Search Results

Search found 25180 results on 1008 pages for 'post processing'.

Page 513/1008 | < Previous Page | 509 510 511 512 513 514 515 516 517 518 519 520  | Next Page >

  • symbols in command line argument.. python, bash

    - by Idlecool
    Hi, I am writing a python script on Linux for twitter post using API, Is it possible to pass symbols like "(" ")" etc in clear text without apostrophes.... % ./twitterupdate this is me #works fine % ./twitterupdate this is bad :(( #this leaves a error on bash. Is the only alternative is to enclose the text into -- "" ?? like.. % ./twitterupdate "this is bad :((" #this will reduce the ease of use for the script Is there any workaround?

    Read the article

  • ASP.NET MVC: How can I explain an invalid type violation to an end-user with Html.ValidationSummary?

    - by Terminal Frost
    Serious n00b warning here; please take mercy! So I finished the Nerd Dinner MVC Tutorial and I'm now in the process of converting a VB.NET application to ASP.NET MVC using the Nerd Dinner program as a sort of rough template. I am using the "IsValid / GetRuleViolations()" pattern to identify invalid user input or values that violate business rules. I am using LINQ to SQL and am taking advantage of the "OnValidate()" hook that allows me to run the validation and throw an application exception upon trying to save changes to the database via the CustomerRepository class. Anyway, everything works well, except that by the time the form values reach my validation method invalid types have already been converted to a default or existing value. (I have a "StreetNumber" property that is an integer, though I imagine this would be a problem for DateTime or any other non-strings as well.) Now, I am guessing that the UpdateModel() method throws an exception and then alters the value because the Html.ValidationMessage is displayed next to the StreetNumber field but my validation method never sees the original input. There are two problems with this: While the Html.ValidationMessage does signal that something is wrong, there is no corresponding entry in the Html.ValidationSummary. If I could even get the exception message to show up there indicating an invalid cast or something that would be better than nothing. My validation method which resides in my Customer partial class never sees the original user input so I do not know if the problem is a missing entry or an invalid type. I can't figure out how I can keep my validation logic nice and neat in one place and still get access to the form values. I could of course write some logic in the View that processes the user input, however that seems like the exact opposite of what I should be doing with MVC. Do I need a new validation pattern or is there some way to pass the original form values to my model class for processing? CustomerController Code // POST: /Customers/Edit/[id] [AcceptVerbs(HttpVerbs.Post)] public ActionResult Edit(int id, FormCollection formValues) { Customer customer = customerRepository.GetCustomer(id); try { UpdateModel(customer); customerRepository.Save(); return RedirectToAction("Details", new { id = customer.AccountID }); } catch { foreach (var issue in customer.GetRuleViolations()) ModelState.AddModelError(issue.PropertyName, issue.ErrorMessage); } return View(customer); }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Is there away to store info, without a database?

    - by Tanner
    HI, I was wondering is there any way to store data, like say I wanted to make a login form and save the usernames and passwords, without using a database or .txt file? Seems like alot of work to set up stuff like that, for something simple, and I was just wondering if there was another way. :) And if any one has some tutorials on how to use a database Access/Sql/Local Database please post.

    Read the article

  • How Does One Differentiate Between Routes POSTed To In Asp.Net MVC?

    - by Laz
    I have two actions, one that accepts a ViewModel and one that accepts two parameters a string and an int, when I try to post to the action, it gives me an error telling me that the current request is ambiguous between the two actions. Is it possible to indicate to the routing system which action is the relevant one, and if it is how is it done?

    Read the article

  • get fbml comments to automatically show form

    - by Cek
    I'm writing facebook app in fbml (not in iframe). I added comments with <fb:comments ...> and it appears to work. However, to add a comment, user has to click Add a comment... link to see the textarea and post button. I am wondering is there a way to automatically show the form? I want it to really look like here: developers.facebook.com/docs/reference/plugins/comments (with or without the like button)

    Read the article

  • How to get to apple iphone discussion forums?

    - by wolverine
    I logged into my account and is reaching this page. http://developer.apple.com/devforums/ After that when i click login and give the details, it redirects to the same page. Where can I see the discussions and post questions? I know its a simple question but dont know what I am missing here.

    Read the article

  • Clearing Page Cache in ASP.NET

    - by GateKiller
    For my blog I am wanting to use the Output Cache to save a cached version of a perticular post for around 10 minutes, and thats fine... <%@OutputCache Duration="600" VaryByParam="*" %> However, if someone posts a comment, I want to clear the cache so that the page is refreshed and the comment can be seen. How do I do this in ASP.Net C#?

    Read the article

  • How do I optimize this query?

    - by InnateDev
    SELECT DISTINCT wposts.* FROM wp_2_posts wposts, wp_2_postmeta wpostmeta, wp_2_postmeta wpostmeta1, wp_2_term_taxonomy, wp_2_terms, wp_2_term_relationships WHERE wposts.ID = wpostmeta.post_id AND wp_2_terms.term_id = '8' AND wp_2_term_taxonomy.term_id = wp_2_terms.term_id AND wp_2_term_taxonomy.term_taxonomy_id = wp_2_term_relationships.term_taxonomy_id AND wp_2_term_relationships.object_id = wposts.ID AND wpostmeta.meta_key = 'validity' AND wpostmeta.meta_value > '".$logic_date."' AND wpostmeta1.meta_key != 'permanent' AND wposts.post_status = 'publish' AND wposts.post_type = 'post' ORDER BY wposts.post_date DESC

    Read the article

  • how to write a script that logs into an application and checks a page

    - by josh
    Is it possible to write a script that will login to an application using uname/pwd? the username/password are not passed in through POST (they dont come in the URL) Basic steps I am looking for are: Visit url enter uname/pwd click a button click a link get the raw html to make sure it does not have 500 error Is that possible to do in any language? Please point me to some examples as well

    Read the article

  • Disqus: change captions after success with jQuery

    - by andufo
    Hi, Disqus automatically places defined captions upon request. For example: Add new Comment I've tried to change its value with jquery on ready(): $('#dsq-new-post h3').text('Paticipa con tu cuenta favorita'); No success :( ... how can i know when disqus script is finished parsing the data so i can change the caption value of h3?

    Read the article

  • Tag Cloud JS + Flash. Not clickable?

    - by Alex
    Hello all, I've implemented a tag cloud on a site of mine, and I'm using a JS script to populate it, but for some reason, the actual text in the tag cloud is not clickable. It displays and works correctly, but the actual text of the cloud is not getting treated as a link for some odd reason. My question is: In my script below, do you see anything that I need to fix in order to make my tag cloud's text actually be links? The site I've implemented it on is a stackexhange site that I run, it is supposed to be a cloud of the "recent tags." CloudPopulator.js <script type="text/javascript"> var divRecentTags = document.getElementById("recent-tags"); if (divRecentTags) { var cloud = new SWFObject("https://kynetx-images.s3.amazonaws.com/tagcloud.swf", "tagcloudflash", "200", "200", "9", "#ffffff"); cloud.addParam("allowScriptAccess", "always"); cloud.addVariable("tcolor", "0x0a94d6"); cloud.addVariable("tcolor2", "0xC0C0C0"); cloud.addVariable("hicolor", "0x000000"); cloud.addVariable("tspeed", "150"); cloud.addVariable("distr", "true"); cloud.addVariable("mode", "tags"); var aTags = divRecentTags.getElementsByTagName("a"); var tagHtml = ""; for(var i = 0; i < aTags.length; i++) { var hrefText = aTags[i].getAttribute("href"); var cssText = aTags[i].className; var tagName = $(aTags[i]).text(); var styleText = "style=\'font-size: 8pt;\'"; if (cssText == "post-tag pop1") { var styleText = "style=\'font-size: 15pt;\'"; } else if (cssText == "post-tag pop2") { var styleText = "style=\'font-size: 22pt;\'"; } var newLinkText = "<a href=\'"+hrefText+"\'"+styleText+">"+tagName+"</a>"; tagHtml = tagHtml + newLinkText; } cloud.addVariable("tagcloud", escape("<tags>" + tagHtml + "</tags>")); cloud.write("recent-tags"); }

    Read the article

  • JS text to array

    - by Sonny
    Hi i got this text 2/92/20 3/32/32 4/62/6 5/22/28 6/60/61 7/33/32 8/34/31 9/31/19 10/19/19 11/34/39 12/32/32 14/19/25 15/45/37 16/32/32 17/84/36 18/72/33 and i need it to be like // 2/92/20 chars[0][0]=2; chars[0][1]=92; chars[0][2]=20; How should i make that PS: the split must be in $.ajax({ type: "POST", url: "char_info2.php", dataType: "html", success: function(data) { //here }

    Read the article

< Previous Page | 509 510 511 512 513 514 515 516 517 518 519 520  | Next Page >