script> <script src="http://code.jquery.com/jquery.min.js" type="text/javascript"></script> <script type = "text/javascript"> $(document).ready(function() { $('.image').mouseover(function(){ $('.munchbutton').show(); }); }); </script> css div.munchbutton{ position: absolute; bottom: 5px; right: 0px; left: 60px; } div.wrapper{ float:left; /* important */ position:relative; /* important(so we can absolutely position the description div */ padding: 5px; } html <!-- wrapper div --> <div class='wrapper'> <!-- image --> <div class="image" style="position: relative; left: 0; top: 0;"> <a href="/partners/Business/CNNMoney" > <img src="/static/CNNMoney.png" style="position: relative; top: 0; left: 0;"/> </a> <!-- partner munchbutton div --> <div class='munchbutton'> <form method='post'><div style='display:none'><input type='hidden' name='csrfmiddlewaretoken' value='7wq8pRYNCDkXUGRv7eU6qI1BU7RKyoT8' /></div> <input type="hidden" name="channel" id="channel" value="CNNMoney" /> <input type='submit' class = 'add' value='Add to plate'/> </form> </div> <!-- end munchbutton div --> </div> <!-- end image div --> </div> <!-- end wrapper div --> <!-- wrapper div --> <div class='wrapper'> <!-- image --> <div class="image" style="position: relative; left: 0; top: 0;"> <a href="/partners/Business/EconomistMagazine" > <img src="/static/EconomistMagazine.png" style="position: relative; top: 0; left: 0;"/> </a> <!-- partner munchbutton div --> <div class='munchbutton'> <form method='post'><div style='display:none'><input type='hidden' name='csrfmiddlewaretoken' value='7wq8pRYNCDkXUGRv7eU6qI1BU7RKyoT8' /></div> <input type="hidden" name="channel" id="channel" value="EconomistMagazine" /> <input type='submit' class = 'add' value='Add to plate'/> </form> </div> <!-- end munchbutton div --> </div> <!-- end image div --> </div> <!-- end wrapper div -->

    Read the article

  • Template function as a template argument

    - by Kos
    I've just got confused how to implement something in a generic way in C++. It's a bit convoluted, so let me explain step by step. Consider such code: void a(int) { // do something } void b(int) { // something else } void function1() { a(123); a(456); } void function2() { b(123); b(456); } void test() { function1(); function2(); } It's easily noticable that function1 and function2 do the same, with the only different part being the internal function. Therefore, I want to make function generic to avoid code redundancy. I can do it using function pointers or templates. Let me choose the latter for now. My thinking is that it's better since the compiler will surely be able to inline the functions - am I correct? Can compilers still inline the calls if they are made via function pointers? This is a side-question. OK, back to the original point... A solution with templates: void a(int) { // do something } void b(int) { // something else } template<void (*param)(int) > void function() { param(123); param(456); } void test() { function<a>(); function<b>(); } All OK. But I'm running into a problem: Can I still do that if a and b are generics themselves? template<typename T> void a(T t) { // do something } template<typename T> void b(T t) { // something else } template< ...param... > // ??? void function() { param<SomeType>(someobj); param<AnotherType>(someotherobj); } void test() { function<a>(); function<b>(); } I know that a template parameter can be one of: a type, a template type, a value of a type. None of those seems to cover my situation. My main question is hence: How do I solve that, i.e. define function() in the last example? (Yes, function pointers seem to be a workaround in this exact case - provided they can also be inlined - but I'm looking for a general solution for this class of problems).

    Read the article

  • OpenVPN (HideMyAss) client on Ubuntu: Route only HTTP traffic

    - by Andersmith
    I want to use HideMyAss VPN (hidemyass.com) on Ubuntu Linux to route only HTTP (ports 80 & 443) traffic to the HideMyAss VPN server, and leave all the other traffic (MySQL, SSH, etc.) alone. I'm running Ubuntu on AWS EC2 instances. The problem is that when I try and run the default HMA script, I suddenly can't SSH into the Ubuntu instance anymore and have to reboot it from the AWS console. I suspect the Ubuntu instance will also have trouble connecting to the RDS MySQL database, but haven't confirmed it. HMA uses OpenVPN like this: sudo openvpn client.cfg The client configuration file (client.cfg) looks like this: ############################################## # Sample client-side OpenVPN 2.0 config file # # for connecting to multi-client server. # # # # This configuration can be used by multiple # # clients, however each client should have # # its own cert and key files. # # # # On Windows, you might want to rename this # # file so it has a .ovpn extension # ############################################## # Specify that we are a client and that we # will be pulling certain config file directives # from the server. client auth-user-pass #management-query-passwords #management-hold # Disable management port for debugging port issues #management 127.0.0.1 13010 ping 5 ping-exit 30 # Use the same setting as you are using on # the server. # On most systems, the VPN will not function # unless you partially or fully disable # the firewall for the TUN/TAP interface. #;dev tap dev tun # Windows needs the TAP-Win32 adapter name # from the Network Connections panel # if you have more than one. On XP SP2, # you may need to disable the firewall # for the TAP adapter. ;dev-node MyTap # Are we connecting to a TCP or # UDP server? Use the same setting as # on the server. proto tcp ;proto udp # The hostname/IP and port of the server. # You can have multiple remote entries # to load balance between the servers. # All VPN Servers are added at the very end ;remote my-server-2 1194 # Choose a random host from the remote # list for load-balancing. Otherwise # try hosts in the order specified. # We order the hosts according to number of connections. # So no need to randomize the list # remote-random # Keep trying indefinitely to resolve the # host name of the OpenVPN server. Very useful # on machines which are not permanently connected # to the internet such as laptops. resolv-retry infinite # Most clients don't need to bind to # a specific local port number. nobind # Downgrade privileges after initialization (non-Windows only) ;user nobody ;group nobody # Try to preserve some state across restarts. persist-key persist-tun # If you are connecting through an # HTTP proxy to reach the actual OpenVPN # server, put the proxy server/IP and # port number here. See the man page # if your proxy server requires # authentication. ;http-proxy-retry # retry on connection failures ;http-proxy [proxy server] [proxy port #] # Wireless networks often produce a lot # of duplicate packets. Set this flag # to silence duplicate packet warnings. ;mute-replay-warnings # SSL/TLS parms. # See the server config file for more # description. It's best to use # a separate .crt/.key file pair # for each client. A single ca # file can be used for all clients. ca ./keys/ca.crt cert ./keys/hmauser.crt key ./keys/hmauser.key # Verify server certificate by checking # that the certicate has the nsCertType # field set to "server". This is an # important precaution to protect against # a potential attack discussed here: # http://openvpn.net/howto.html#mitm # # To use this feature, you will need to generate # your server certificates with the nsCertType # field set to "server". The build-key-server # script in the easy-rsa folder will do this. ;ns-cert-type server # If a tls-auth key is used on the server # then every client must also have the key. ;tls-auth ta.key 1 # Select a cryptographic cipher. # If the cipher option is used on the server # then you must also specify it here. ;cipher x # Enable compression on the VPN link. # Don't enable this unless it is also # enabled in the server config file. #comp-lzo # Set log file verbosity. verb 3 # Silence repeating messages ;mute 20 # Detect proxy auto matically #auto-proxy # Need this for Vista connection issue route-metric 1 # Get rid of the cached password warning #auth-nocache #show-net-up #dhcp-renew #dhcp-release #route-delay 0 120 # added to prevent MITM attack ns-cert-type server # # Remote servers added dynamically by the master server # DO NOT CHANGE below this line # remote-random remote 173.242.116.200 443 # 0 remote 38.121.77.74 443 # 0 # etc... remote 67.23.177.5 443 # 0 remote 46.19.136.130 443 # 0 remote 173.254.207.2 443 # 0 # END

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • Learning... anything really

    - by WebDevHobo
    I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

    Read the article

  • Abnormally disconnected TCP sockets and write timeout

    - by James
    Hello I will try to explain the problem in shortest possible words. I am using c++ builder 2010. I am using TIdTCPServer and sending voice packets to a list of connected clients. Everything works ok untill any client is disconnected abnormally, For example power failure etc. I can reproduce similar disconnect by cutting the ethernet connection of a connected client. So now we have a disconnected socket but as you know it is not yet detected at server side so server will continue to try to send data to that client too. But when server try to write data to that disconnected client ...... Write() or WriteLn() HANGS there in trying to write, It is like it is wating for somekind of Write timeout. This hangs the hole packet distribution process as a result creating a lag in data transmission to all other clients. After few seconds "Socket Connection Closed" Exception is raised and data flow continues. Here is the code try { EnterCriticalSection(&SlotListenersCriticalSection); for(int i=0;i<SlotListeners->Count;i++) { try { //Here the process will HANG for several seconds on a disconnected socket ((TIdContext*) SlotListeners->Objects[i])->Connection->IOHandler->WriteLn("Some DATA"); }catch(Exception &e) { SlotListeners->Delete(i); } } }__finally { LeaveCriticalSection(&SlotListenersCriticalSection); } Ok i already have a keep alive mechanism which disconnect the socket after n seconds of inactivity. But as you can imagine, still this mechnism cant sync exactly with this braodcasting loop because this braodcasting loop is running almost all the time. So is there any Write timeouts i can specify may be through iohandler or something ? I have seen many many threads about "Detecting disconnected tcp socket" but my problem is little different, i need to avoid that hangup for few seconds during the write attempt. So is there any solution ? Or should i consider using some different mechanism for such data broadcasting for example the broadcasting loop put the data packet in some kind of FIFO buffer and client threads continuously check for available data and pick and deliver it to themselves ? This way if one thread hangs it will not stop/delay the over all distribution thread. Any ideas please ? Thanks for your time and help. Regards Jams

    Read the article

  • WPF: Improving Performance for Running on Older PCs

    - by Phil Sandler
    So, I'm building a WPF app and did a test deployment today, and found that it performed pretty poorly. I was surprised, as we are really not doing much in the way of visual effects or animations. I deployed on two machines: the fastest and the slowest that will need to run the application (the slowest PC has an Intel Celeron 1.80GHz with 2GB RAM). The application ran pretty well on the faster machine, but was choppy on the slower machine. And when I say "choppy", I mean the cursor jumped even just passing it over any open window of the app that had focus. I opened the Task Manager Performance window, and could see that the CPU usage jumped whenever the app had focus and the cursor was moving over it. If I gave focus to another (e.g. Excel), the CPU usage went back down after a second. This happened on both machines, but the choppiness was only noticeable on the slower machine. I had very limited time to tinker on the deployment machines, so didn't do a lot of detailed testing. The app runs fine on my development machine, but I also see the CPU spiking up to 10% there, just running the cursor over the window. I downloaded the WPF performance tool from MS and have been tinkering with it (on my dev machine). The docs say this about the "Frame Rate" metric in the Perforator tool: For applications without animation, this value should be near 0. The app is not doing any heavy animation, but the frame rate stays near 50 when the cursor is over any window. The screens I tested on have column headers in a grid that "highlight" and buttons that change color and appearance when scrolled over. Even moving the mouse on blank areas of the windows cause the same Frame rate and CPU usage (doesn't seem to be related to these minor animations). (Also, I am unable to figure out how to get anything but the two default tools--Perforator and Visual Profiler--installed into the WPF performance tool. That is probably a separate question). I also have Redgate's profiling tool, but I'm not sure if that can shed any light on rendering performance. So, I realize this is not an easy thing to troubleshoot without specifics or sample code (which I can't post). My questions are: What are some general things to look for (or avoid) in the code to improve performance? What steps can I take using the WPF performance tool to narrow down the problem? Is the PC spec listed above (Intel Celeron 1.80GHz with 2GB RAM) too slow to be running even vanilla WPF applications?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Unable to Use Simple JSOUP Example To Parse Website Table Data

    - by OhNoItsAnOverflow
    I'm attempting to extract the following data from a table via Android / JSOUP however I'm having a bit of trouble nailing down the process. I think I'm getting close to being able to do this using the code I've provided below - but for some reason I still cannot get my textview to display any of the table data. P.S. Live URL's can be provided if necessary. SOURCE: public class MainActivity extends Activity { TextView tv; final String URL = "http://exampleurl.com"; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.activity_main); tv = (TextView) findViewById(R.id.TextView01); new MyTask().execute(URL); } private class MyTask extends AsyncTask<String, Void, String> { ProgressDialog prog; String title = ""; @Override protected void onPreExecute() { prog = new ProgressDialog(MainActivity.this); prog.setMessage("Loading...."); prog.show(); } @Override protected String doInBackground(String... params) { try { Document doc = Jsoup.connect(params[0]).get(); Element tableElement = doc.getElementsByClass("datagrid") .first(); title = doc.title(); } catch (IOException e) { e.printStackTrace(); } return title; } @Override protected void onPostExecute(String result) { super.onPostExecute(result); prog.dismiss(); tv.setText(result); } } } TABLE: <table class="datagrid"> <tbody><tr> <th>Item No.</th> <th>Name</th> <th>Sex</th> <th>Location</th> </tr> <tr> <td><a href="redirector.cfm?ID=a33660a3-aae0-45e3-9703-d59d77717836&amp;page=1&amp;&amp;lname=&amp;fname=" title="501207593">501207593&nbsp;</a></td> <td>USER1</td> <td>M&nbsp;</td> <td>Unknown</td> </tr> <tr> <td><a href="redirector.cfm?ID=edf524da-8598-450f-9373-da87db8d6c84&amp;page=1&amp;&amp;lname=&amp;fname=" title="501302750">501302750&nbsp;</a></td> <td>USER2</td> <td>M&nbsp;</td> <td>Unknown</td> </tr> <tr> <td><a href="redirector.cfm?ID=a78abeea-7651-4ac1-bba2-0dcb272c8b77&amp;page=1&amp;&amp;lname=&amp;fname=" title="531201804">531201804&nbsp;</a></td> <td>USER3</td> <td>M&nbsp;</td> <td>Unknown</td> </tr> </tbody></table>

    Read the article

  • Getting rid of "static" references in C#

    - by DevEight
    Hello. I've recently begun learning C# but have encountered an annoying problem. Every variable I want available to all functions in my program I have to put a "static" in front of and also every function. What I'd like to know is how to avoid this, if possible? Also, small side question: creating public variables inside functions? This is what my program looks like right now, and I want to basically keep it like that, without having to add "static" everywhere: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Net; using System.Threading; using System.Net.Sockets; namespace NetworkExercise { class Client { public IPAddress addr; public int port; public string name; public Thread thread; public TcpClient tcp; public NetworkStream stream; public Client(IPAddress addr, int port, string name, NetworkStream stream) { } } class Program { //NETWORK TcpListener tcpListener; Thread listenThread; ASCIIEncoding encoder = new ASCIIEncoding(); //DATA byte[] buffer = new byte[4096]; string servIp; int servPort; //CLIENT MANAGEMENT int clientNum; static void Main(string[] args) { beginConnect(); } public void beginConnect() { Console.Write("Server IP (leave blank if you're the host): "); servIp = Console.ReadLine(); Console.Write("Port: "); servPort = Console.Read(); tcpListener = new TcpListener(IPAddress.Any, servPort); listenThread = new Thread(new ThreadStart(listenForClients)); listenThread.Start(); } public void listenForClients() { tcpListener.Start(); Console.WriteLine("Listening for clients..."); while (true) { Client cl = new Client(null, servPort, null, null); cl.tcp = tcpListener.AcceptTcpClient(); ThreadStart pts = delegate { handleClientCom(cl); }; cl.thread = new Thread(pts); cl.thread.Start(); } } public void handleClientCom(Client cl) { cl.stream = cl.tcp.GetStream(); } } }

    Read the article

  • C# Serialization Surrogate - Cannot access a disposed object

    - by crushhawk
    I have an image class (VisionImage) that is a black box to me. I'm attempting to serialize the image object to file using Serialization Surrogates as explained on this page. Below is my surrogate code. sealed class VisionImageSerializationSurrogate : ISerializationSurrogate { public void GetObjectData(Object obj, SerializationInfo info, StreamingContext context) { VisionImage image = (VisionImage)obj; byte[,] temp = image.ImageToArray().U8; info.AddValue("width", image.Width); info.AddValue("height", image.Height); info.AddValue("pixelvalues", temp, temp.GetType()); } public Object SetObjectData(Object obj, SerializationInfo info, StreamingContext context, ISurrogateSelector selector) { VisionImage image = (VisionImage)obj; Int32 width = info.GetInt32("width"); Int32 height = info.GetInt32("height"); byte[,] temp = new byte[height, width]; temp = (byte[,])info.GetValue("pixelvalues", temp.GetType()); PixelValue2D tempPixels = new PixelValue2D(temp); image.ArrayToImage(tempPixels); return image; } } I've stepped through it to write to binary. It seems to be working fine (file is getting bigger as the images are captured). I tried to test it read the file back in. The values read back in are correct as far as the "info" object is concerned. When I get to the line image.ArrayToImage(tempPixels); It throws the "Cannot access a disposed object" exception. Upon further inspection, the object and the resulting image are both marked as disposed. My code behind the form spawns an "acquisitionWorker" and runs the following code. void acquisitionWorker_LoadImages(object sender, DoWorkEventArgs e) { // This is the main function of the acquisition background worker thread. // Perform image processing here instead of the UI thread to avoid a // sluggish or unresponsive UI. BackgroundWorker worker = (BackgroundWorker)sender; try { uint bufferNumber = 0; // Loop until we tell the thread to cancel or we get an error. When this // function completes the acquisitionWorker_RunWorkerCompleted method will // be called. while (!worker.CancellationPending) { VisionImage savedImage = (VisionImage) formatter.Deserialize(fs); CommonAlgorithms.Copy(savedImage, imageViewer.Image); // Update the UI by calling ReportProgress on the background worker. // This will call the acquisition_ProgressChanged method in the UI // thread, where it is safe to update UI elements. Do not update UI // elements directly in this thread as doing so could result in a // deadlock. worker.ReportProgress(0, bufferNumber); bufferNumber++; } } catch (ImaqException ex) { // If an error occurs and the background worker thread is not being // cancelled, then pass the exception along in the result so that // it can be handled in the acquisition_RunWorkerCompleted method. if (!worker.CancellationPending) e.Result = ex; } } What am I missing here? Why would the object be immediately disposed?

    Read the article

  • Jquery - Loading a page with .load and selector doesn't execute script?

    - by PirateKitten
    I'm trying to load one page into another using the .load() method. This loaded page contains a script that I want to execute when it has finished loading. I've put together a barebones example to demonstrate: Index.html: <html> <head> <title>Jquery Test</title> <script type="text/javascript" src="script/jquery-1.3.2.min.js"></script> <script type="text/javascript"> $(document).ready(function() { $('#nav a').click(function() { $('#contentHolder').load('content.html #toLoad', '', function() {}); return false; }); }); </script> </head> <body> <div id="nav"> <a href="content.html">Click me!</a> </div> <hr /> <div id="contentHolder"> Content loaded will go here </div> </body> </html> Content.html: <div id="toLoad"> This content is from content.html <div id="contentDiv"> This should fade away. </div> <script type="text/javascript"> $('#contentDiv').fadeOut('slow', function() {} ); </script> </div> When the link is clicked, the content should load and the second paragraph should fade away. However it doesn't execute. If I stick a simple alert("") in the script of content.html it doesn't execute either. However, if I do away with the #toLoad selector in the .load() call, it works fine. I am not sure why this is, as the block is clearly in the scope of the #toLoad div. I don't want to avoid using the selector, as in reality the content.html will be a full HTML page, and I'll only want a select part out of it. Any ideas? If the script from content.html was in the .load() callback, it works fine, however I obviously don't want that logic contained within index.html. I could possibly have the callback use .getScript() to load "content.html.js" afterwards and have the logic in there, that seems to work? I'd prefer to keep the script in content.html, if possible, so that it executes fine when loaded normally too. In fact, I might do this anyway, but I would like to know why the above doesn't work.

    Read the article

  • How do I 'globally' catch exceptions thrown in object instances.

    - by SleepyBobos
    I am currently writing a winforms application (C#). I am making use of the Enterprise Library Exception Handling Block, following a fairly standard approach from what I can see. IE : In the Main method of Program.cs I have wired up event handler to Application.ThreadException event etc. This approach works well and handles the applications exceptional circumstances. In one of my business objects I throw various exceptions in the Set accessor of one of the objects properties set { if (value > MaximumTrim) throw new CustomExceptions.InvalidTrimValue("The value of the minimum trim..."); if (!availableSubMasterWidthSatisfiesAllPatterns(value)) throw new CustomExceptions.InvalidTrimValue("Another message..."); _minimumTrim = value; } My logic for this approach (without turning this into a 'when to throw exceptions' discussion) is simply that the business objects are responsible for checking business rule constraints and throwing an exception that can bubble up and be caught as required. It should be noted that in the UI of my application I do explictly check the values that the public property is being set to (and take action there displaying friendly dialog etc) but with throwing the exception I am also covering the situation where my business object may not be used by a UI eg : the Property is being set by another business object for example. Anyway I think you all get the idea. My issue is that these exceptions are not being caught by the handler wired up to Application.ThreadException and I don't understand why. From other reading I have done the Application.ThreadException event and it handler "... catches any exception that occurs on the main GUI thread". Are the exceptions being raised in my business object not in this thread? I have not created any new threads. I can get the approach to work if I update the code as follows, explicity calling the event handler that is wired to Application.ThreadException. This is the approach outlined in Enterprise Library samples. However this approach requires me to wrap any exceptions thrown in a try catch, something I was trying to avoid by using a 'global' handler to start with. try { if (value > MaximumTrim) throw new CustomExceptions.InvalidTrimValue("The value of the minimum..."); if (!availableSubMasterWidthSatisfiesAllPatterns(value)) throw new CustomExceptions.InvalidTrimValue("Another message"); _minimumTrim = value; } catch (Exception ex) { Program.ThreadExceptionHandler.ProcessUnhandledException(ex); } I have also investigated using wiring a handler up to AppDomain.UnhandledException event but this does not catch the exceptions either. I would be good if someone could explain to me why my exceptions are not being caught by my global exception handler in the first code sample. Is there another approach I am missing or am I stuck with wrapping code in try catch, shown above, as required?

    Read the article

  • Adding Insert Row in tableView

    - by user333624
    Hello everyone, I have a tableView that loads its data directly from a Core Data table with a NSFetchedResultsController. I'm not using an intermediate NSMutableArray to store the objects from the fetch results; I basically implemented inside my UITableViewController the protocol method numberOfRowsInSection and it returns the numberOfObjects inside a NSFetchedResultsSectionInfo. id <NSFetchedResultsSectionInfo> sectionInfo = [[fetchedResultsController sections] objectAtIndex:section]; and then I configure the cell content by implementing configureCell:atIndexPath and retrieving object info from the fetchedResultController but right now I have a generic configuration for any object (to avoid complications) cell.textLabel.text = @"categoria"; I also have a NavigationBar with a custom edit button at the right that loads my own selector called customSetEditing. What I'm trying to accomplish is to load an "Insert Cell" at the beginning of the tableView so when I tap it, it creates a new record. This last part is easy to implement the problem is that I dont's seem to be able to load the insert row or any row when I tap on the navigation bar edit button. this is the code for my customSetEditing: - (void) customSetEditing { [super setEditing:YES animated:YES]; [self.tableView setEditing:YES animated:YES]; [[self tableView] beginUpdates]; //[[self tableView] beginUpdates]; UIBarButtonItem *customDoneButtonItem = [[UIBarButtonItem alloc] initWithBarButtonSystemItem:UIBarButtonSystemItemDone target:self action:@selector(customDone)]; [self.navigationItem.rightBarButtonItem release]; self.navigationItem.rightBarButtonItem = customDoneButtonItem; //[categoriasArray insertObject:[NSNull null] atIndex:0]; NSMutableArray *indexPaths = [[NSMutableArray alloc] initWithObjects:[NSIndexPath indexPathForRow:0 inSection:0],nil ]; [self.tableView insertRowsAtIndexPaths:indexPaths withRowAnimation:UITableViewRowAnimationTop]; //[indexPaths release]; [self.tableView reloadData];} Before adding the:[self.tableView reloadData]; I was getting an out of bounds error plus a program crash and although the program is not crashing it is not loading anything. I have seen many examples of similar situations in stackoverflow (by the way is an excellent forum with very helpful and nice people) none of the examples seems to work for me. Any ideas?

    Read the article

  • Javascript self contained sandbox events and client side stack

    - by amnon
    I'm in the process of moving a JSF heavy web application to a REST and mainly JS module application . I've watched "scalable javascript application architecture" by Nicholas Zakas on yui theater (excellent video) and implemented much of the talk with good success but i have some questions : I found the lecture a little confusing in regards to the relationship between modules and sandboxes , on one had to my understanding modules should not be effected by something happening outside of their sandbox and this is why they publish events via the sandbox (and not via the core as they do access the core for hiding base libary) but each module in the application gets a new sandbox ? , shouldn't the sandbox limit events to the modoules using it ? or should events be published cross page ? e.g. : if i have two editable tables but i want to contain each one in a different sandbox and it's events effect only the modules inside that sandbox something like messabe box per table which is a different module/widget how can i do that with sandbox per module , ofcourse i can prefix the events with the moduleid but that creates coupling that i want to avoid ... and i don't want to package modules toghter as one module per combination as i already have 6-7 modules ? while i can hide the base library for small things like id selector etc.. i would still like to use the base library for module dependencies and resource loading and use something like yui loader or dojo.require so in fact i'm hiding the base library but the modules themself are defined and loaded by the base library ... seems a little strange to me libraries don't return simple js objects but usualy wrap them e.g. : u can do something like $$('.classname').each(.. which cleans the code alot , it makes no sense to wrap the base and then in the module create a dependency for the base library by executing .each but not using those features makes a lot of code written which can be left out ... and implemnting that functionality is very bug prone does anyonen have any experience with building a front side stack of this order ? how easy is it to change a base library and/or have modules from different libraries , using yui datatable but doing form validation with dojo ... ? some what of a combination of 2+4 if u choose to do something like i said and load dojo form validation widgets for inputs via yui loader would that mean dojocore is a module and the form module is dependant on it ? Thanks .

    Read the article

  • Should I go along with my choice of web hosting company or still search?

    - by Devner
    Hi all, I have been searching for a good website hosting company that can offer me all the services that I need for hosting my PHP & MySQL based website. Now this is a community based website and users will be able to upload pictures, etc. The hosting company that I have in mind, currently lets me do everything... let me use mail(), supports CRON jobs, etc. Of course they are charging about $6/month. Now the only problem with this company is that they have a limit of 50,000 files that can exist within the hosting account at any time. This kind of contradicts their frontpage ad of "UNLIMITED SPACE" on their website. Apart from this, I know of no other reason why I should not go with this hosting company. But my issue is that 50,000 file limit is what I cannot live with, once the users increase in significant number and the files they upload, exceed 50,000 in number. Now since this is a dynamic website and also includes sensitive issues like payments, etc. I am not sure if I should go ahead with this company as I am just starting out and then later switch over to a better hosting company which does not limit me with 50,000 files. If I need to switch over once I host with this company, I will need to take backups of all the files located in my account (jpg, zip, etc.), then upload them to the new host. I am not aware of any tools that can help me in this process. Can you please mention if you know any? I can go ahead with the other companies right now, but their cost is double/triple of the current price and they all sport less features than my current choice. If I pay more, then they are ready to accommodate my higher demands. Unfortunately, the company that I am willing to go with now, does NOT have any other higher/better plans that I can switch to. So that's the really really bad part. So my question(s): Since I am starting out with my website and since the scope of users initially is going to be less/small, should I go ahead with the current choice and then once the demand increases, switch over to a better provider? If yes, how can I transfer my database, especially the jpg files, etc. to the new provider? I don't even know the tools required to backup and restore to another host. (I don't like this idea but still..) Should I go ahead and pay more right now and go with better providers (without knowing if the website is going to do really that well) just for saving myself the trouble of having to take a backup of the 50,000 files and upload to a new host from an old host and just start paying double/triple the price without even knowing if I would receive back the returns as I expected? Backup and Restore in such a bulky numbers is something that I have never done before and hence I am stuck here trying to decide what to do. The price per month is also a considerable factor in my decision. All these web hosting companies say one common thing: It is customers responsibility to backup and restore data and they are not liable for any loss. So no matter what hosting company that I would like to go with, they ask me to take backup via FTP so that I can restore them whenever I want (& it seems to be safer to have the files locally with me). Some are providing tools for backup and some are not and I am not sure how much their backup tools can be trusted considering the disclaimers they have. I have never backed-up and restored 50,000 files from one web host to another, so please, all you experienced people out there, leave your comments and let me know your suggestions so that I can decide. I have spent 2 days fighting with myself trying to decide what to do and finally concluded that this is a double-edged sword and I can't arrive at a satisfactory final decision without involving others suggestions. I believe that someone must be out there who may have had such troublesome decision to make. So all your suggestions to help me make my decision are appreciated. Thank you all.

    Read the article

  • How to perform gui operation in doInBackground method?

    - by jM2.me
    My application reads a user selected file which contains addresses and then displays on mapview when done geocoding. To avoid hanging app the importing and geocoding is done in AsyncTask. public class LoadOverlayAsync extends AsyncTask<Uri, Integer, StopsOverlay> { Context context; MapView mapView; Drawable drawable; public LoadOverlayAsync(Context con, MapView mv, Drawable dw) { context = con; mapView = mv; drawable = dw; } protected StopsOverlay doInBackground(Uri... uris) { StringBuilder text = new StringBuilder(); StopsOverlay stopsOverlay = new StopsOverlay(drawable, context); Geocoder geo = new Geocoder(context, Locale.US); try { File file = new File(new URI(uris[0].toString())); BufferedReader br = new BufferedReader(new FileReader(file)); String line; while ((line = br.readLine()) != null) { StopOverlay stopOverlay = null; String[] tempLine = line.split("~"); List<Address> results = geo.getFromLocationName(tempLine[4] + " " + tempLine[5] + " " + tempLine[7] + " " + tempLine[8], 10); if (results.size() > 0) { Toast progressToast = Toast.makeText(context, "More than one yo", 1000); progressToast.show(); } else if (results.size() == 1) { Address addr = results.get(0); GeoPoint mPoint = new GeoPoint((int)(addr.getLatitude() * 1E6), (int)(addr.getLongitude() * 1E6)); stopOverlay = new StopOverlay(mPoint, tempLine); } if (stopOverlay != null) { stopsOverlay.addOverlay(stopOverlay); } //List<Address> results = geo.getFromLocationName(locationName, maxResults) } } catch (URISyntaxException e) { showErrorToast(e.toString()); //e.printStackTrace(); } catch (FileNotFoundException e) { showErrorToast(e.toString()); //e.printStackTrace(); } catch (IOException e) { showErrorToast(e.toString()); //e.printStackTrace(); } return stopsOverlay; } protected void onProgressUpdate(Integer... progress) { Toast progressToast = Toast.makeText(context, "Loaded " + progress.toString(), 1000); progressToast.show(); } protected void onPostExecute(StopsOverlay so) { //mapView.getOverlays().add(so); Toast progressToast = Toast.makeText(context, "Done geocoding", 1000); progressToast.show(); } protected void showErrorToast(String msg) { Toast Newtoast = Toast.makeText(context, msg, 10000); Newtoast.show(); } } But if geocode fails, I want a dialog popup to let user edit the address. That would require calling on gui method while in doInBackground. What would be a good workaround this?

    Read the article

  • Advice on "Invalid Pointer Operation" when using complex records

    - by Xaz
    Env: Delphi 2007 <JustificationI tend to use complex records quite frequently as they offer almost all of the advantages of classes but with much simpler handling.</Justification Anyhoo, one particularly complex record I have just implemented is trashing memory (later leading to an "Invalid Pointer Operation" error). This is an example of the memory trashing code: sSignature := gProfiles.Profile[_stPrimary].Signature.Formatted(True); On the second time i call it i get "Invalid Pointer Operation" It works OK if i call it like this: AProfile := gProfiles.Profile[_stPrimary]; ASignature := AProfile.Signature; sSignature := ASignature.Formatted(True); Background Code: gProfiles: TProfiles; TProfiles = Record private FPrimaryProfileID: Integer; FCachedProfile: TProfile; ... public < much code removed > property Profile[ProfileType: TProfileType]: TProfile Read GetProfile; end; function TProfiles.GetProfile(ProfileType: TProfileType): TProfile; begin case ProfileType of _stPrimary : Result := ProfileByID(FPrimaryProfileID); ... end; end; function TProfiles.ProfileByID(iID: Integer): TProfile; begin <snip> if LoadProfileOfID(iID, FCachedProfile) then begin Result := FCachedProfile; end else ... end; TProfile = Record private ... public ... Signature: TSignature; ... end; TSignature = Record private public PlainTextFormat : string; HTMLFormat : string; // The text to insert into a message when using this profile function Formatted(bHTML: boolean): string; end; function TSignature.Formatted(bHTML: boolean): string; begin if bHTML then result := HTMLFormat else result := PlainTextFormat; < SNIP MUCH CODE > end; OK, so I have a record within a record within a record, which is approaching Inception level confusion and I'm the first to admit is not really a good model. Clearly i am going to have to restructure it. What I would like from you gurus is a better understanding of why it is trashing the memory (something to do with the string object that is created then freed...) so that i can avoid making these kinds of errors in future. Thanks

    Read the article

  • Java replacement for C macros

    - by thkala
    Recently I refactored the code of a 3rd party hash function from C++ to C. The process was relatively painless, with only a few changes of note. Now I want to write the same function in Java and I came upon a slight issue. In the C/C++ code there is a C preprocessor macro that takes a few integer variables names as arguments and performs a bunch of bitwise operations with their contents and a few constants. That macro is used in several different places, therefore its presence avoids a fair bit of code duplication. In Java, however, there is no equivalent for the C preprocessor. There is also no way to affect any basic type passed as an argument to a method - even autoboxing produces immutable objects. Coupled with the fact that Java methods return a single value, I can't seem to find a simple way to rewrite the macro. Avenues that I considered: Expand the macro by hand everywhere: It would work, but the code duplication could make things interesting in the long run. Write a method that returns an array: This would also work, but it would repeatedly result into code like this: long tmp[] = bitops(k, l, m, x, y, z); k = tmp[0]; l = tmp[1]; m = tmp[2]; x = tmp[3]; y = tmp[4]; z = tmp[5]; Write a method that takes an array as an argument: This would mean that all variable names would be reduced to array element references - it would be rather hard to keep track of which index corresponds to which variable. Create a separate class e.g. State with public fields of the appropriate type and use that as an argument to a method: This is my current solution. It allows the method to alter the variables, while still keeping their names. It has the disadvantage, however, that the State class will get more and more complex, as more macros and variables are added, in order to avoid copying values back and forth among different State objects. How would you rewrite such a C macro in Java? Is there a more appropriate way to deal with this, using the facilities provided by the standard Java 6 Development Kit (i.e. without 3rd party libraries or a separate preprocessor)?

    Read the article

< Previous Page | 503 504 505 506 507 508 509 510 511 512 513 514  | Next Page >