Search Results

Search found 25180 results on 1008 pages for 'post processing'.

Page 512/1008 | < Previous Page | 508 509 510 511 512 513 514 515 516 517 518 519  | Next Page >

  • Sequential GUID in Linq-to-Sql?

    - by JacobE
    I just read a blog post about NHibernate's ability to create a GUID from the system time (Guid.Comb), thus avoiding a good amount of database fragmentation. You could call it the client-side equivalent to the SQL Server Sequential ID. Is there a way I could use a similar strategy in my Linq-to-Sql project (by generating the Guid in code)?

    Read the article

  • Hiding Group Column Names

    - by Robert
    You once replied to a post about hiding list group header names. http://edinkapic.blogspot.com/2008/06/hiding-list-view-group-headers.html I do not write code or jQuery at that. But you mentioned that it would be better to write a solution in jQuery. Would you have code that would hide the group header and colon in a 2003 list (SP v.2)? Do you have any good leads? Thanks. Robert S.

    Read the article

  • Error with my Android Application httpGet

    - by Coombes
    Basically I'm getting a strange issue with my Android application, it's supposed to grab a JSON Array and print out some values, the class looks like this: ShowComedianActivity.class package com.example.connecttest; public class ShowComedianActivity extends Activity{ TextView name; TextView add; TextView email; TextView tel; String id; // Progress Dialog private ProgressDialog pDialog; //JSON Parser class JSONParser jsonParser = new JSONParser(); // Single Comedian url private static final String url_comedian_details = "http://86.9.71.17/connect/get_comedian_details.php"; // JSON Node names private static final String TAG_SUCCESS = "success"; private static final String TAG_COMEDIAN = "comedian"; private static final String TAG_ID = "id"; private static final String TAG_NAME = "name"; private static final String TAG_ADDRESS = "address"; private static final String TAG_EMAIL = "email"; private static final String TAG_TEL = "tel"; public void onCreate(Bundle savedInstanceState){ super.onCreate(savedInstanceState); setContentView(R.layout.show_comedian); // Getting Comedian Details from intent Intent i = getIntent(); // Getting id from intent id = i.getStringExtra(TAG_ID); new GetComedianDetails().execute(); } class GetComedianDetails extends AsyncTask<String, String, String>{ protected void onPreExecute(){ super.onPreExecute(); pDialog = new ProgressDialog(ShowComedianActivity.this); pDialog.setMessage("Fetching Comedian details. Please wait..."); pDialog.setIndeterminate(false); pDialog.setCancelable(true); pDialog.show(); } @Override protected String doInBackground(String... params) { runOnUiThread(new Runnable(){ public void run(){ int success; try{ //Building parameters List<NameValuePair> params = new ArrayList<NameValuePair>(); params.add(new BasicNameValuePair("id",id)); // Getting comedian details via HTTP request // Uses a GET request JSONObject json = jsonParser.makeHttpRequest(url_comedian_details, "GET", params); // Check Log for json response Log.d("Single Comedian details", json.toString()); //JSON Success tag success = json.getInt(TAG_SUCCESS); if(success == 1){ // Succesfully received product details JSONArray comedianObj = json.getJSONArray(TAG_COMEDIAN); //JSON Array // get first comedian object from JSON Array JSONObject comedian = comedianObj.getJSONObject(0); // comedian with id found name = (TextView) findViewById(R.id.name); add = (TextView) findViewById(R.id.add); email = (TextView) findViewById(R.id.email); tel = (TextView) findViewById(R.id.tel); // Set text to details name.setText(comedian.getString(TAG_NAME)); add.setText(comedian.getString(TAG_ADDRESS)); email.setText(comedian.getString(TAG_EMAIL)); tel.setText(comedian.getString(TAG_TEL)); } } catch (JSONException e){ e.printStackTrace(); } } }); return null; } } } And my JSON Parser class looks like: package com.example.connecttest; public class JSONParser { static InputStream is = null; static JSONObject jObj = null; static String json = ""; // constructor public JSONParser() { } // function get json from url // by making HTTP POST or GET method public JSONObject makeHttpRequest(String url, String method, List<NameValuePair> params) { // Making HTTP request try { // check for request method if(method == "POST"){ // request method is POST // defaultHttpClient DefaultHttpClient httpClient = new DefaultHttpClient(); HttpPost httpPost = new HttpPost(url); httpPost.setEntity(new UrlEncodedFormEntity(params)); HttpResponse httpResponse = httpClient.execute(httpPost); HttpEntity httpEntity = httpResponse.getEntity(); is = httpEntity.getContent(); }else if(method == "GET"){ // request method is GET DefaultHttpClient httpClient = new DefaultHttpClient(); String paramString = URLEncodedUtils.format(params, "utf-8"); url += "?" + paramString; HttpGet httpGet = new HttpGet(url); HttpResponse httpResponse = httpClient.execute(httpGet); HttpEntity httpEntity = httpResponse.getEntity(); is = httpEntity.getContent(); } } catch (UnsupportedEncodingException e) { e.printStackTrace(); } catch (ClientProtocolException e) { e.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } try { BufferedReader reader = new BufferedReader(new InputStreamReader( is, "iso-8859-1"), 8); StringBuilder sb = new StringBuilder(); String line = null; while ((line = reader.readLine()) != null) { sb.append(line + "\n"); } is.close(); json = sb.toString(); } catch (Exception e) { Log.e("Buffer Error", "Error converting result " + e.toString()); } // try parse the string to a JSON object try { jObj = new JSONObject(json); } catch (JSONException e) { Log.e("JSON Parser", "Error parsing data " + e.toString()); } // return JSON String return jObj; } } Now when I run a debug it's querying the correct address with ?id=1 on the end of the URL, and when I navigate to that url I get the following JSON Array: {"success":1,"comedian":[{"id":"1","name":"Michael Coombes","address":"5 Trevethenick Road","email":"[email protected]","tel":"xxxxxxxxxxxx"}]} However my app just crashes, the log-cat report looks like this: 03-22 02:05:02.140: E/Trace(3776): error opening trace file: No such file or directory (2) 03-22 02:05:04.590: E/AndroidRuntime(3776): FATAL EXCEPTION: main 03-22 02:05:04.590: E/AndroidRuntime(3776): android.os.NetworkOnMainThreadException 03-22 02:05:04.590: E/AndroidRuntime(3776): at android.os.StrictMode$AndroidBlockGuardPolicy.onNetwork(StrictMode.java:1117) 03-22 02:05:04.590: E/AndroidRuntime(3776): at libcore.io.BlockGuardOs.connect(BlockGuardOs.java:84) 03-22 02:05:04.590: E/AndroidRuntime(3776): at libcore.io.IoBridge.connectErrno(IoBridge.java:127) 03-22 02:05:04.590: E/AndroidRuntime(3776): at libcore.io.IoBridge.connect(IoBridge.java:112) 03-22 02:05:04.590: E/AndroidRuntime(3776): at java.net.PlainSocketImpl.connect(PlainSocketImpl.java:192) 03-22 02:05:04.590: E/AndroidRuntime(3776): at java.net.PlainSocketImpl.connect(PlainSocketImpl.java:459) 03-22 02:05:04.590: E/AndroidRuntime(3776): at java.net.Socket.connect(Socket.java:842) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.conn.scheme.PlainSocketFactory.connectSocket(PlainSocketFactory.java:119) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.impl.conn.DefaultClientConnectionOperator.openConnection(DefaultClientConnectionOperator.java:144) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.impl.conn.AbstractPoolEntry.open(AbstractPoolEntry.java:164) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.impl.conn.AbstractPooledConnAdapter.open(AbstractPooledConnAdapter.java:119) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.impl.client.DefaultRequestDirector.execute(DefaultRequestDirector.java:360) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:555) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:487) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:465) 03-22 02:05:04.590: E/AndroidRuntime(3776): at com.example.connecttest.JSONParser.makeHttpRequest(JSONParser.java:62) 03-22 02:05:04.590: E/AndroidRuntime(3776): at com.example.connecttest.ShowComedianActivity$GetComedianDetails$1.run(ShowComedianActivity.java:89) 03-22 02:05:04.590: E/AndroidRuntime(3776): at android.os.Handler.handleCallback(Handler.java:615) 03-22 02:05:04.590: E/AndroidRuntime(3776): at android.os.Handler.dispatchMessage(Handler.java:92) 03-22 02:05:04.590: E/AndroidRuntime(3776): at android.os.Looper.loop(Looper.java:137) 03-22 02:05:04.590: E/AndroidRuntime(3776): at android.app.ActivityThread.main(ActivityThread.java:4745) 03-22 02:05:04.590: E/AndroidRuntime(3776): at java.lang.reflect.Method.invokeNative(Native Method) 03-22 02:05:04.590: E/AndroidRuntime(3776): at java.lang.reflect.Method.invoke(Method.java:511) 03-22 02:05:04.590: E/AndroidRuntime(3776): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:786) 03-22 02:05:04.590: E/AndroidRuntime(3776): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:553) 03-22 02:05:04.590: E/AndroidRuntime(3776): at dalvik.system.NativeStart.main(Native Method) From this I'm guessing the error is in the jsonParser.makeHttpRequest however I can't for the life of me figure out what's going wrong and was hoping someone brighter than I could illuminate me.

    Read the article

  • ASP.NET MVC: How can I explain an invalid type violation to an end-user with Html.ValidationSummary?

    - by Terminal Frost
    Serious n00b warning here; please take mercy! So I finished the Nerd Dinner MVC Tutorial and I'm now in the process of converting a VB.NET application to ASP.NET MVC using the Nerd Dinner program as a sort of rough template. I am using the "IsValid / GetRuleViolations()" pattern to identify invalid user input or values that violate business rules. I am using LINQ to SQL and am taking advantage of the "OnValidate()" hook that allows me to run the validation and throw an application exception upon trying to save changes to the database via the CustomerRepository class. Anyway, everything works well, except that by the time the form values reach my validation method invalid types have already been converted to a default or existing value. (I have a "StreetNumber" property that is an integer, though I imagine this would be a problem for DateTime or any other non-strings as well.) Now, I am guessing that the UpdateModel() method throws an exception and then alters the value because the Html.ValidationMessage is displayed next to the StreetNumber field but my validation method never sees the original input. There are two problems with this: While the Html.ValidationMessage does signal that something is wrong, there is no corresponding entry in the Html.ValidationSummary. If I could even get the exception message to show up there indicating an invalid cast or something that would be better than nothing. My validation method which resides in my Customer partial class never sees the original user input so I do not know if the problem is a missing entry or an invalid type. I can't figure out how I can keep my validation logic nice and neat in one place and still get access to the form values. I could of course write some logic in the View that processes the user input, however that seems like the exact opposite of what I should be doing with MVC. Do I need a new validation pattern or is there some way to pass the original form values to my model class for processing? CustomerController Code // POST: /Customers/Edit/[id] [AcceptVerbs(HttpVerbs.Post)] public ActionResult Edit(int id, FormCollection formValues) { Customer customer = customerRepository.GetCustomer(id); try { UpdateModel(customer); customerRepository.Save(); return RedirectToAction("Details", new { id = customer.AccountID }); } catch { foreach (var issue in customer.GetRuleViolations()) ModelState.AddModelError(issue.PropertyName, issue.ErrorMessage); } return View(customer); }

    Read the article

  • jQuery: modify hidden form field value before submit

    - by Jason Miesionczek
    I have the following code in a partial view (using Spark): <span id="selectCount">0</span> video(s) selected. <for each="var video in Model"> <div style="padding: 3px; margin:2px" class="video_choice" id="${video.YouTubeID}"> <span id="video_name">${video.Name}</span><br/> <for each="var thumb in video.Thumbnails"> <img src="${thumb}" /> </for> </div> </for> # using(Html.BeginForm("YouTubeVideos","Profile", FormMethod.Post, new { id = "youTubeForm" })) # { <input type="hidden" id="video_names" name="video_names" /> <input type="submit" value="add selected"/> # } <ScriptBlock> $(".video_choice").click(function() { $(this).toggleClass('selected'); var count = $(".selected").length; $("#selectCount").html(count); }); var options = { target: '#videos', beforeSubmit: function(arr, form, opts) { var names = []; $(".selected").each(function() { names[names.length] = $(this).attr('id'); }); var namestring = names.join(","); $("#video_names").attr('value',namestring); //alert(namestring); //arr["video_names"] = namestring; //alert($.param(arr)); //alert($("#video_names").attr('value')); return true; } }; $("#youTubeForm").ajaxForm(options); </ScriptBlock> Essentially i display a series of divs that contain information pulled from the YouTube API. I use jQuery to allow the the user to select which videos they would like to add to their profile. When i submit the form i would like to populate the hidden field with a comma separated list of video ids. Everything works except that when i try to set the value of the field, in the controller on post, the field comes back empty. I am using the jQuery ajax form plugin. What am i doing wrong that is not allowing the value i set in the field to be sent to the server?

    Read the article

  • Design patterns and interview question

    - by user160758
    When I was learning to code, I read up on the design patterns like a good boy. Long after this, I started to actually understand them. Design discussions such as those on this site constantly try to make the rules more and more general, which is good. But there is a line, over which it becomes over-analysis starts to feed off itself and as such I think begins to obfuscate the original point - for example the "What's Alternative to Singleton" post and the links contained therein. http://stackoverflow.com/questions/1300655/whats-alternative-to-singleton I say this having been asked in both interviews I’ve had over the last 2 weeks what a singleton is and what criticisms I have of it. I have used it a few times for items such as user data (simple key-value eg. last file opened by this user) and logging (very common i'm sure). I've never ever used it just to have what is essentially global application data, as this is clearly stupid. In the first interview, I reply that I have no criticisms of it. He seemed disappointed by this but as the job wasn’t really for me, I forgot about it. In the next one, I was asked again and, as I wanted this job, I thought about it on the spot and made some objections, similar to those contained in the post linked to above (I suggested use of a factory or dependency injection instead). He seemed happy with this. But my problem is that I have used the singleton without ever using it in this kind of stupid way, which I had to describe on the spot. Using it for global data and the like isn’t something I did then realised was stupid, or read was stupid so didn’t do, it was just something I knew was stupid from the start. Essentially I’m supposed to be able to think of ways of how to misuse a pattern in the interview? Which class of programmers can best answer this question? The best ones? The medium ones? I'm not sure.... And these were both bright guys. I read more than enough to get better at my job but had never actually bothered to seek out criticisms of the most simple of the design patterns like this one. Do people think such questions are valid and that I ought to know the objections off by heart? Or that it is reasonable to be able to work out what other people who are missing the point would do on the fly? Or do you think I’m at least partially right that the question is too unsubtle and that the questions ought to be better thought out in order to make sure only good candidates can answer. PS. Please don’t think I’m saying that I’m just so clever that I know everything automatically - I’ve learnt the hard way like everyone else. But avoiding global data is hardly revolutionary.

    Read the article

  • Coolest C# LINQ/Lambdas trick you've ever pulled?

    - by chakrit
    Saw a post about hidden features in C# but not a lot of people have written linq/lambdas example so... I wonder... What's the coolest (as in the most elegant) use of the C# LINQ and/or Lambdas/anonymous delegates you have ever saw/written? Bonus if it has went into production too!

    Read the article

  • Wordpress display specific sub category of a parent category.

    - by Pennf0lio
    So here's the scenario, I'm building a theme that would display sub category of a parent post for Food: [Food] -Hotdog -Eggs -Fries for Toys: [Toys] -Doll -Car -Drums for People: [People] -Mom -Dad -Uncle now I don't want to display their parent category, just their subcategory (eg Doll, Car, Drums). I've looked list_cats() and wp_list_categories() but I can't figure out how to display it right. Thanks!

    Read the article

  • jQuery getting just added by ajax element

    - by Qiao
    $.post('includes/script.php', $(this).serialize(), function(data) { $('body').append(data); }); alert ($('#new').length) php script is <php echo "<div id="new">text</div>" ?> it alerts 0, so it can't see new div. How can you make it see new div?

    Read the article

  • Linq Expression Trees in Compact Framework.

    - by Michal Drozdowicz
    The lack of expression trees in Compact Framework has bugged me for some time now, but I haven't really looked for a solution. Today, I've found a blog post about an alternative System.Linq.Expressions built on top of Mono System.Core and used e.g. by db4o (you can find it here). My question is - have you used this library and if so, what were your experiences with it (especially regarding performance)?

    Read the article

  • Variable disappears when I log in

    - by John
    Hello, I have profile page where the profile is retrieved via GET. The index file has this: $profile = $_GET['profile']; When I log in on the profile page, the $profile variable disappears. Here is the form action on the login function: <form name="login-form" id="login-form" method="post" action="./index.php"> (The $profile variable is separate of the login username.) How could I make the page retain the $profile variable? Thanks in advance, John

    Read the article

  • Using preg_replace to replace all occurrences in php

    - by Greg-J
    Regex is absolutely my weak point and this one has me completely stumped. I am building a fairly basic search functionality and I need to be able to alter my user input based on the following pattern: Subject: %22first set%22 %22second set%22-drupal -wordpress Desired output: +"first set" +"second set" -drupal -wordpress I wish I could be more help as I normally like to at least post the solution I have so far, but on this one I'm at a loss. Any help is appreciated. Thank you.

    Read the article

  • Nesting forms in CakePHP

    - by Erik
    I am wondering if there's a way in CakePHP to nest multiple models in a form? What I'm trying to accomplish is to make a form for creating Posts that will also contain fields for adding Images (separate model) that will automatically be connected to the created post. Something similar to Ruby on Rails ** accept_nested_attributes_for**.

    Read the article

  • Clearing Page Cache in ASP.NET

    - by GateKiller
    For my blog I am wanting to use the Output Cache to save a cached version of a perticular post for around 10 minutes, and thats fine... <%@OutputCache Duration="600" VaryByParam="*" %> However, if someone posts a comment, I want to clear the cache so that the page is refreshed and the comment can be seen. How do I do this in ASP.Net C#?

    Read the article

  • symbols in command line argument.. python, bash

    - by Idlecool
    Hi, I am writing a python script on Linux for twitter post using API, Is it possible to pass symbols like "(" ")" etc in clear text without apostrophes.... % ./twitterupdate this is me #works fine % ./twitterupdate this is bad :(( #this leaves a error on bash. Is the only alternative is to enclose the text into -- "" ?? like.. % ./twitterupdate "this is bad :((" #this will reduce the ease of use for the script Is there any workaround?

    Read the article

  • get fbml comments to automatically show form

    - by Cek
    I'm writing facebook app in fbml (not in iframe). I added comments with <fb:comments ...> and it appears to work. However, to add a comment, user has to click Add a comment... link to see the textarea and post button. I am wondering is there a way to automatically show the form? I want it to really look like here: developers.facebook.com/docs/reference/plugins/comments (with or without the like button)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Is DevTeach worth the cost?

    - by Mafuba
    Wondering if people who have attended DevTeach could comment on the value of the conference (e.g. well-organized, good sessions, good material, etc.). This post seems to indicate that it is not worth the money.

    Read the article

  • virtualenvwrapper .hook problem

    - by Wraith
    I've used virtualenvwrapper, but I'm having problems running it on a new computer. My .bashrc file is updated per the instructions: export WORKON_HOME=$DEV_HOME/projects source /usr/local/bin/virtualenvwrapper.sh But when source is run, I get the following: bash: /25009.hook: Permission denied bash: /25009.hook: No such file or directory This previous post leads me to believe the filename is being recycled and locked because virtualenvwrapper.sh uses $$. Is there any way to fix this?

    Read the article

  • html5 uploader + jquery drag & drop: how to store file data with FormData?

    - by lauthiamkok
    I am making a html5 drag and drop uploader with jquery, below is my code so far, the problem is that I get an empty array without any data. Is this line incorrect to store the file data - fd.append('file', $thisfile);? $('#div').on( 'dragover', function(e) { e.preventDefault(); e.stopPropagation(); } ); $('#div').on( 'dragenter', function(e) { e.preventDefault(); e.stopPropagation(); } ); $('#div').on( 'drop', function(e){ if(e.originalEvent.dataTransfer){ if(e.originalEvent.dataTransfer.files.length) { e.preventDefault(); e.stopPropagation(); // The file list. var fileList = e.originalEvent.dataTransfer.files; //console.log(fileList); // Loop the ajax post. for (var i = 0; i < fileList.length; i++) { var $thisfile = fileList[i]; console.log($thisfile); // HTML5 form data object. var fd = new FormData(); //console.log(fd); fd.append('file', $thisfile); /* var file = {name: fileList[i].name, type: fileList[i].type, size:fileList[i].size}; $.each(file, function(key, value) { fd.append('file['+key+']', value); }) */ $.ajax({ url: "upload.php", type: "POST", data: fd, processData: false, contentType: false, success: function(response) { // .. do something }, error: function(jqXHR, textStatus, errorMessage) { console.log(errorMessage); // Optional } }); } /*UPLOAD FILES HERE*/ upload(e.originalEvent.dataTransfer.files); } } } ); function upload(files){ console.log('Upload '+files.length+' File(s).'); }; then if I use another method is that to make the file data into an array inside the jquery code, var file = {name: fileList[i].name, type: fileList[i].type, size:fileList[i].size}; $.each(file, function(key, value) { fd.append('file['+key+']', value); }); but where is the tmp_name data inside e.originalEvent.dataTransfer.files[i]? php, print_r($_POST); $uploaddir = './uploads/'; $file = $uploaddir . basename($_POST['file']['name']); if (move_uploaded_file($_POST['file']['tmp_name'], $file)) { echo "success"; } else { echo "error"; } as you can see that tmp_name is needed to upload the file via php... html, <div id="div">Drop here</div>

    Read the article

< Previous Page | 508 509 510 511 512 513 514 515 516 517 518 519  | Next Page >