Search Results

Search found 13788 results on 552 pages for 'instance caging'.

Page 510/552 | < Previous Page | 506 507 508 509 510 511 512 513 514 515 516 517  | Next Page >

  • XML pass values to timer, AS3

    - by VideoDnd
    My timer has three variables that I can trace to the output window, but don't know how to pass them to the timer. How to I pass the XML values to my timer? Purpose I want to test with an XML document, before I try connecting it to an XML socket. myXML <?xml version="1.0" encoding="utf-8"?> <SESSION> <TIMER TITLE="speed">100</TIMER> <COUNT TITLE="starting position">-77777</COUNT> <FCOUNT TITLE="ramp">1000</FCOUNT> </SESSION> myFlash //myTimer 'instance of mytext on stage' /* fields I want to change with XML */ //CHANGE TO 100 var timer:Timer = new Timer(10); //CHANGE TO -77777 var count:int = 0; //CHANGE TO 1000 var fcount:int = 0; timer.addEventListener(TimerEvent.TIMER, incrementCounter); timer.start(); function incrementCounter(event:TimerEvent) { count++; fcount=int(count*count/1000);//starts out slow... then speeds up mytext.text = formatCount(fcount); } function formatCount(i:int):String { var fraction:int = i % 100; var whole:int = i / 100; return ("0000000" + whole).substr(-7, 7) + "." + (fraction < 10 ? "0" + fraction : fraction); } //LOAD XML var myXML:XML; var myLoader:URLLoader = new URLLoader(); myLoader.load(new URLRequest("time.xml")); myLoader.addEventListener(Event.COMPLETE, processXML); //PARSE XML function processXML(e:Event):void { myXML = new XML(e.target.data); trace(myXML.ROGUE.*); trace(myXML); //TEXT var text:TextField = new TextField(); text.text = myXML.TIMER.*; text.textColor = 0xFF0000; addChild(text); } RESOURCES OReilly's ActionScript 3.0 Cookbook, Chapter 12 Strings, Chapter 20 XML

    Read the article

  • Should I skip authorization, with CanCan, of an action that instantiates a resource?

    - by irkenInvader
    I am writing a web app to pick random lists of cards from larger, complete sets of cards. I have a Card model and a CardSet model. Both models have a full RESTful set of 7 actions (:index, :new, :show, etc). The CardSetsController has an extra action for creating random sets: :random. # app/models/card_set.rb class CardSet < ActiveRecord::Base belongs_to :creator, :class_name => "User" has_many :memberships has_many :cards, :through => :memberships # app/models/card.rb class Card < ActiveRecord::Base belongs_to :creator, :class_name => "User" has_many :memberships has_many :card_sets, :through => :memberships I have added Devise for authentication and CanCan for authorizations. I have users with an 'editor' role. Editors are allowed to create new CardSets. Guest users (Users who have not logged in) can only use the :index and :show actions. These authorizations are working as designed. Editors can currently use both the :random and the :new actions without any problems. Guest users, as expected, cannot. # app/controllers/card_sets_controller.rb class CardSetsController < ApplicationController before_filter :authenticate_user!, :except => [:show, :index] load_and_authorize_resource I want to allow guest users to use the :random action, but not the :new action. In other words, they can see new random sets, but not save them. The "Save" button on the :random action's view is hidden (as designed) from the guest users. The problem is, the first thing the :random action does is build a new instance of the CardSet model to fill out the view. When cancan tries to load_and_authorize_resource a new CardSet, it throws a CanCan::AccessDenied exception. Therefore, the view never loads and the guest user is served a "You need to sign in or sign up before continuing" message. # app/controllers/card_sets_controllers.rb def random @card_set = CardSet.new( :name => "New Set of 10", :set_type => "Set of 10" ) I realize that I can tell load_and_authorize_resource to skip the :random action by passing :except => :random to the call, but that just feels "wrong" for some reason. What's the "right" way to do this? Should I create the new random set without instantiating a new CardSet? Should I go ahead and add the exception?

    Read the article

  • Using Core Data Concurrently and Reliably

    - by John Topley
    I'm building my first iOS app, which in theory should be pretty straightforward but I'm having difficulty making it sufficiently bulletproof for me to feel confident submitting it to the App Store. Briefly, the main screen has a table view, upon selecting a row it segues to another table view that displays information relevant for the selected row in a master-detail fashion. The underlying data is retrieved as JSON data from a web service once a day and then cached in a Core Data store. The data previous to that day is deleted to stop the SQLite database file from growing indefinitely. All data persistence operations are performed using Core Data, with an NSFetchedResultsController underpinning the detail table view. The problem I am seeing is that if you switch quickly between the master and detail screens several times whilst fresh data is being retrieved, parsed and saved, the app freezes or crashes completely. There seems to be some sort of race condition, maybe due to Core Data importing data in the background whilst the main thread is trying to perform a fetch, but I'm speculating. I've had trouble capturing any meaningful crash information, usually it's a SIGSEGV deep in the Core Data stack. The table below shows the actual order of events that happen when the detail table view controller is loaded: Main Thread Background Thread viewDidLoad Get JSON data (using AFNetworking) Create child NSManagedObjectContext (MOC) Parse JSON data Insert managed objects in child MOC Save child MOC Post import completion notification Receive import completion notification Save parent MOC Perform fetch and reload table view Delete old managed objects in child MOC Save child MOC Post deletion completion notification Receive deletion completion notification Save parent MOC Once the AFNetworking completion block is triggered when the JSON data has arrived, a nested NSManagedObjectContext is created and passed to an "importer" object that parses the JSON data and saves the objects to the Core Data store. The importer executes using the new performBlock method introduced in iOS 5: NSManagedObjectContext *child = [[NSManagedObjectContext alloc] initWithConcurrencyType:NSPrivateQueueConcurrencyType]; [child setParentContext:self.managedObjectContext]; [child performBlock:^{ // Create importer instance, passing it the child MOC... }]; The importer object observes its own MOC's NSManagedObjectContextDidSaveNotification and then posts its own notification which is observed by the detail table view controller. When this notification is posted the table view controller performs a save on its own (parent) MOC. I use the same basic pattern with a "deleter" object for deleting the old data after the new data for the day has been imported. This occurs asynchronously after the new data has been fetched by the fetched results controller and the detail table view has been reloaded. One thing I am not doing is observing any merge notifications or locking any of the managed object contexts or the persistent store coordinator. Is this something I should be doing? I'm a bit unsure how to architect this all correctly so would appreciate any advice.

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • How to develop a Jquery plugin to find the first child that match with a selector?

    - by Ivan
    I'm trying to make a Jquery plugin (findFirst()) to find the first child with a given characteristics (something in the middle of the find() and children() functions. For instance, given this markup: <div id="start"> <div> <span>Hello world</span> <ul class="valid-result"> ... </ul> <ul class="valid-result"> <li> <ul class="not-a-result"> ... </ul> </li> </ul> <div> <ul class="valid-result"> ... </ul> </div> </div> </div> If you ask for $("#start").findFirst('ul') it should return all ul lists that I have tagged with the valid-result class, but not the ul with class not-a-result. It is, this function has to find the first elements that matches with a given selector, but not the inner elements that match this selector. This is the first time I try to code a Jquery function, and what I've already read doesn't helps me too much with this. The function I have developed is this: jQuery.fn.findFirst = function (sel) { return this.map(function() { return $(this).children().map(function() { if ($(this).is(sel)) { return $(this); } else { return $(this).findFirst(sel); } }); }); } It works in the sense it tries to return the expected result, but the format it returns the result is very rare for me. I suppose the problem is something I don't understand about Jquery. Here you have the JFiddle where I'm testing. EDIT The expected result after $("#start").findFirst('ul') is a set with all UL that have the class 'valid-result' BUT it's not possible to use this class because it doesn't exist in a real case (it's just to try to explain the result). This is not equivalent to first(), because first returns only one element!

    Read the article

  • WndProc(ref Message m), Prevent minimize Games, Send key strokes.

    - by Stanomatic
    Overview: I am going to create a touch application that interfaces with games and other apps. This concept is similar to the app found on touch-buddy.com but I will be using C# and WPF instead of how the application is written in Perl. I have a few challenges I would like to evaluate. The touch-buddy app uses two approaches while interacting with games; 1. Client mode (Same machine runs both game and touch-buddy). 2. Server / Client mode where a separate box sends commands to the game machine. The reason I believe for this method was to circumvent the issue with games minimizing. In Client only mode I am faced with the issue where I touch a screen OTHER than the main screen where the game is viewed and then the game minimizes. Not all games have this behavior but I would like to conquer the games that do minimize and prevent it. Is it possible to keep a game front and center Focused and prevent minimizing utilizing C# WndProc(ref Message m)? I have been experimenting with WndProc(ref Message m) where I created a win form and when I press minimize on my own Win form and it will close an instance of notepad. This proves to me that I can capture a message, prevent that message from bubbling up and then send a message to another application. I then tried to click on notepad with my touch screen and keep my win form application in focus and not minimize. At this point I am unsuccessful. I need more time understanding message codes. Is this the right approach? Can it be done? Should I look at other libraries such as Windows Automation? Key input is my other concern. What is the best way to send key strokes to other apps/games. Should I tap into DirectX, use some kind of send key, Automation Framework? Can any of these handle the multiple key strokes that some simulation games require? I appreciate any links and or insight you may have. If you have gone down this path for any reason I would love to hear your comments. Stan

    Read the article

  • jquery event namespace bubbling issue

    - by Adrian Adkison
    Hi, I stumbled upon an issue with event namespacing while developing a jQuery plugin. here is the html <div class="parent"> <div class="child"> </div> </div> <a class="btn-a">trigger a</a> <a class="btn-b">trigger b</a> <a class="btn-c">trigger c</a> Here is the jQuery jQuery('#content div.child') .bind('child.a',function(){alert('a-child');}) .bind('child.b',function(){alert('b-child');}) .bind('child.c',function(){alert('c-child');}); jQuery('#content div.parent') .bind('child.b',function(){alert('b-parent');}) .bind('child.c',function(){alert('c-parent');}); jQuery('a.btn-a') .click(function(){ jQuery('#content div.child').trigger('a.a'); }); jQuery('a.btn-b') .click(function(){ jQuery('#content div.child').trigger('a.b'); }); jQuery('a.btn-c') .click(function(){ jQuery('#content div.child').trigger('a.c'); }); In sum, I have attached a namespaced event listener to the child and parent and created three buttons that trigger each of the events(a.a, a.b, a.c). Note the parent is only listening to a.b and a.c. When I click on the button that triggers a.a on the child, only the div.child listener for a.a is fired, but the entire 'a' namespace event bubbles up to div.parent listeners, a.b and a.c, and triggers them. My question is, how would I still use event namespacing but only have the intended event bubble up(i.e. a.a is the only event that fires for both child and parent). I am aware of stopPropagation and stopImmediatePropagation. I would not want to put these on the child a.b and a.c listeners because there are times when i do want them to bubble. For instance when I trigger 'a.b' on the child, I would expect the 'a.b' and only the 'a.b' event to be handled by the child and the parent. Thanks

    Read the article

  • Voicexml how to store input into a global variable

    - by Tyzak
    Hello, I'm creating a voicexml appliacation. I want to store an user input into a global variable. I wondered, the input should be stored in the fieldvar. shouldn't it? After I tried it with this, i tried to store it in an global variable: <assign name="myvar" expr="'myinput'"/> but somehow it didn't work. I used value expr="var" as expr. <?xml version="1.0" encoding="UTF-8"?> <vxml xmlns="http://www.w3.org/2001/vxml" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.w3.org/2001/vxml http://www.w3.org/TR/voicexml20/vxml.xsd" version="2.0"> <var name="myProdukt" /> <form id="test"> <field name="var"> <prompt bargein="true" bargeintype="hotword" >Sagen Sie ein Produkt</prompt> <grammar root="main" version="1.0" xml:lang="de-DE"> <rule id="main" scope="public"> <one-of> <item> p1 </item> <item> p2 </item> <item> p3 </item> <item> p4 </item> </one-of> </rule> </grammar> <filled> <assign name="myProdukt" expr="<value expr="var"/>"/> </filled> </field> </form> <<!--[...] Here i want to use the input.--> </vxml> thanks in advance

    Read the article

  • Is Abstract Factory Pattern implemented correctly for given scenario.... ???

    - by Amit
    First thing... I am novice to pattern world, so correct me if wrong anywhere Scenario: There are multiple companies providing multiple products of diff size so there are 3 entities i.e. Companies, Their Product and size of product I have implement Abstract Pattern on this i.e. so that I will create instance of IProductFactory interface to get desired product... Is below implementation of Abstract Factory Pattern correct ??? If not then please correct the approach + Also tell me if any other pattern can be used for such scenario Thanks in advance... public enum Companies { Samsung = 0, LG = 1, Philips = 2, Sony = 3 } public enum Product { PlasmaTv = 0, DVD = 1 } public enum ProductSize { FortyTwoInch, FiftyFiveInch } interface IProductFactory { IPhilips GetPhilipsProduct(); ISony GetSonyProduct(); } interface ISony { string CreateProducts(Product product, ProductSize size); } interface IPhilips { string CreateProducts(Product product, ProductSize size); } class ProductFactory : IProductFactory { public IPhilips GetPhilipsProduct() { return new Philips(); } public ISony GetSonyProduct() { return new Sony(); } } class Philips : IPhilips { #region IPhilips Members public string CreateProducts(Product product, ProductSize size) {// I have ingnore size for now.... string output = string.Empty; if (product == Product.PlasmaTv) { output = "Plasma TV Created !!!"; } else if (product == Product.DVD) { output = "DVD Created !!!"; } return output; } #endregion } class Sony : ISony {// I have ingnore size for now.... #region ISony Members public string CreateProducts(Product product, ProductSize size) { string output = string.Empty; if (product == Product.PlasmaTv) { output = "Plasma TV Created !!!"; } else if (product == Product.DVD) { output = "DVD Created !!!"; } return output; } #endregion } IProductFactory prodFactory = new ProductFactory(); IPhilips philipsObj = prodFactory.GetPhilipsProduct(); MessageBox.Show(philipsObj.CreateProducts(Product.DVD, ProductSize.FortyTwoInch)); or //ISony sonyObj = prodFactory.GetSonyProduct(); //MessageBox.Show(sonyObj.CreateProducts(Product.DVD, ProductSize.FortyTwoInch));

    Read the article

  • Java - is this an idiom or pattern, behavior classes with no state

    - by Berlin Brown
    I am trying to incorporate more functional programming idioms into my java development. One pattern that I like the most and avoids side effects is building classes that have behavior but they don't necessarily have any state. The behavior is locked into the methods but they only act on the parameters passed in. The code below is code I am trying to avoid: public class BadObject { private Map<String, String> data = new HashMap<String, String>(); public BadObject() { data.put("data", "data"); } /** * Act on the data class. But this is bad because we can't * rely on the integrity of the object's state. */ public void execute() { data.get("data").toString(); } } The code below is nothing special but I am acting on the parameters and state is contained within that class. We still may run into issues with this class but that is an issue with the method and the state of the data, we can address issues in the routine as opposed to not trusting the entire object. Is this some form of idiom? Is this similar to any pattern that you use? public class SemiStatefulOOP { /** * Private class implies that I can access the members of the <code>Data</code> class * within the <code>SemiStatefulOOP</code> class and I can also access * the getData method from some other class. * * @see Test1 * */ class Data { protected int counter = 0; public int getData() { return counter; } public String toString() { return Integer.toString(counter); } } /** * Act on the data class. */ public void execute(final Data data) { data.counter++; } /** * Act on the data class. */ public void updateStateWithCallToService(final Data data) { data.counter++; } /** * Similar to CLOS (Common Lisp Object System) make instance. */ public Data makeInstance() { return new Data(); } } // End of Class // Issues with the code above: I wanted to declare the Data class private, but then I can't really reference it outside of the class: I can't override the SemiStateful class and access the private members. Usage: final SemiStatefulOOP someObject = new SemiStatefulOOP(); final SemiStatefulOOP.Data data = someObject.makeInstance(); someObject.execute(data); someObject.updateStateWithCallToService(data);

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Why are static classes considered “classes” and “reference types”?

    - by Timwi
    I’ve been pondering about the C# and CIL type system today and I’ve started to wonder why static classes are considered classes. There are many ways in which they are not really classes: A “normal” class can contain non-static members, a static class can’t. In this respect, a class is more similar to a struct than it is to a static class, and yet structs have a separate name. You can have a reference to an instance of a “normal” class, but not a static class (despite it being considered a “reference type”). In this respect, a class is more similar to an interface than it is to a static class, and yet interfaces have a separate name. The name of a static class can never be used in any place where a type name would normally fit: you can’t declare a variable of this type, you can’t use it as a base type, and you can’t use it as a generic type parameter. In this respect, static classes are somewhat more like namespaces. A “normal” class can implement interfaces. Once again, that makes classes more similar to structs than to static classes. A “normal” class can inherit from another class. It is also bizarre that static classes are considered to derive from System.Object. Although this allows them to “inherit” the static methods Equals and ReferenceEquals, the purpose of that inheritance is questionable as you would call those methods on object anyway. C# even allows you to specify that useless inheritance explicitly on static classes, but not on interfaces or structs, where the implicit derivation from object and System.ValueType, respectively, actually has a purpose. Regarding the subset-of-features argument: Static classes have a subset of the features of classes, but they also have a subset of the features of structs. All of the things that make a class distinct from the other kinds of type, do not seem to apply to static classes. Regarding the typeof argument: Making a static class into a new and different kind of type does not preclude it from being used in typeof. Given the sheer oddity of static classes, and the scarcity of similarities between them and “normal” classes, shouldn’t they have been made into a separate kind of type instead of a special kind of class?

    Read the article

  • How do I check for the existence of an external file with XSL?

    - by LOlliffe
    I've found a lot of examples that reference Java and C for this, but how do I, or can I, check for the existence of an external file with XSL. First, I realize that this is only a snippet, but it's part of a huge stylesheet, so I'm hoping it's enough to show my issue. <!-- Use this template for Received SMSs --> <xsl:template name="ReceivedSMS"> <!-- Set/Declare "SMSname" variable (local, evaluates per instance) --> <xsl:variable name="SMSname"> <xsl:value-of select=" following-sibling::Name"/> </xsl:variable> <fo:table font-family="Arial Unicode MS" font-size="8pt" text-align="start"> <fo:table-column column-width=".75in"/> <fo:table-column column-width="6.75in"/> <fo:table-body> <fo:table-row> <!-- Cell contains "speakers" icon --> <fo:table-cell display-align="after"> <fo:block text-align="start"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> What I'd like to do, is put in an "if" statement, surronding the {$SMSname}.jpg line. That is: <fo:block text-align="start"> <xsl:if test="exists( the external file {$SMSname}.jpg)"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> </xsl:if> <xsl:if test="not(exists( the external file {$SMSname}.jpg))"> <fo:external-graphic src="../images/unknown.jpg" content-height="0.6in"/> </xsl:if> </fo:block> Because of "grouping", etc., I'm using XSLT 2.0. I hope that this is something that can be done. I hope even more that it's something simple. As always, thanks in advance for any help. LO

    Read the article

  • How to dispose off custom object from within custom membership provider

    - by IrfanRaza
    I have created my custom MembershipProvider. I have used an instance of the class DBConnect within this provider to handle database functions. Please look at the code below: public class SGIMembershipProvider : MembershipProvider { #region "[ Property Variables ]" private int newPasswordLength = 8; private string connectionString; private string applicationName; private bool enablePasswordReset; private bool enablePasswordRetrieval; private bool requiresQuestionAndAnswer; private bool requiresUniqueEmail; private int maxInvalidPasswordAttempts; private int passwordAttemptWindow; private MembershipPasswordFormat passwordFormat; private int minRequiredNonAlphanumericCharacters; private int minRequiredPasswordLength; private string passwordStrengthRegularExpression; private MachineKeySection machineKey; **private DBConnect dbConn;** #endregion ....... public override bool ChangePassword(string username, string oldPassword, string newPassword) { if (!ValidateUser(username, oldPassword)) return false; ValidatePasswordEventArgs args = new ValidatePasswordEventArgs(username, newPassword, true); OnValidatingPassword(args); if (args.Cancel) { if (args.FailureInformation != null) { throw args.FailureInformation; } else { throw new Exception("Change password canceled due to new password validation failure."); } } SqlParameter[] p = new SqlParameter[3]; p[0] = new SqlParameter("@applicationName", applicationName); p[1] = new SqlParameter("@username", username); p[2] = new SqlParameter("@password", EncodePassword(newPassword)); bool retval = **dbConn.ExecuteSP("User_ChangePassword", p);** return retval; } //ChangePassword public override void Initialize(string name, NameValueCollection config) { if (config == null) { throw new ArgumentNullException("config"); } ...... ConnectionStringSettings ConnectionStringSettings = ConfigurationManager.ConnectionStrings[config["connectionStringName"]]; if ((ConnectionStringSettings == null) || (ConnectionStringSettings.ConnectionString.Trim() == String.Empty)) { throw new ProviderException("Connection string cannot be blank."); } connectionString = ConnectionStringSettings.ConnectionString; **dbConn = new DBConnect(connectionString); dbConn.ConnectToDB();** ...... } //Initialize ...... } // SGIMembershipProvider I have instantiated dbConn object within Initialize() event. My problem is that how could i dispose off this object when object of SGIMembershipProvider is disposed off. I know the GC will do this all for me, but I need to explicitly dispose off that object. Even I tried to override Finalize() but there is no such overridable method. I have also tried to create destructor for SGIMembershipProvider. Can anyone provide me solution.

    Read the article

  • How to cache queries in EJB and return result efficient (performance POV)

    - by Maxym
    I use JBoss EJB 3.0 implementation (JBoss 4.2.3 server) At the beginning I created native query all the time using construction like Query query = entityManager.createNativeQuery("select * from _table_"); Of couse it is not that efficient, I performed some tests and found out that it really takes a lot of time... Then I found a better way to deal with it, to use annotation to define native queries: @NamedNativeQuery( name = "fetchData", value = "select * from _table_", resultClass=Entity.class ) and then just use it Query query = entityManager.createNamedQuery("fetchData"); the performance of code line above is two times better than where I started from, but still not that good as I expected... then I found that I can switch to Hibernate annotation for NamedNativeQuery (anyway, JBoss's implementation of EJB is based on Hibernate), and add one more thing: @NamedNativeQuery( name = "fetchData2", value = "select * from _table_", resultClass=Entity.class, readOnly=true) readOnly - marks whether the results are fetched in read-only mode or not. It sounds good, because at least in this case of mine I don't need to update data, I wanna just fetch it for report. When I started server to measure performance I noticed that query without readOnly=true (by default it is false) returns result with each iteration better and better, and at the same time another one (fetchData2) works like "stable" and with time difference between them is shorter and shorter, and after 5 iterations speed of both was almost the same... The questions are: 1) is there any other way to speed query using up? Seems that named queries should be prepared once, but I can't say it... In fact if to create query once and then just use it it would be better from performance point of view, but it is problematic to cache this object, because after creating query I can set parameters (when I use ":variable" in query), and it changes query object (isn't it?). well, is here any way to cache them? Or named query is the best option I can use? 2) any other approaches how to make results retrieveng faster. I mean, for instance I don't need those Entities to be attached, I won't update them, all I need is just fetch collection of data. Maybe readOnly is the only available way, so I can't speed it up, but who knows :) P.S. I don't ask about DB performance, all I need now is how not to create query all the time, so use it efficient, and to "allow" EJB to do less job with the same result concerning data returning.

    Read the article

  • Will this ever result in a stack overflow error?

    - by David
    Will incrementing the instance variables of an object ever lead to a stack overflow error? For example: This method (java) will cause a stack overflow error: class StackOverflow { public static void StackOverflow (int x) { System.out.println (x) ; StackOverflow(x+1) ; } public static void main (String[]arg) { StackOverflow (0) ; } but will this?: (..... is a gap that i've put in to shorten the code. its long enough as it is.) import java.util.*; class Dice { String name ; int x ; int[] sum ; .... public Dice (String name) { this.name = name ; this.x = 0 ; this.sum = new int[7] ; } .... public static void main (String[] arg) { Dice a1 = new Dice ("a1") ; for (int i = 0; i<6000000; i++) { a1.roll () ; printDice(a1) ; } } .... public void roll () { this.x = randNum(1, this.sum.length) ; this.sum[x] ++ ; } public static int randNum (int a, int b) { Random random = new Random() ; int c = (b-a) ; int randomNumber = ((random.nextInt(c)) + a) ; return randomNumber ; } public static void printDice (Dice Dice) { System.out.println (Dice.name) ; System.out.println ("value: "+Dice.x) ; printValues (Dice) ; } public static void printValues (Dice Dice) { for (int i = 0; i<Dice.sum.length; i++) System.out.println ("#of "+i+"'s: "+Dice.sum[i]) ; } } The above doesn't currently cause a stack overflow error but could i get it too if i changed this line in main: for (int i = 0; i<6000000; i++) so that instead of 6 million something sufficiently high were there?

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • Several client waiting for the same event

    - by ff8mania
    I'm developing a communication API to be used by a lot of generic clients to communicate with a proprietary system. This proprietary system exposes an API, and I use a particular classes to send and wait messages from this system: obviously the system alert me that a message is ready using an event. The event is named OnMessageArrived. My idea is to expose a simple SendSyncMessage(message) method that helps the user/client to simply send a message and the method returns the response. The client: using ( Communicator c = new Communicator() ) { response = c.SendSync(message); } The communicator class is done in this way: public class Communicator : IDisposable { // Proprietary system object ExternalSystem c; String currentRespone; Guid currentGUID; private readonly ManualResetEvent _manualResetEvent; private ManualResetEvent _manualResetEvent2; String systemName = "system"; String ServerName = "server"; public Communicator() { _manualResetEvent = new ManualResetEvent(false); //This methods are from the proprietary system API c = SystemInstance.CreateInstance(); c.Connect(systemName , ServerName); } private void ConnectionStarter( object data ) { c.OnMessageArrivedEvent += c_OnMessageArrivedEvent; _manualResetEvent.WaitOne(); c.OnMessageArrivedEvent-= c_OnMessageArrivedEvent; } public String SendSync( String Message ) { Thread _internalThread = new Thread(ConnectionStarter); _internalThread.Start(c); _manualResetEvent2 = new ManualResetEvent(false); String toRet; int messageID; currentGUID = Guid.NewGuid(); c.SendMessage(Message, "Request", currentGUID.ToString()); _manualResetEvent2.WaitOne(); toRet = currentRespone; return toRet; } void c_OnMessageArrivedEvent( int Id, string root, string guid, int TimeOut, out int ReturnCode ) { if ( !guid.Equals(currentGUID.ToString()) ) { _manualResetEvent2.Set(); ReturnCode = 0; return; } object newMessage; c.FetchMessage(Id, 7, out newMessage); currentRespone = newMessage.ToString(); ReturnCode = 0; _manualResetEvent2.Set(); } } I'm really noob in using waithandle, but my idea was to create an instance that sends the message and waits for an event. As soon as the event arrived, checks if the message is the one I expect (checking the unique guid), otherwise continues to wait for the next event. This because could be (and usually is in this way) a lot of clients working concurrently, and I want them to work parallel. As I implemented my stuff, at the moment if I run client 1, client 2 and client 3, client 2 starts sending message as soon as client 1 has finished, and client 3 as client 2 has finished: not what I'm trying to do. Can you help me to fix my code and get my target? Thanks!

    Read the article

  • Why are these two sql statements deadlocking? (Deadlock graph + details included).

    - by Pure.Krome
    Hi folks, I've got the following deadlock graph that describes two sql statements that are deadlocking each other. I'm just not sure how to analyse this and then fix up my sql code to prevent this from happening. Main deadlock graph Click here for a bigger image. Left side, details Click here for a bigger image. Right side, details Click here for a bigger image. What is the code doing? I'm reading in a number of files (eg. lets say 3, for this example). Each file contains different data BUT the same type of data. I then insert data into LogEntries table and then (if required) I insert or delete something from the ConnectedClients table. Here's my sql code. using (TransactionScope transactionScope = new TransactionScope()) { _logEntryRepository.InsertOrUpdate(logEntry); // Now, if this log entry was a NewConnection or an LostConnection, then we need to make sure we update the ConnectedClients. if (logEntry.EventType == EventType.NewConnection) { _connectedClientRepository.Insert(new ConnectedClient { LogEntryId = logEntry.LogEntryId }); } // A (PB) BanKick does _NOT_ register a lost connection .. so we need to make sure we handle those scenario's as a LostConnection. if (logEntry.EventType == EventType.LostConnection || logEntry.EventType == EventType.BanKick) { _connectedClientRepository.Delete(logEntry.ClientName, logEntry.ClientIpAndPort); } _unitOfWork.Commit(); transactionScope.Complete(); } Now each file has it's own UnitOfWork instance (which means it has it's own database connection, transaction and repository context). So i'm assuming this means there's 3 different connections to the db all happening at the same time. Finally, this is using Entity Framework as the repository, but please don't let that stop you from having a think about this problem. Using a profiling tool, the Isolation Level is Serializable. I've also tried ReadCommited and ReadUncommited, but they both error :- ReadCommited: same as above. Deadlock. ReadUncommited: different error. EF exception that says it expected some result back, but got nothing. I'm guessing this is the LogEntryId Identity (scope_identity) value that is expected but not retrieve because of the dirty read. Please help! PS. It's Sql Server 2008, btw.

    Read the article

  • How change Castor mapping to remove "xmlns:xsi" and "xsi:type" attributes from element in XML output

    - by Derek Mahar
    How do I change the Castor mapping <?xml version="1.0"?> <!DOCTYPE mapping PUBLIC "-//EXOLAB/Castor Mapping DTD Version 1.0//EN" "http://castor.org/mapping.dtd"> <mapping> <class name="java.util.ArrayList" auto-complete="true"> <map-to xml="ArrayList" /> </class> <class name="com.db.spgit.abstrack.ws.response.UserResponse"> <map-to xml="UserResponse" /> <field name="id" type="java.lang.String"> <bind-xml name="id" node="element" /> </field> <field name="deleted" type="boolean"> <bind-xml name="deleted" node="element" /> </field> <field name="name" type="java.lang.String"> <bind-xml name="name" node="element" /> </field> <field name="typeId" type="java.lang.Integer"> <bind-xml name="typeId" node="element" /> </field> <field name="regionId" type="java.lang.Integer"> <bind-xml name="regionId" node="element" /> </field> <field name="regionName" type="java.lang.String"> <bind-xml name="regionName" node="element" /> </field> </class> </mapping> to suppress the xmlns:xsi and xsi:type attributes in the element of the XML output? For example, instead of the output XML <?xml version="1.0" encoding="UTF-8"?> <ArrayList> <UserResponse xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:type="UserResponse"> <name>Tester</name> <typeId>1</typeId> <regionId>2</regionId> <regionName>US</regionName> </UserResponse> </ArrayList> I'd prefer <?xml version="1.0" encoding="UTF-8"?> <ArrayList> <UserResponse> <name>Tester</name> <typeId>1</typeId> <regionId>2</regionId> <regionName>US</regionName> </UserResponse> </ArrayList> such that the element name implies the xsi:type.

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • Is there a reason why a base class decorated with XmlInclude would still throw a type unknown exception when serialized?

    - by Tedford
    I will simplify the code to save space but what is presented does illustrate the core problem. I have a class which has a property that is a base type. There exist 3 dervived classes which could be assigned to that property. If I assign any of the derived classes to the container then the XmlSerializer throws dreaded "The type xxx was not expected. Use the XmlInclude or SoapInclude attribute to specify types that are not known statically." exception when attempting to seralize the container. However my base class is already decorated with that attribute so I figure there must be an additional "hidden" requirement. The really odd part is that the default WCF serializer has no issues with this class hierarchy. The Container class [DataContract] [XmlRoot(ElementName = "TRANSACTION", Namespace = Constants.Namespace)] public class PaymentSummaryRequest : CommandRequest { /// <summary> /// Gets or sets the summary. /// </summary> /// <value>The summary.</value> /// <remarks></remarks> [DataMember] public PaymentSummary Summary { get; set; } /// <summary> /// Initializes a new instance of the <see cref="PaymentSummaryRequest"/> class. /// </summary> public PaymentSummaryRequest() { Mechanism = CommandMechanism.PaymentSummary; } } The base class [DataContract] [XmlInclude(typeof(xxxPaymentSummary))] [XmlInclude(typeof(yyyPaymentSummary))] [XmlInclude(typeof(zzzPaymentSummary))] [KnownType(typeof(xxxPaymentSummary))] [KnownType(typeof(xxxPaymentSummary))] [KnownType(typeof(zzzPaymentSummary))] public abstract class PaymentSummary { } One of the derived classes [DataContract] public class xxxPaymentSummary : PaymentSummary { } The serialization code var serializer = new XmlSerializer(typeof(PaymentSummaryRequest)); serializer.Serialize(Console.Out,new PaymentSummaryRequest{Summary = new xxxPaymentSummary{}}); The Exception System.InvalidOperationException: There was an error generating the XML document. --- System.InvalidOperationException: The type xxxPaymentSummary was not expected. Use the XmlInclude or SoapInclude attribute to specify types that are not known statically. at Microsoft.Xml.Serialization.GeneratedAssembly.XmlSerializationWriterPaymentSummaryRequest.Write13_PaymentSummary(String n, String ns, PaymentSummary o, Boolean isNullable, Boolean needType) at Microsoft.Xml.Serialization.GeneratedAssembly.XmlSerializationWriterPaymentSummaryRequest.Write14_PaymentSummaryRequest(String n, String ns, PaymentSummaryRequest o, Boolean isNullable, Boolean needType) at Microsoft.Xml.Serialization.GeneratedAssembly.XmlSerializationWriterPaymentSummaryRequest.Write15_TRANSACTION(Object o) --- End of inner exception stack trace --- at System.Xml.Serialization.XmlSerializer.Serialize(XmlWriter xmlWriter, Object o, XmlSerializerNamespaces namespaces, String encodingStyle, String id) at System.Xml.Serialization.XmlSerializer.Serialize(TextWriter textWriter, Object o, XmlSerializerNamespaces namespaces) at UserQuery.RunUserAuthoredQuery() in c:\Users\Tedford\AppData\Local\Temp\uqacncyo.0.cs:line 47

    Read the article

  • Linux configurations that would affect Java memory usage?

    - by wmacura
    Hi, Background: I have a set of java background workers I start as part of my webapp. I develop locally on Ubuntu 10.10 and deploy to an Ubuntu 10.04LTS server (a media temple (ve) instance). They're both running the same JVM: Sun JVM 1.6.0_22-b04. As part of the initialization script each worker is started with explicit Xmx, Xms, and XX:MaxPermGen settings. Yet somehow locally all 10 workers use 250MB, while on the server they use more than 2.7GB. I don't know how to begin to track this down. I thought the Ubuntu (and thus, kernel) version might make a difference, but I tried an old 10.04 VM and it behaves as expected. I've noticed that the machine does not seem to ever use memory for buffer or cache (according to htop), which seems a bit strange, but perhaps normal for a server? (edited) Some info: (server) root@devel:/app/axir/target# uname -a Linux devel 2.6.18-028stab069.5 #1 SMP Tue May 18 17:26:16 MSD 2010 x86_64 GNU/Linux (local) wiktor@beastie:~$ uname -a Linux beastie 2.6.35-25-generic #44-Ubuntu SMP Fri Jan 21 17:40:44 UTC 2011 x86_64 GNU/Linux (edited) Comparing PS output: (ps -eo "ppid,pid,cmd,rss,sz,vsz") PPID PID CMD RSS SZ VSZ (local) 1588 1615 java -cp axir-distribution. 25484 234382 937528 1615 1631 java -cp /home/wiktor/Code/ 83472 163059 652236 1615 1657 java -cp /home/wiktor/Code/ 70624 89135 356540 1615 1658 java -cp /home/wiktor/Code/ 37652 77625 310500 1615 1669 java -cp /home/wiktor/Code/ 38096 77733 310932 1615 1675 java -cp /home/wiktor/Code/ 37420 61395 245580 1615 1684 java -cp /home/wiktor/Code/ 38000 77736 310944 1615 1703 java -cp /home/wiktor/Code/ 39180 78060 312240 1615 1712 java -cp /home/wiktor/Code/ 38488 93882 375528 1615 1719 java -cp /home/wiktor/Code/ 38312 77874 311496 1615 1726 java -cp /home/wiktor/Code/ 38656 77958 311832 1615 1727 java -cp /home/wiktor/Code/ 78016 89429 357716 (server) 22522 23560 java -cp axir-distribution. 24860 285196 1140784 23560 23585 java -cp /app/axir/target/a 100764 161629 646516 23560 23667 java -cp /app/axir/target/a 72408 92682 370728 23560 23670 java -cp /app/axir/target/a 39948 97671 390684 23560 23674 java -cp /app/axir/target/a 40140 81586 326344 23560 23739 java -cp /app/axir/target/a 39688 81542 326168 They look very similar. In fact, the question now is why, if I add up the virtual memory usage on the server (3.2GB) does it more closely reflect 2.4GB of memory used (according to free), yet locally the virtual memory used adds up to a much more substantial 4.7GB but only actually uses ~250MB. It seems that perhaps memory isn't being shared as aggressively. (if that's even possible) Thank you for your help, Wiktor

    Read the article

  • What is GC holes?

    - by tianyi
    I wrote a long TCP connection socket server in C#. Spike in memory in my server happens. I used dotNet Memory Profiler(a tool) to detect where the memory leaks. Memory Profiler indicates the private heap is huge, and the memory is something like below(the number is not real,what I want to show is the GC0 and GC2's Holes are very very huge, the data size is normal): Managed heaps - 1,500,000KB Normal heap - 1400,000KB Generation #0 - 600,000KB Data - 100,000KB "Holes" - 500,000KB Generation #1 - xxKB Data - 0KB "Holes" - xKB Generation #2 - xxxxxxxxxxxxxKB Data - 100,000KB "Holes" - 700,000KB Large heap - 131072KB Large heap - 83KB Overhead/unused - 130989KB Overhead - 0KB Howerver, what is GC hole? I read an article about the hole: http://kaushalp.blogspot.com/2007/04/what-is-gc-hole-and-how-to-create-gc.html The author said : The code snippet below is the simplest way to introduce a GC hole into the system. //OBJECTREF is a typedef for Object*. { PointerTable *pTBL = o_pObjectClass->GetPointerTable(); OBJECTREF aObj = AllocateObjectMemory(pTBL); OBJECTREF bObj = AllocateObjectMemory(pTBL); //WRONG!!! “aObj” may point to garbage if the second //“AllocateObjectMemory” triggered a GC. DoSomething (aOb, bObj); } All it does is allocate two managed objects, and then does something with them both. This code compiles fine, and if you run simple pre-checkin tests, it will probably “work.” But this code will crash eventually. Why? If the second call to “AllocateObjectMemory” triggers a GC, that GC discards the object instance you just assigned to “aObj”. This code, like all C++ code inside the CLR, is compiled by a non-managed compiler and the GC cannot know that “aObj” holds a root reference to an object you want kept live. ======================================================================== I can't understand what he explained. Does the sample mean aObj becomes a wild pointer after GC? Is it mean { aObj = (*aObj)malloc(sizeof(object)); free(aObj); function(aObj);? } ? I hope somebody can explain it.

    Read the article

  • How do you unit test the real world?

    - by Kim Sun-wu
    I'm primarily a C++ coder, and thus far, have managed without really writing tests for all of my code. I've decided this is a Bad Idea(tm), after adding new features that subtly broke old features, or, depending on how you wish to look at it, introduced some new "features" of their own. But, unit testing seems to be an extremely brittle mechanism. You can test for something in "perfect" conditions, but you don't get to see how your code performs when stuff breaks. A for instance is a crawler, let's say it crawls a few specific sites, for data X. Do you simply save sample pages, test against those, and hope that the sites never change? This would work fine as regression tests, but, what sort of tests would you write to constantly check those sites live and let you know when the application isn't doing it's job because the site changed something, that now causes your application to crash? Wouldn't you want your test suite to monitor the intent of the code? The above example is a bit contrived, and something I haven't run into (in case you haven't guessed). Let me pick something I have, though. How do you test an application will do its job in the face of a degraded network stack? That is, say you have a moderate amount of packet loss, for one reason or the other, and you have a function DoSomethingOverTheNetwork() which is supposed to degrade gracefully when the stack isn't performing as it's supposed to; but does it? The developer tests it personally by purposely setting up a gateway that drops packets to simulate a bad network when he first writes it. A few months later, someone checks in some code that modifies something subtly, so the degradation isn't detected in time, or, the application doesn't even recognize the degradation, this is never caught, because you can't run real world tests like this using unit tests, can you? Further, how about file corruption? Let's say you're storing a list of servers in a file, and the checksum looks okay, but the data isn't really. You want the code to handle that, you write some code that you think does that. How do you test that it does exactly that for the life of the application? Can you? Hence, brittleness. Unit tests seem to test the code only in perfect conditions(and this is promoted, with mock objects and such), not what they'll face in the wild. Don't get me wrong, I think unit tests are great, but a test suite composed only of them seems to be a smart way to introduce subtle bugs in your code while feeling overconfident about it's reliability. How do I address the above situations? If unit tests aren't the answer, what is? Thanks!

    Read the article

< Previous Page | 506 507 508 509 510 511 512 513 514 515 516 517  | Next Page >