Search Results

Search found 14311 results on 573 pages for 'stan note'.

Page 511/573 | < Previous Page | 507 508 509 510 511 512 513 514 515 516 517 518  | Next Page >

  • How does Sentry aggregate errors?

    - by Hugo Rodger-Brown
    I am using Sentry (in a django project), and I'd like to know how I can get the errors to aggregate properly. I am logging certain user actions as errors, so there is no underlying system exception, and am using the culprit attribute to set a friendly error name. The message is templated, and contains a common message ("User 'x' was unable to perform action because 'y'"), but is never exactly the same (different users, different conditions). Sentry clearly uses some set of attributes under the hood to determine whether to aggregate errors as the same exception, but despite having looked through the code, I can't work out how. Can anyone short-cut my having to dig further into the code and tell me what properties I need to set in order to manage aggregation as I would like? [UPDATE 1: event grouping] This line appears in sentry.models.Group: class Group(MessageBase): """ Aggregated message which summarizes a set of Events. """ ... class Meta: unique_together = (('project', 'logger', 'culprit', 'checksum'),) ... Which makes sense - project, logger and culprit I am setting at the moment - the problem is checksum. I will investigate further, however 'checksum' suggests that binary equivalence, which is never going to work - it must be possible to group instances of the same exception, with differenct attributes? [UPDATE 2: event checksums] The event checksum comes from the sentry.manager.get_checksum_from_event method: def get_checksum_from_event(event): for interface in event.interfaces.itervalues(): result = interface.get_hash() if result: hash = hashlib.md5() for r in result: hash.update(to_string(r)) return hash.hexdigest() return hashlib.md5(to_string(event.message)).hexdigest() Next stop - where do the event interfaces come from? [UPDATE 3: event interfaces] I have worked out that interfaces refer to the standard mechanism for describing data passed into sentry events, and that I am using the standard sentry.interfaces.Message and sentry.interfaces.User interfaces. Both of these will contain different data depending on the exception instance - and so a checksum will never match. Is there any way that I can exclude these from the checksum calculation? (Or at least the User interface value, as that has to be different - the Message interface value I could standardise.) [UPDATE 4: solution] Here are the two get_hash functions for the Message and User interfaces respectively: # sentry.interfaces.Message def get_hash(self): return [self.message] # sentry.interfaces.User def get_hash(self): return [] Looking at these two, only the Message.get_hash interface will return a value that is picked up by the get_checksum_for_event method, and so this is the one that will be returned (hashed etc.) The net effect of this is that the the checksum is evaluated on the message alone - which in theory means that I can standardise the message and keep the user definition unique. I've answered my own question here, but hopefully my investigation is of use to others having the same problem. (As an aside, I've also submitted a pull request against the Sentry documentation as part of this ;-)) (Note to anyone using / extending Sentry with custom interfaces - if you want to avoid your interface being use to group exceptions, return an empty list.)

    Read the article

  • Using mcrypt to pass data across a webservice is failing

    - by adam
    Hi I'm writing an error handler script which encrypts the error data (file, line, error, message etc) and passes the serialized array as a POST variable (using curl) to a script which then logs the error in a central db. I've tested my encrypt/decrypt functions in a single file and the data is encrypted and decrypted fine: define('KEY', 'abc'); define('CYPHER', 'blowfish'); define('MODE', 'cfb'); function encrypt($data) { $td = mcrypt_module_open(CYPHER, '', MODE, ''); $iv = mcrypt_create_iv(mcrypt_enc_get_iv_size($td), MCRYPT_RAND); mcrypt_generic_init($td, KEY, $iv); $crypttext = mcrypt_generic($td, $data); mcrypt_generic_deinit($td); return $iv.$crypttext; } function decrypt($data) { $td = mcrypt_module_open(CYPHER, '', MODE, ''); $ivsize = mcrypt_enc_get_iv_size($td); $iv = substr($data, 0, $ivsize); $data = substr($data, $ivsize); if ($iv) { mcrypt_generic_init($td, KEY, $iv); $data = mdecrypt_generic($td, $data); } return $data; } echo "<pre>"; $data = md5(''); echo "Data: $data\n"; $e = encrypt($data); echo "Encrypted: $e\n"; $d = decrypt($e); echo "Decrypted: $d\n"; Output: Data: d41d8cd98f00b204e9800998ecf8427e Encrypted: ê÷#¯KžViiÖŠŒÆÜ,ÑFÕUW£´Œt?†÷>c×åóéè+„N Decrypted: d41d8cd98f00b204e9800998ecf8427e The problem is, when I put the encrypt function in my transmit file (tx.php) and the decrypt in my recieve file (rx.php), the data is not fully decrypted (both files have the same set of constants for key, cypher and mode). Data before passing: a:4:{s:3:"err";i:1024;s:3:"msg";s:4:"Oops";s:4:"file";s:46:"/Applications/MAMP/htdocs/projects/txrx/tx.php";s:4:"line";i:80;} Data decrypted: Mª4:{s:3:"err";i:1024@7OYªç`^;g";s:4:"Oops";s:4:"file";sôÔ8F•Ópplications/MAMP/htdocs/projects/txrx/tx.php";s:4:"line";i:80;} Note the random characters in the middle. My curl is fairly simple: $ch = curl_init($url); curl_setopt($ch, CURLOPT_POST, true); curl_setopt($ch, CURLOPT_POSTFIELDS, 'data=' . $data); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); $output = curl_exec($ch); Things I suspect could be causing this: Encoding of the curl request Something to do with mcrypt padding missing bytes I've been staring at it too long and have missed something really really obvious If I turn off the crypt functions (so the transfer tx-rx is unencrypted) the data is received fine. Any and all help much appreciated! Thanks, Adam

    Read the article

  • Best practices regarding equals: to overload or not to overload?

    - by polygenelubricants
    Consider the following snippet: import java.util.*; public class EqualsOverload { public static void main(String[] args) { class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } public boolean equals(Thing other) { return this.x == other.x; } } List<Thing> myThings = Arrays.asList(new Thing(42)); System.out.println(myThings.contains(new Thing(42))); // prints "false" } } Note that contains returns false!!! We seems to have lost our things!! The bug, of course, is the fact that we've accidentally overloaded, instead of overridden, Object.equals(Object). If we had written class Thing as follows instead, then contains returns true as expected. class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } @Override public boolean equals(Object o) { return (o instanceof Thing) && (this.x == ((Thing) o).x); } } Effective Java 2nd Edition, Item 36: Consistently use the Override annotation, uses essentially the same argument to recommend that @Override should be used consistently. This advice is good, of course, for if we had tried to declare @Override equals(Thing other) in the first snippet, our friendly little compiler would immediately point out our silly little mistake, since it's an overload, not an override. What the book doesn't specifically cover, however, is whether overloading equals is a good idea to begin with. Essentially, there are 3 situations: Overload only, no override -- ALMOST CERTAINLY WRONG! This is essentially the first snippet above Override only (no overload) -- one way to fix This is essentially the second snippet above Overload and override combo -- another way to fix The 3rd situation is illustrated by the following snippet: class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } public boolean equals(Thing other) { return this.x == other.x; } @Override public boolean equals(Object o) { return (o instanceof Thing) && (this.equals((Thing) o)); } } Here, even though we now have 2 equals method, there is still one equality logic, and it's located in the overload. The @Override simply delegates to the overload. So the questions are: What are the pros and cons of "override only" vs "overload & override combo"? Is there a justification for overloading equals, or is this almost certainly a bad practice?

    Read the article

  • Google Docs iphone library error reporting

    - by phil harris
    I'm in the process of adding a Google Docs interface to my iPhone app, and I'm largely following the example in the GoogleDocs.m file from Tom Saxton's example app. The objective-c library I'm using is from http://code.google.com/p/gdata-objectivec-client/wiki/GDataObjCIntroduction The library file used is from gdata-objectivec-client-1.10.0.zip. This service:username:password method is a slight variant of the one found in the Saxton file GoogleDocs.m starting at line 351: - (void)service:(NSString *)username password:(NSString *)password { if(service == nil) { service = [[[GDataServiceGoogleDocs alloc] init] autorelease]; [service setUserAgent:s_strUserAgent]; [service setShouldCacheDatedData:NO]; [service setServiceShouldFollowNextLinks:NO]; (void)[service authenticateWithDelegate:self didAuthenticateSelector:@selector(ticket:authenticatedWithError:)]; } // update the username/password each time the service is requested if (username != nil && [username length] && password != nil && [password length]) [service setUserCredentialsWithUsername:username password:password]; else [service setUserCredentialsWithUsername:nil password:nil]; } // associated callback for service:username:password: method - (void)ticket:(GDataServiceTicket *)ticket authenticatedWithError:(NSError *)error { NSLog(@"%@",@"authenticatedWithError called"); if(error == nil) [self selectBackupRestore]; else { NSLog(@"error code(%d)", [error code]); NSLog(@"error domain(%d)", [error domain]); NSLog(@"localizedDescription(%@)", error.localizedDescription); NSLog(@"localizedFailureReason(%@)", error.localizedFailureReason); NSLog(@"localizedRecoveryOptions(%@)", error.localizedRecoveryOptions); NSLog(@"localizedRecoverySuggestion(%@)", error.localizedRecoverySuggestion); } } Please note the service:username:password method and the callback compile and run fine. The problem is that the callback is passing a non-nil NSError object. I added an NSLog() for every error reporting attribute of NSError and the (Xcode) log output of a test run is below. [Session started at 2010-05-27 12:27:16 -0700.] 2010-05-27 12:27:38.778 iFilebox[74596:207] authenticatedWithError called 2010-05-27 12:27:38.779 iFilebox[74596:207] error code(-1) 2010-05-27 12:27:38.780 iFilebox[74596:207] error domain(499324) 2010-05-27 12:27:38.781 iFilebox[74596:207] localizedDescription(Operation could not be completed. (com.google.GDataServiceDomain error -1.)) 2010-05-27 12:27:38.782 iFilebox[74596:207] localizedFailureReason((null)) 2010-05-27 12:27:38.782 iFilebox[74596:207] localizedRecoveryOptions((null)) 2010-05-27 12:27:38.783 iFilebox[74596:207] localizedRecoverySuggestion((null)) My essential question is in the error reporting. I was hoping the localizedDescription would be more specific of the error. All I get for the error code value is -1, and the only description of the error is "Operation could not be completed. (com.google.GDataServiceDomain error -1.". Not very helpful. Does anyone know what a GDataServiceDomain error -1 is? Where can I find a full list of all error codes returned, and a description of what they mean?

    Read the article

  • Loop through children and display each, as3

    - by VideoDnd
    How do I loop through all of my children, and display each? I would like to know the best way to do this. my children and containerfive children, one plays every sec, 1,2,3, etc. var square1:Square1 = new Square1; var square2:Square2 = new Square2; var square3:Square3 = new Square3; var square4:Square4 = new Square4; var square5:Square5 = new Square5; var container:Sprite = new Sprite; addChild(container); container.addChild(square1) container.addChild(square2) container.addChild(square3) container.addChild(square4) container.addChild(square5) my timer var timly:Timer = new Timer(1000, 5); timly.start(); timly.addEventListener(TimerEvent.TIMER, onLoop); Note: Tried for loop, numChildren -1, and visibility ERROR 'access of undefined property' //Thomas's idea var timly:Timer = new Timer(1000, 10); timly.start(); timly.addEventListener(TimerEvent.TIMER, onLoop, false, 0, true); // var square1:Square1 = new Square1; square1.visible = false container.addChild(square2) var square2:Square2 = new Square2; square2.visible = false container.addChild(square3) var square3:Square3 = new Square3; square3.visible = false container.addChild(square3) var square4:Square4 = new Square4; square4.visible = false container.addChild(square4) var square5:Square5 = new Square5; square5.visible = false container.addChild(square5) var container:Sprite = new Sprite; this.addChild(container); var curCount:Number = 100; // function collectChildren(container:DisplayObjectContainer):Array { var len:int = container.numChildren; var mySquaresArray:Array = []; for (var i:int = 0; i < len; i++) { mySquaresArray.push(container.getChildAt(i).name); } return mySquaresArray; } // function onLoop( e:Event ) { curCount = e.target.currentCount; if( curCount > 1 ) { var previous_square = curCount -2; mySquaresArray[previous_square].visible = false; } var current_square = curCount - 1; mySquaresArray[current_square].visible = true; }

    Read the article

  • Is this a legitimate implementation of a 'remember me' function for my web app?

    - by user246114
    Hi, I'm trying to add a "remember me" feature to my web app to let a user stay logged in between browser restarts. I think I got the bulk of it. I'm using google app engine for the backend which lets me use java servlets. Here is some pseudo-code to demo: public class MyServlet { public void handleRequest() { if (getThreadLocalRequest().getSession().getAttribute("user") != null) { // User already has session running for them. } else { // No session, but check if they chose 'remember me' during // their initial login, if so we can have them 'auto log in' // now. Cookie[] cookies = getThreadLocalRequest().getCookies(); if (cookies.find("rememberMePlz").exists()) { // The value of this cookie is the cookie id, which is a // unique string that is in no way based upon the user's // name/email/id, and is hard to randomly generate. String cookieid = cookies.find("rememberMePlz").value(); // Get the user object associated with this cookie id from // the data store, would probably be a two-step process like: // // select * from cookies where cookieid = 'cookieid'; // select * from users where userid = 'userid fetched from above select'; User user = DataStore.getUserByCookieId(cookieid); if (user != null) { // Start session for them. getThreadLocalRequest().getSession() .setAttribute("user", user); } else { // Either couldn't find a matching cookie with the // supplied id, or maybe we expired the cookie on // our side or blocked it. } } } } } // On first login, if user wanted us to remember them, we'd generate // an instance of this object for them in the data store. We send the // cookieid value down to the client and they persist it on their side // in the "rememberMePlz" cookie. public class CookieLong { private String mCookieId; private String mUserId; private long mExpirationDate; } Alright, this all makes sense. The only frightening thing is what happens if someone finds out the value of the cookie? A malicious individual could set that cookie in their browser and access my site, and essentially be logged in as the user associated with it! On the same note, I guess this is why the cookie ids must be difficult to randomly generate, because a malicious user doesn't have to steal someone's cookie - they could just randomly assign cookie values and start logging in as whichever user happens to be associated with that cookie, if any, right? Scary stuff, I feel like I should at least include the username in the client cookie such that when it presents itself to the server, I won't auto-login unless the username+cookieid match in the DataStore. Any comments would be great, I'm new to this and trying to figure out a best practice. I'm not writing a site which contains any sensitive personal information, but I'd like to minimize any potential for abuse all the same, Thanks

    Read the article

  • Advice/suggestions for my first project PHP Classes

    - by Philip
    Hi guys, Any advice is welcome! I have a very limited understanding of php classes but below is my starting point for the route I would like to take. The code is a reflection of what I see in my head and how I would like to go about business. Does my code even look ok, or am I way off base? What are your thoughts, how would you go about achieving such a task as form-validate-insertquery-sendmail-return messages and errors? Please try and keep your answers simple enough for me to digest as for me its about understanding whats going on and not just a copy/paste job. Kindest regards, Phil. Note: This is a base structure only, no complete code added. <?php //======================================= //class.logging.php //======================================== class logging { public $data = array(); public $errors = array(); function __construct() { array_pop($_POST); $this->data =($this->_logging)? is_isset(filterStr($_POST) : ''; foreach($this->data as $key=> $value) { $this->data[$key] = $value; } //print_r($this->data); de-bugging } public function is_isset($str) { if(isset($str)) ? true: false; } public function filterStr($str) { return preg_match(do somthing, $str); } public function validate_post() { try { if(!is_numeric($data['cardID'])) ? throw new Exception('CardID must be numeric!') : continue; } catch (Exception $e) { return $errors = $e->getCode(); } } public function showErrors() { foreach($errors as $error => $err) { print('<div class="notok"></div><br />'); } } public function insertQ() { $query = ""; } } //======================================= //Usercp.php //======================================== if(isset($_GET['mode'])) { $mode = $_GET['mode']; } else { $mode = 'usercp'; } switch($mode) { case 'usercp': echo 'Welcome to the User Control Panel'; break; case 'logging': require_once 'class.logging.php'; $logger = new logging(); if(isset($_POST['submit']) { if($logger->validate_post === true) { $logger->insertQ(); require_once '/scripts/PHPMailer/class.phpmailer.php'; $mailer = new PHPMailer(); $mailer->PHPMailer(); } else { echo ''.$logger->showErrors.''; } } else { echo ' <form action="'.$_SERVER['PHP_SELF'].'?mode=logging" method="post"> </form> '; } break; case 'user_logout': // do somthing break; case 'user_settings': // do somthing break; ?>

    Read the article

  • XSLT: How to remove the self-closed elment

    - by Daoming Yang
    I have a large xml file which contents a lot of self-closed tags. How could remove all them by using XSLT. eg. <?xml version="1.0" encoding="utf-8" ?> <Persons> <Person> <Name>user1</Name> <Tel /> <Mobile>123</Mobile> </Person> <Person> <Name>user2</Name> <Tel>456</Tel> <Mobile /> </Person> <Person> <Name /> <Tel>123</Tel> <Mobile /> </Person> <Person> <Name>user4</Name> <Tel /> <Mobile /> </Person> </Persons> I'm expecting the result: <?xml version="1.0" encoding="utf-8" ?> <Persons> <Person> <Name>user1</Name> <Mobile>123</Mobile> </Person> <Person> <Name>user2</Name> <Tel>456</Tel> </Person> <Person> <Tel>123</Tel> </Person> <Person> <Name>user4</Name> </Person> </Persons> Note: there are thousands of different elements, how can I programmatically remove all the self-closed tags. Another question is how to remove the empty element such as <name></name> as well. Can anyone help me on this? Many thanks.

    Read the article

  • ASP.NET MVC 4/Web API Single Page App for Mobile Devices ... Needs Authentication

    - by lmttag
    We have developed an ASP.NET MVC 4/Web API single page, mobile website (also using jQuery Mobile) that is intended to be accessed only from mobile devices (e.g., iPads, iPhones, Android tables and phones, etc.), not desktop browsers. This mobile website will be hosted internally, like an intranet site. However, since we’re accessing it from mobile devices, we can’t use Windows authentication. We still need to know which user (and their role) is logging in to the mobile website app. We tried simply using ASP.NET’s forms authentication and membership provider, but couldn’t get it working exactly the way we wanted. What we need is for the user to be prompted for a user name and password only on the first time they access the site on their mobile device. After they enter a correct user name and password and have been authenticated once, each subsequent time they access the site they should just go right in. They shouldn’t have to re-enter their credentials (i.e., something needs to be saved locally to each device to identify the user after the first time). This is where we had troubles. Everything worked as expected the first time. That is, the user was prompted to enter a user name and password, and, after doing that, was authenticated and allowed into the site. The problem is every time after the browser was closed on the mobile device, the device and user were not know and the user had to re-enter user name and password. We tried lots of things too. We tried setting persistent cookies in JavaScript. No good. The cookies weren’t there to be read the second time. We tried manually setting persistent cookies from ASP.NET. No good. We, of course, used FormsAuthentication.SetAuthCookie(model.UserName, true); as part of the form authentication framework. No good. We tried using HTML5 local storage. No good. No matter what we tried, if the user was on a mobile device, they would have to log in every single time. (Note: we’ve tried on an iPad and iPhone running both iOS 5.1 and 6.0, with Safari configure to allow cookies, and we’ve tried on Android 2.3.4.) Is there some trick to getting a scenario like this working? Or, do we have to write some sort of custom authentication mechanism? If so, how? And, what? Or, should we use something like claims-based authentication and WIF? Or??? Any help is appreciated. Thanks!

    Read the article

  • help Implementing Object Oriented ansi-C approach??

    - by No Money
    Hey there, I am an Intermediate programmer in Java and know some of the basics in C++. I recently started to scam over "C language" [please note that i emphasized on C language and want to stick with C as i found it to be a perfect tool, so no need for suggestions focusing on why should i move back to C++ or Java]. Moving on, I code an Object Oriented approach in C but kindda scramble with the pointers part. Please understand that I am just a noob trying to extend my knowledge beyond what i learned in High School. Here is my code..... #include <stdio.h> typedef struct per{ int privateint; char *privateString; struct per (*New) (); void (*deleteperOBJ) (struct t_person *); void (*setperNumber) ((struct*) t_person,int); void (*setperString) ((struct*) t_person,char *); void (*dumpperState) ((struct*) t_person); }t_person; void setperNumber(t_person *const per,int num){ if(per==NULL) return; per->privateint=num; } void setperString(t_person *const per,char *string){ if(per==NULL) return; per->privateString=string; } void dumpperState(t_person *const per){ if(per==NULL) return; printf("value of private int==%d\n", per->privateint); printf("value of private string==%s\n", per->privateString); } void deleteperOBJ(struct t_person *const per){ free((void*)t_person->per); t_person ->per = NULL; } main(){ t_person *const per = (struct*) malloc(sizeof(t_person)); per = t_person -> struct per -> New(); per -> setperNumber (t_person *per, 123); per -> setperString(t_person *per, "No money"); dumpperState(t_person *per); deleteperOBJ(t_person *per); } Just to warn you, this program has several errors and since I am a beginner I couldn't help except to post this thread as a question. I am looking forward for assistance. Thanks in advance.

    Read the article

  • PHP - Cannot modify header information...

    - by Scott W.
    Hi, I am going crazy with this error: Cannot modify header information - headers already sent by... Please note that I know about the gazillion results on google and on stack overflow. My problem is the way I've constructed my pages. To keep html separate from php, I use include files. So, for example, my pages look something like this: <?php require_once('web.config.php'); ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Login</title> <link rel="shortcut icon" href="images/favicon.gif"/> <link rel="shortcut icon" href="images/favicon.ico"/> <link rel="stylesheet" type="text/css" href="<?php echo SITE_STYLE; ?>"/> </head> <body> <div id="page_effect" style="display:none;"> <?php require_once('./controls/login/login.control.php'); ?> </div> </body> </html> So, by the time my php file is included, the header is already sent. Part of the include file looks like this: // redirect to destination if($user_redirect != 'default') { $destination_url = $row['DestinationUrl']; header('Location:'.$user_redirect); } elseif($user_redirect == 'default' && isset($_GET['ReturnURL'])) { $destination_url = $_GET['ReturnURL']; header('Location:'.$destination_url); } else { header('Location:'.SITE_URL.'login.php'); } But I can't figure out how to work around this. I can't have the header redirect before the output so having output buffering on is the only thing I can do. Naturally it works fine that way - but having to rely on that just stinks. It would be nice if PHP had an alternative way to redirect or had additional parameters to tell it to clear the buffer.

    Read the article

  • Windows Question: RunOnce/Second Boot Issues [closed]

    - by Greg
    Moved to Super User: Windows Question: RunOnce/Second Boot Issues I am attempting to create a Windows XP SP3 image that will run my application on Second Boot. Here is the intended workflow. 1) Run Image Prep Utility (I wrote) on windows to add my runonce entries and clean a few things up. 2) Reboot to ghost, make image file. 3) Package into my ISO and distribute. 4) System will be imaged by user. 5) On first boot, I have about 5 things that run, one of which includes a driver updater (I wrote) for my own specific devices. 6) One of the entries inside of HKCU/../runonce is a reg file, which adds another key to HKLM/../runonce. This is how second boot is acquired. 7) As a result of the driver updater, user is prompted to reboot. 8) My application is then launched from HKLM/../runonce on second boot. This workflow works perfectly, except for a select few legacy systems that contain devices that cause the add hardware wizard to pop up. When the add hardware wizard pops up is when I begin to see problems. It's important to note, that if I manually inspect the registry after the add hardware wizard pops up, it appears as I would expect, with all the first boot scripts having run, and it's sitting in a state I would correctly expect it to be in for a second boot scenario. The problem comes when I click next on the add hardware wizard, it seems to re-run the single entry I've added, and re-executes the runonce scripts. (only one script now as it's already executed and cleared out the initial entries). This causes my application to open as if it were a second boot, only when next is clicked on the add hardware wizard. If I click cancel, and reboot, then it also works as expected. I don't care as much about other solutions, because I could design a system that doesn't fully rely on Microsoft's registry. I simply can't find any information as to WHY this is happening. I believe this is some type of Microsoft issue that's presenting itself as a result of an overstretched image that's expected to support too many legacy platforms, but any help that can be provided would be appreciated. Thanks,

    Read the article

  • How to find the one Label in DataList that is set to True

    - by Doug
    In my .aspx page I have my DataList: <asp:DataList ID="DataList1" runat="server" DataKeyField="ProductSID" DataSourceID="SqlDataSource1" onitemcreated="DataList1_ItemCreated" RepeatColumns="3" RepeatDirection="Horizontal" Width="1112px"> <ItemTemplate> ProductSID: <asp:Label ID="ProductSIDLabel" runat="server" Text='<%# Eval("ProductSID") %>' /> <br /> ProductSKU: <asp:Label ID="ProductSKULabel" runat="server" Text='<%# Eval("ProductSKU") %>' /> <br /> ProductImage1: <asp:Label ID="ProductImage1Label" runat="server" Text='<%# Eval("ProductImage1") %>' /> <br /> ShowLive: <asp:Label ID="ShowLiveLabel" runat="server" Text='<%# Eval("ShowLive") %>' /> <br /> CollectionTypeID: <asp:Label ID="CollectionTypeIDLabel" runat="server" Text='<%# Eval("CollectionTypeID") %>' /> <br /> CollectionHomePage: <asp:Label ID="CollectionHomePageLabel" runat="server" Text='<%# Eval("CollectionHomePage") %>' /> <br /> <br /> </ItemTemplate> </asp:DataList> And in my code behind using the ItemCreated event to find and set the label.backcolor property. (Note:I'm using a recursive findControl class) protected void DataList1_ItemCreated(object sender, DataListItemEventArgs e) { foreach (DataListItem item in DataList1.Items) { if (e.Item.ItemType == ListItemType.Item || e.Item.ItemType == ListItemType.AlternatingItem) { Label itemLabel = form1.FindControlR("CollectionHomePageLabel") as Label; if (itemLabel !=null || itemLabel.Text == "True") { itemLabel.BackColor = System.Drawing.Color.Yellow; } } When I run the page, the itemLabel is found, and the color shows. But it sets the itemLabel color to the first instance of the itemLabel found in the DataList. Of all the itemLabels in the DataList, only one will have it's text = True - and that should be the label picking up the backcolor. Also: The itemLabel is picking up a column in the DB called "CollectionHomePage" which is True/False bit data type. I must be missing something simple... Thanks for your ideas.

    Read the article

  • Calling cdecl Functions That Have Different Number of Arguments

    - by KlaxSmashing
    I have functions that I wish to call based on some input. Each function has different number of arguments. In other words, if (strcmp(str, "funcA") == 0) funcA(a, b, c); else if (strcmp(str, "funcB") == 0) funcB(d); else if (strcmp(str, "funcC") == 0) funcC(f, g); This is a bit bulky and hard to maintain. Ideally, these are variadic functions (e.g., printf-style) and can use varargs. But they are not. So exploiting the cdecl calling convention, I am stuffing the stack via a struct full of parameters. I'm wondering if there's a better way to do it. Note that this is strictly for in-house (e.g., simple tools, unit tests, etc.) and will not be used for any production code that might be subjected to malicious attacks. Example: #include <stdio.h> typedef struct __params { unsigned char* a; unsigned char* b; unsigned char* c; } params; int funcA(int a, int b) { printf("a = %d, b = %d\n", a, b); return a; } int funcB(int a, int b, const char* c) { printf("a = %d, b = %d, c = %s\n", a, b, c); return b; } int funcC(int* a) { printf("a = %d\n", *a); *a *= 2; return 0; } typedef int (*f)(params); int main(int argc, char**argv) { int val; int tmp; params myParams; f myFuncA = (f)funcA; f myFuncB = (f)funcB; f myFuncC = (f)funcC; myParams.a = (unsigned char*)100; myParams.b = (unsigned char*)200; val = myFuncA(myParams); printf("val = %d\n", val); myParams.c = (unsigned char*)"This is a test"; val = myFuncB(myParams); printf("val = %d\n", val); tmp = 300; myParams.a = (unsigned char*)&tmp; val = myFuncC(myParams); printf("a = %d, val = %d\n", tmp, val); return 0; } Output: gcc -o func func.c ./func a = 100, b = 200 val = 100 a = 100, b = 200, c = This is a test val = 200 a = 300 a = 600, val = 0

    Read the article

  • What is fastest way to convert bool to byte?

    - by Amir Rezaei
    What is fastest way to convert bool to byte? I want this mapping: False=0, True=1 Note: I don't want to use any if statement. Update: I don't want to use conditional statement. I don't want the CPU to halt or guess next statement. I want to optimize this code: private static string ByteArrayToHex(byte[] barray) { char[] c = new char[barray.Length * 2]; byte k; for (int i = 0; i < barray.Length; ++i) { k = ((byte)(barray[i] >> 4)); c[i * 2] = (char)(k > 9 ? k + 0x37 : k + 0x30); k = ((byte)(barray[i] & 0xF)); c[i * 2 + 1] = (char)(k > 9 ? k + 0x37 : k + 0x30); } return new string(c); } Update: The length of the array is very large, it's in terabyte order! Therefore I need to do optimization if possible. I shouldn't need to explain my self. The question is still valid. Update: I'm working on a project and looking at others code. That's why I didn't provide with the function at first place. I didn't want to spend time on explaining for people when they have opinion about the code. I shouldn’y need to provide in my question the background of my work, and a function that is not written by me. I have started to optimize it part by part. If I needed help with the whole function I would asked that in another question. That is why I asked this very simple at the beginning. Unfortunately people couldn’t keep themselves to the question. So please if you want to help answer the question. Update: For dose who want to see the point of this question. This example shows how two if statement are reduced from the code. byte A = k > 9 ; //If it was possible (k>9) == 0 || 1 c[i * 2] = A * (k + 0x30) - (A - 1) * (k + 0x30);

    Read the article

  • Android library to get pitch from WAV file

    - by Sakura
    I have a list of sampled data from the WAV file. I would like to pass in these values into a library and get the frequency of the music played in the WAV file. For now, I will have 1 frequency in the WAV file and I would like to find a library that is compatible with Android. I understand that I need to use FFT to get the frequency domain. Is there any good libraries for that? I found that [KissFFT][1] is quite popular but I am not very sure how compatible it is on Android. Is there an easier and good library that can perform the task I want? EDIT: I tried to use JTransforms to get the FFT of the WAV file but always failed at getting the correct frequency of the file. Currently, the WAV file contains sine curve of 440Hz, music note A4. However, I got the result as 441. Then I tried to get the frequency of G4, I got the result as 882Hz which is incorrect. The frequency of G4 is supposed to be 783Hz. Could it be due to not enough samples? If yes, how much samples should I take? //DFT DoubleFFT_1D fft = new DoubleFFT_1D(numOfFrames); double max_fftval = -1; int max_i = -1; double[] fftData = new double[numOfFrames * 2]; for (int i = 0; i < numOfFrames; i++) { // copying audio data to the fft data buffer, imaginary part is 0 fftData[2 * i] = buffer[i]; fftData[2 * i + 1] = 0; } fft.complexForward(fftData); for (int i = 0; i < fftData.length; i += 2) { // complex numbers -> vectors, so we compute the length of the vector, which is sqrt(realpart^2+imaginarypart^2) double vlen = Math.sqrt((fftData[i] * fftData[i]) + (fftData[i + 1] * fftData[i + 1])); //fd.append(Double.toString(vlen)); // fd.append(","); if (max_fftval < vlen) { // if this length is bigger than our stored biggest length max_fftval = vlen; max_i = i; } } //double dominantFreq = ((double)max_i / fftData.length) * sampleRate; double dominantFreq = (max_i/2.0) * sampleRate / numOfFrames; fd.append(Double.toString(dominantFreq)); Can someone help me out? EDIT2: I manage to fix the problem mentioned above by increasing the number of samples to 100000, however, sometimes I am getting the overtones as the frequency. Any idea how to fix it? Should I use Harmonic Product Frequency or Autocorrelation algorithms?

    Read the article

  • PHP, MySQL - My own version of SALT (I call salty) - Login Issue

    - by Fabio Anselmo
    Ok I wrote my own version of SALT I call it salty lol don't make fun of me.. Anyway the registration part of my script as follows is working 100% correctly. //generate SALTY my own version of SALT and I likes me salt.. lol function rand_string( $length ) { $chars = "ABCDEFGHIJKLMNOPQRSTUWXYZabcdefghijklmnopqrstuwxyz1234567890"; $size = strlen( $chars ); for( $i = 0; $i < $length; $i++ ) { $str .= $chars[ rand( 0, $size - 1 ) ]; } return $str; } $salty = rand_string( 256 ); //generate my extra salty pw $password = crypt('password'); $hash = $password . $salty; $newpass = $hash; //insert the data in the database include ('../../scripts/dbconnect.php'); //Update db record with my salty pw ;) // TESTED WITH AND WITHOUT SALTY //HENCE $password and $newpass mysql_query("UPDATE `Register` SET `Password` = '$password' WHERE `emailinput` = '$email'"); mysql_close($connect); However my LOGIN script is failing. I have it setup to TEST and echo if its login or not. It always returns FAILED. I entered the DB and changed the crypted salty pw to "TEST" and I got a SUCCESS. So my problem is somewhere in this LOGIN script I assume. Now I am not sure how to implement my $Salty in this. But also be advised that even without SALTY (just using crypt to store my pass) - I was still unable to perform a login successfully. And if you're gonna suggest i use blowfish - note that my webhost doesn't have it supported and i don't know how to install it. here's my login script: if (isset($_POST['formsubmitted'])) { include ('../../scripts/dbconnect.php'); $username = mysql_real_escape_string($_POST['username']); $password = crypt(mysql_real_escape_string($_POST['password'])); $qry = "SELECT ID FROM Register WHERE emailinput='$username' AND Password='$password'"; $result = mysql_query($qry); if(mysql_num_rows($result) > 0) { echo 'SUCCESS'; //START SESSION } else { echo 'FAILED'; //YOU ARE NOT LOGGED IN } } So what's wrong with this login? Why isn't it working just using the crypt/storing only crypt? How can i make it work storing both the crypt and randomly generated SALTY :) ? Ty advance

    Read the article

  • Opening Macro definitions: tdfx_span.c: lvalue required as left operand of assignment

    - by anttir
    Hi, I'm trying to compile X11R6-7.0 under Ubuntu maverick and got some weird compilation errors I'm unable to resolve myself. I needed X11R6-7.0 as ati catalyst drivers don't support newer xorg and oss drivers don't support 3d acceleration of my hardware. Anyone know what this error message means? I know some C but I got a bit confused. Does it mean GET_FB_DATA macro returned NULL or some method/property not set? Any further insight how to "debug" preprocessor definitions at this point would be great. I don't think I can print anything useful with #error. The error I get: tdfx_span.c: In function ‘tdfxDDWriteDepthPixels’: tdfx_span.c:976: error: lvalue required as left operand of assignment tdfx_span.c:1008: error: lvalue required as left operand of assignment tdfx_span.c: In function ‘write_stencil_pixels’: tdfx_span.c:1242: error: lvalue required as left operand of assignment the Code: 958- switch (depth_size) { 959- case 16: 960- GetBackBufferInfo(fxMesa, &backBufferInfo); 961- /* 962- * Note that the _LOCK macro adds a curly brace, 963- * and the UNLOCK macro removes it. 964- */ 965- WRITE_FB_SPAN_LOCK(fxMesa, info, 966- GR_BUFFER_AUXBUFFER, GR_LFBWRITEMODE_ANY); 967- { 968- LFBParameters ReadParams; 969- GetFbParams(fxMesa, &info, &backBufferInfo, 970- &ReadParams, sizeof(GLushort)); 971- for (i = 0; i < n; i++) { 972- if (mask[i] && visible_pixel(fxMesa, x[i], y[i])) { 973- xpos = x[i] + fxMesa->x_offset; 974- ypos = bottom - y[i]; 975- d16 = depth[i]; 976: PUT_FB_DATA(&ReadParams, GLushort, xpos, ypos, d16); 977- } 978- } 979- } 980- WRITE_FB_SPAN_UNLOCK(fxMesa, GR_BUFFER_AUXBUFFER); 981- break; 982- case 24: And relative macros: #define GET_FB_DATA(ReadParamsp, type, x, y) \ (((x) < (ReadParamsp)->firstWrappedX) \ ? (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) \ : (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)])) #define GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) #define GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)]) #define PUT_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_ORDINARY_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_WRAPPED_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) The LFBParameters Struct 483-typedef struct 484-{ 485- void *lfbPtr; 486- void *lfbWrapPtr; 487- FxU32 LFBStrideInElts; 488- GLint firstWrappedX; 489-} 490:LFBParameters; Thanks for looking.

    Read the article

  • Issues accessing an object's array values - returns null or 0s

    - by PhatNinja
    The function below should return an array of objects with this structure: TopicFrequency = { name: "Chemistry", //This is dependent on topic data: [1,2,3,4,5,6,7,8,9,10,11,12] //This would be real data }; so when I do this: myData = this.getChartData("line"); it should return two objects: {name : "Chemistry", data : [1,2,3,4,51,12,0,0, 2,1,41, 31]} {name : "Math", data : [0,0,41,4,51,12,0,0, 2,1,41, 90]} so when I do console.log(myData); it's perfect, returns exactly this. However when I do console.log(myData[0].data) it returns all 0s, not the values. I'm not sure what this issues is known as, and my question is simple what is this problem known as? Here is the full function. Somethings were hardcoded and other variables (notable server and queryContent) removed. Those parts worked fine, it is only when manipulated/retreiving the returned array's values that I run into problems. Note this is async. so not sure if that is also part of the problem. getChartData: function (chartType) { var TopicsFrequencyArray = new Array(); timePairs = this.newIntervalSet("Month"); topicList = new Array("Chemistry", "Math");//Hard coded for now var queryCopy = { //sensitive information }; for (i = 0; i < topicList.length; i++) { var TopicFrequency = { name: null, data: this.newFilledArray(12, 0) }; j = 0; TopicFrequency.name = topicList[i]; while (j < timePairs.length) { queryCopy.filter = TopicFrequency.name; //additional queryCopy parameter changes made here var request = esri.request({ url: server, content: queryCopy, handleAs: "json", load: sucess, error: fail }); j = j + 1; function sucess(response, io) { var topicCountData = 0; query = esri.urlToObject(io.url); var dateString = query.query.fromDate.replace("%", " "); dateString = dateString.replace(/-/g, "/"); dateString = dateString.split("."); date = new Date(dateString[0]); dojo.forEach(response.features, function (feature) { if (feature.properties.count > 0) { topicCountData = feature.properties.count; } TopicFrequency.data[date.getMonth()] = topicCountData; }); } function fail(error) { j = j + 1; alert("There was an unspecified error with this request"); console.log(error); } } TopicsFrequencyArray.push(TopicFrequency); } },

    Read the article

  • DRY-ing very similar specs for ASP.NET MVC controller action with MSpec (BDD guidelines)

    - by spapaseit
    Hi all, I have two very similar specs for two very similar controller actions: VoteUp(int id) and VoteDown(int id). These methods allow a user to vote a post up or down; kinda like the vote up/down functionality for StackOverflow questions. The specs are: VoteDown: [Subject(typeof(SomeController))] public class When_user_clicks_the_vote_down_button_on_a_post : SomeControllerContext { Establish context = () => { post = PostFakes.VanillaPost(); post.Votes = 10; session.Setup(s => s.Single(Moq.It.IsAny<Expression<Func<Post, bool>>>())).Returns(post); session.Setup(s => s.CommitChanges()); }; Because of = () => result = controller.VoteDown(1); It should_decrement_the_votes_of_the_post_by_1 = () => suggestion.Votes.ShouldEqual(9); It should_not_let_the_user_vote_more_than_once; } VoteUp: [Subject(typeof(SomeController))] public class When_user_clicks_the_vote_down_button_on_a_post : SomeControllerContext { Establish context = () => { post = PostFakes.VanillaPost(); post.Votes = 0; session.Setup(s => s.Single(Moq.It.IsAny<Expression<Func<Post, bool>>>())).Returns(post); session.Setup(s => s.CommitChanges()); }; Because of = () => result = controller.VoteUp(1); It should_increment_the_votes_of_the_post_by_1 = () => suggestion.Votes.ShouldEqual(1); It should_not_let_the_user_vote_more_than_once; } So I have two questions: How should I go about DRY-ing these two specs? Is it even advisable or should I actually have one spec per controller action? I know I Normally should, but this feels like repeating myself a lot. Is there any way to implement the second It within the same spec? Note that the It should_not_let_the_user_vote_more_than_once; requires me the spec to call controller.VoteDown(1) twice. I know the easiest would be to create a separate spec for it too, but it'd be copying and pasting the same code yet again... I'm still getting the hang of BDD (and MSpec) and many times it is not clear which way I should go, or what the best practices or guidelines for BDD are. Any help would be appreciated.

    Read the article

  • How to use Facebook graph API to retrieve fan photos uploaded to wall of fan page?

    - by Joe
    I am creating an external photo gallery using PHP and the Facebook graph API. It pulls thumbnails as well as the large image from albums on our Facebook Fan Page. Everything works perfect, except I'm only able to retrieve photos that an ADMIN posts to our page. (graph.facebook.com/myalbumid/photos) Is there a way to use graph api to load publicy uploaded photos from fans? I want to retrieve the pictures from the "Photos from" album, but trying to get the ID for the graph query is not like other albums... it looks like this: http://www.facebook.com/media/set/?set=o.116860675007039 Another note: The only way i've come close to retreiving this data is by using the "feed" option.. ie: graph.facebook.com/pageid/feed EDIT: This is about as far as I could get- it works, but has certain issues stated below. Maybe someone could expand on this, or provide a better solution. (Using FB PHP SDK) <?php require_once ('config.php'); // get all photos for album $photos = $facebook->api("/YourID/tagged"); $maxitem =10; $count = 0; foreach($photos['data'] as $photo) { if ($photo['type'] == "photo"): echo "<img src='{$photo['picture']}' />", "<br />"; endif; $count+= 1; if ($count >= "$maxitem") break; } ?> Issues with this: 1) The fact that I don't know a method for graph querying specific "types" of Tags, I had to run a conditional statement to display photos. 2) You cannot effectively use the "?limit=#" with this, because as I said the "tagged" query contains all types (photo, video, and status). So if you are going for a photo gallery and wish to avoid running an entire query by using ?limit, you will lose images. 3) The only content that shows up in the "tagged" query is from people that are not Admins of the page. This isn't the end of the world, but I don't understand why Facebook wouldn't allow yourself to be shown in this data as long as you posted it "as yourself" and not as the page.

    Read the article

  • Scalable Database Tagging Schema

    - by Longpoke
    EDIT: To people building tagging systems. Don't read this. It is not what you are looking for. I asked this when I wasn't aware that RDBMS all have their own optimization methods, just use a simple many to many scheme. I have a posting system that has millions of posts. Each post can have an infinite number of tags associated with it. Users can create tags which have notes, date created, owner, etc. A tag is almost like a post itself, because people can post notes about the tag. Each tag association has an owner and date, so we can see who added the tag and when. My question is how can I implement this? It has to be fast searching posts by tag, or tags by post. Also, users can add tags to posts by typing the name into a field, kind of like the google search bar, it has to fill in the rest of the tag name for you. I have 3 solutions at the moment, but not sure which is the best, or if there is a better way. Note that I'm not showing the layout of notes since it will be trivial once I get a proper solution for tags. Method 1. Linked list tagId in post points to a linked list in tag_assoc, the application must traverse the list until flink=0 post: id, content, ownerId, date, tagId, notesId tag_assoc: id, tagId, ownerId, flink tag: id, name, notesId Method 2. Denormalization tags is simply a VARCHAR or TEXT field containing a tab delimited array of tagId:ownerId. It cannot be a fixed size. post: id, content, ownerId, date, tags, notesId tag: id, name, notesId Method 3. Toxi (from: http://www.pui.ch/phred/archives/2005/04/tags-database-schemas.html, also same thing here: http://stackoverflow.com/questions/20856/how-do-you-recommend-implementing-tags-or-tagging) post: id, content, ownerId, date, notesId tag_assoc: ownerId, tagId, postId tag: id, name, notesId Method 3 raises the question, how fast will it be to iterate through every single row in tag_assoc? Methods 1 and 2 should be fast for returning tags by post, but for posts by tag, another lookup table must be made. The last thing I have to worry about is optimizing searching tags by name, I have not worked that out yet. I made an ASCII diagram here: http://pastebin.com/f1c4e0e53

    Read the article

  • How to implement a tagging plugin for jQuery

    - by anxiety
    Goal: To implement a jQuery plugin for my rails app (or write one myself, if necessary) that creates a "box" around text after a delimiter is typed. Example: With tagging on SO, the user begins typing a tag, then selects one from the drop-down list provided. The input field recognizes that a tag has been selected, puts a space and then is ready for the next tag. Similarly, I am attempting to use this plugin to put a box around the previously entered tag before moving to to accept the next tag/input. The instructions in the README.txt seem simple enough, however I have been receiving a $(".tagbox").tagbox is not a function error when debugging my app with firebug. Here is what I have in my application.js: $(document).ready( function(){ $('.tagbox').tagbox({ separator: /\[,]/, // specifying comma separation for <code>tags</code> }); }); And here is my _form.html.erb: <% form_for @tag do |f| %> <%= f.error_messages %> <p> <%= f.label :name %><br /> <%= text_field :tag, :name, { :method => :get, :class => "tagbox" } %> </p> <p><%= f.submit "Submit" %></p> <% end %> I have omitted some other code (namely the implementation of an autocomplete plugin) existing within my _form.html.erb and application.js for sake of readability. The inclusion or exclusion of this omitted code does not affect the performance of this plugin. I have included all of the necessary files for the tagbox plugin (as well as application.js after all other included JS files) within the javascript_include_tag in my application.html.erb file. I'm pretty much confused as to why I'd be getting this "not a function" error when jquery.tagbox.js clearly defines the function and is included in the head of my html page in question. I've been struggling with this plugin for longer than I'd like to admit, so any help would really be appreciated. And, of course, I'm open to any other plugins or from-scratch suggestions you may have in mind.. This tagbox plugin does not seem to have a wealth of documentation or any currently working examples. Also to note, I'm trying to avoid using jrails. Thanks for your time

    Read the article

  • Is "Systems Designer" the job title that best describes what I do? [closed]

    - by ivo-rossi
    After having worked as Java developer for almost 3 years in the same company that I currently work at, I moved to a new position associated with the development of the same application. I’m in this new position for more than 1 year now. My official job title is Systems Designer, but I’m not sure this is a title that expresses well what I do. So my question here is what would be the most appropriate job title for me? I see this question as important for my career development. After all, I should be able to explain in one word what I do. And it’s no longer “Java Developer”. Well, in more than one word, this is what I do: The business analysts gather requirements / business problems to be solved with the clients and then discuss these requirements with me. Given the requirements, I design the high level solutions to be implemented in our system (e.g. a new screen on the client application, modifications to existing reports, extension to the XML export format of some objects, etc). I base my decision on the current capabilities of the system, the overall impact that the solutions would have on the system and the estimated effort to implement them (as I was a developer of this same application for almost 3 years before I moved to this position, I’m confident in my estimates). The solutions are discussed iteratively with the business analysts until we agree that they are good. The outcome of this analysis is what we call the “requirements design” document, which is written by me, shared with clients for approval and then also with the team that is going to implement the solutions and test them. Note that there are a few problems that I need to find a solution for that are non-functional. If the users are unhappy with the performance of a certain tool, I will investigate what can be done to speed it up. I will do some research – often based in the Java code itself - to identify possibilities of optimizations. But in this new position I no longer code, the main outcome of my work is really the “requirements design”. Is “Systems Designer” really the most appropriate job title?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

< Previous Page | 507 508 509 510 511 512 513 514 515 516 517 518  | Next Page >