Search Results

Search found 25180 results on 1008 pages for 'post processing'.

Page 513/1008 | < Previous Page | 509 510 511 512 513 514 515 516 517 518 519 520  | Next Page >

  • get fbml comments to automatically show form

    - by Cek
    I'm writing facebook app in fbml (not in iframe). I added comments with <fb:comments ...> and it appears to work. However, to add a comment, user has to click Add a comment... link to see the textarea and post button. I am wondering is there a way to automatically show the form? I want it to really look like here: developers.facebook.com/docs/reference/plugins/comments (with or without the like button)

    Read the article

  • How to link to specific anchor in table with jquery

    - by LisaH
    I am using this jquery plugin: http://www.jankoatwarpspeed.com/post/2009/07/20/Expand-table-rows-with-jQuery-jExpand-plugin.aspx I have anchors in the code such as: <a name="art" id="art2"></a> Articles How can I open that particular row then? In other words, when a user clicks a link from another page to this landing page I would like the appropriate row to open up based on the anchor tag. Thanks in advance!

    Read the article

  • Hiding Group Column Names

    - by Robert
    You once replied to a post about hiding list group header names. http://edinkapic.blogspot.com/2008/06/hiding-list-view-group-headers.html I do not write code or jQuery at that. But you mentioned that it would be better to write a solution in jQuery. Would you have code that would hide the group header and colon in a 2003 list (SP v.2)? Do you have any good leads? Thanks. Robert S.

    Read the article

  • Wordpress display specific sub category of a parent category.

    - by Pennf0lio
    So here's the scenario, I'm building a theme that would display sub category of a parent post for Food: [Food] -Hotdog -Eggs -Fries for Toys: [Toys] -Doll -Car -Drums for People: [People] -Mom -Dad -Uncle now I don't want to display their parent category, just their subcategory (eg Doll, Car, Drums). I've looked list_cats() and wp_list_categories() but I can't figure out how to display it right. Thanks!

    Read the article

  • Clearing Page Cache in ASP.NET

    - by GateKiller
    For my blog I am wanting to use the Output Cache to save a cached version of a perticular post for around 10 minutes, and thats fine... <%@OutputCache Duration="600" VaryByParam="*" %> However, if someone posts a comment, I want to clear the cache so that the page is refreshed and the comment can be seen. How do I do this in ASP.Net C#?

    Read the article

  • form_dropdown in codeigniter

    - by Patrick
    I'm getting a strange behaviour from form_dropdown - basically, when I reload the page after validation, the values are screwed up. this bit generates 3 drop downs with days, months and years: $days = array(0 => 'Day...'); for ($i = 1; $i <= 31; $i++) { $days[] = $i; } $months = array(0 => 'Month...', ); for ($i = 1; $i <= 12; $i++) { $months[] = $i; } $years = array(0 => 'Year...'); for ($i = 2010; $i <= 2012; $i++) { $years[$i] = $i; echo "<pre>"; print_r($years); echo "</pre>";//remove this } $selected_day = (isset($selected_day)) ? $selected_day : 0; $selected_month = (isset($selected_month)) ? $selected_month : 0; $selected_year = (isset($selected_year)) ? $selected_year : 0; echo "<p>"; echo form_label('Select date:', 'day', array('class' => 'left')); echo form_dropdown('day', $days, $selected_day, 'class="combosmall"'); echo form_dropdown('month', $months, $selected_month, 'class="combosmall"'); echo form_dropdown('year', $years, $selected_year, 'class="combosmall"'); echo "</p>"; ...and generates this: <p><label for="day" class="left">Select date:</label><select name="day" class="combosmall"> <option value="0" selected="selected">Day...</option> <option value="1">1</option> <option value="2">2</option> <option value="3">3</option> <option value="4">4</option> <option value="5">5</option> <option value="6">6</option> <option value="7">7</option> <option value="8">8</option> <option value="9">9</option> <option value="10">10</option> <option value="11">11</option> <option value="12">12</option> <option value="13">13</option> <option value="14">14</option> <option value="15">15</option> <option value="16">16</option> <option value="17">17</option> <option value="18">18</option> <option value="19">19</option> <option value="20">20</option> <option value="21">21</option> <option value="22">22</option> <option value="23">23</option> <option value="24">24</option> <option value="25">25</option> <option value="26">26</option> <option value="27">27</option> <option value="28">28</option> <option value="29">29</option> <option value="30">30</option> <option value="31">31</option> </select><select name="month" class="combosmall"> <option value="0" selected="selected">Month...</option> <option value="1">1</option> <option value="2">2</option> <option value="3">3</option> <option value="4">4</option> <option value="5">5</option> <option value="6">6</option> <option value="7">7</option> <option value="8">8</option> <option value="9">9</option> <option value="10">10</option> <option value="11">11</option> <option value="12">12</option> </select><select name="year" class="combosmall"> <option value="0" selected="selected">Year...</option> <option value="2010">2010</option> <option value="2011">2011</option> <option value="2012">2012</option> </select></p> however, when the form is reloaded after validation, the same code above generates this: <!-- days and months... --> <select name="year" class="combosmall"> <option value="0" selected="selected">Year...</option> <option value="1">2010</option> <option value="2">2011</option> <option value="3">2012</option> </select> So basically the value start from 1 instead of 2010. The same happens to days and months but obviously it doesn't make any difference in this particular case as the values would start from 1 anyway. How can I fix this - and why does it happen? edit: validation rules are: $this->load->library('form_validation'); //...rules for other fields.. $this->form_validation->set_rules('day', 'day', 'required|xss_clean'); $this->form_validation->set_rules('month', 'month', 'required|xss_clean'); $this->form_validation->set_rules('year', 'year', 'required|xss_clean'); $this->form_validation->set_error_delimiters('<p class="error">', '</p>'); //define other errors if($this->input->post('day') == 0 || $this->input->post('month') == 0 || $this->input->post('year') == 0) { $data['error'] = "Please check the date of your event."; }

    Read the article

  • How Does One Differentiate Between Routes POSTed To In Asp.Net MVC?

    - by Laz
    I have two actions, one that accepts a ViewModel and one that accepts two parameters a string and an int, when I try to post to the action, it gives me an error telling me that the current request is ambiguous between the two actions. Is it possible to indicate to the routing system which action is the relevant one, and if it is how is it done?

    Read the article

  • Describe your workflow of using version control (VCS or DVCS)

    - by edwin.nathaniel
    I'd like to learn other people workflow when using either SVN or GIT. Please describe your strategy to handle the following tasks: Implement a feature Fixing bugs (during development and deployed app) Code Review Refactoring code (post code-review) Incorporate patches Releasing the newer version of your app (desktop, web, mobile, would you treat them differently?) Feel free to organize your answer not grouped by the tasks but grouped by whatever you think is relevant but please organize it by VCS/DVCS (please don't mix them). Thank you.

    Read the article

  • Is DevTeach worth the cost?

    - by Mafuba
    Wondering if people who have attended DevTeach could comment on the value of the conference (e.g. well-organized, good sessions, good material, etc.). This post seems to indicate that it is not worth the money.

    Read the article

  • Compile multiple C files with make

    - by Mohit Deshpande
    (I am running Linux Ubuntu 9.10, so the extension for an executable is executablefile.out) I am just getting into modular programming (programming with multiple files) in C and I want to know how to compile multiple files in a single makefile. For example, what would be the makefile to compile these files: main.c, dbAdapter.c, dbAdapter.h? (By the way, If you haven't figured it out yet, the main function is in main.c) Also could someone post a link to the documentation of a makefile?

    Read the article

  • virtualenvwrapper .hook problem

    - by Wraith
    I've used virtualenvwrapper, but I'm having problems running it on a new computer. My .bashrc file is updated per the instructions: export WORKON_HOME=$DEV_HOME/projects source /usr/local/bin/virtualenvwrapper.sh But when source is run, I get the following: bash: /25009.hook: Permission denied bash: /25009.hook: No such file or directory This previous post leads me to believe the filename is being recycled and locked because virtualenvwrapper.sh uses $$. Is there any way to fix this?

    Read the article

  • Zend Framework decorator subform add a class tag to DD wrapper tag

    - by Samuele
    I have this form: class Request_Form_Prova extends Zend_Form { public function init() { $this->setMethod('post'); $SubForm_Step = new Zend_Form_SubForm(); $SubForm_Step->setAttrib('class','Step'); $this->addSubform($SubForm_Step, 'Chicco'); $PrivacyCheck = $SubForm_Step->createElement('CheckBox', 'PrivacyCheck'); $PrivacyCheck->setLabel('I have read and I agre bla bla...') ->setRequired(true) ->setUncheckedValue(''); $PrivacyCheck->getDecorator('Label')->setOption('class', 'inline'); $SubForm_Step->addElement($PrivacyCheck); $SubForm_Step->addElement('submit', 'submit', array( 'ignore' => true, 'label' => 'OK', )); } } That generate this HTML: <form enctype="application/x-www-form-urlencoded" method="post" action=""> <dl class="zend_form"> <dt id="Chicco-label">&nbsp;</dt> <dd id="Chicco-element"> <fieldset id="fieldset-Chicco" class="Step"> <dl> <dt id="Chicco-PrivacyCheck-label"><label for="Chicco-PrivacyCheck" class="inline required">I have read and I agre bla bla...</label></dt> <dd id="Chicco-PrivacyCheck-element"> <input type="hidden" name="Chicco[PrivacyCheck]" value=""><input type="checkbox" name="Chicco[PrivacyCheck]" id="Chicco-PrivacyCheck" value="1"> </dd> <dt id="submit-label">&nbsp;</dt> <dd id="submit-element"> <input type="submit" name="Chicco[submit]" id="Chicco-submit" value="OK"> </dd> </dl> </fieldset> </dd> </dl> </form> How can I add a class="Test" to the <dd id="Chicco-element"> elemnt? In order to have it like that: <dd id="Chicco-element" class="Test"> I thought something like that but it don't work: $SubForm_Step->getDecorator('DdWrapper')->setOption('class', 'Test'); OR $SubForm_Step->getDecorator('DtDdWrapper')->setOption('class', 'Test'); How can I do it? And last question: How can I wrap that DD and DT element of a SubForm in another DL element? Like that: ( second line ) <dl class="zend_form"> <dl> <dt id="Chicco-label">&nbsp;</dt> <dd id="Chicco-element"> <fieldset id="fieldset-Chicco" class="Step"> <dl> .......

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Nesting forms in CakePHP

    - by Erik
    I am wondering if there's a way in CakePHP to nest multiple models in a form? What I'm trying to accomplish is to make a form for creating Posts that will also contain fields for adding Images (separate model) that will automatically be connected to the created post. Something similar to Ruby on Rails ** accept_nested_attributes_for**.

    Read the article

  • Live search results as you type... am I going about this the right way? jQuery + PHP

    - by dallen
    This is my first time building a tool like this, so please bare with me. I'm doing this to learn more about jQuery and AJAX. Basically, I have a search input and a hidden div. When you start typing in the search input, the hidden div becomes visible and results are brought in. In this case, I'm searching for client names. It all works fine, however I think my code could be better but I'm not sure exactly where to begin. Each keyup requests a PHP script which accesses a table in a database to find a like string. But in my PHP script, I'm echo'ing some JS/jQuery which I'm not sure is good practice. Below is my code. Am I going about this the right way or am I totally off base? Any suggestions for improvement? Javascript $("#search").keyup(function() { $("#search_results").show("fast"); $.ajax ({ type: "POST", url: "http://localhost:8888/index.php/welcome/search/" + $("#search").val(), success: function(html) { $("#search_results").html(html); } }); }); PHP function search($search_string = false) { if ($search_string) { $this->db->like('name', $search_string); $query = $this->db->get('clients'); if ($query->num_rows() == 0) { echo "No client exists."; } else { foreach ($query->result() as $row) { echo '<script>'; echo ' $("#client_results_'.$row->id.'").hide(); $("#'.$row->id.'").toggle(function() { $.ajax ({ type: "POST", url: "http://localhost:8888/index.php/welcome/search_client_ads/" + '.$row->id.', success: function(html) { $("#client_results_'.$row->id.'").html(html).show("fast"); } }); }, function() { $("#client_results_'.$row->id.'").hide("fast").html(""); });'; echo '</script>'; echo '<p><span id="'.$row->id.'">'.$row->name.'</span></p>'; echo '<div id="client_results_'.$row->id.'"></div>'; } } } else { echo ''; } } function search_client_ads($client_id) { $query = $this->db->get_where('online_ads', array('client' => $client_id)); if ($query->num_rows() == 0) { echo "No ads exist."; } else { foreach ($query->result() as $row) { echo $row->id; } } }

    Read the article

  • Add Events to Yahoo using curl

    - by Sudhir
    I've tried using curl to add new events to yahoo, succeeded in logging in and getting the calendar add events page, but when i try to post events using curl, it redirects me to login page. Please suggest what can i do...? Thanks in advance

    Read the article

  • Codeigniter not returning me to upload form after image upload.

    - by Drew
    I'm still very new to codeigniter. The issue i'm having is that the file uploads fine and it writes to the database without issue but it just doesn't return me to the upload form. Instead it stays in the do_upload and doesn't display anything. Even more bizarrely there is some source code behind the scenes. Can someone tell my what it is i'm doing wrong because I want to be returning to my upload form after submission. Thanks in advance. Below is my code: Controller: function do_upload() { if($this->Upload_model->do_upload()) { $this->load->view('home/upload_form'); }else{ $this->load->view('home/upload_success', $error); } } Model: function do_upload() { $config['upload_path'] = './uploads/'; $config['allowed_types'] = 'gif|jpg|png'; $config['max_size'] = '2000'; $this->load->library('upload', $config); if ( ! $this->upload->do_upload()) { $error = array('error' => $this->upload->display_errors()); return $error; } else { $data = $this->upload->data(); $full_path = 'uploads/' . $data['file_name']; $spam = array( 'image_url' => $full_path, 'url' => $this->input->post('url') ); $id = $this->input->post('id'); $this->db->where('id', $id); $this->db->update('NavItemData', $spam); return true; } } View (called upload_form): <html> <head> <title>Upload Form</title> </head> <body> <?php if(isset($buttons)) : foreach($buttons as $row) : ?> <h2><?php echo $row->image_url; ?></h2> <p><?php echo $row->url; ?></p> <p><?php echo $row->name; ?></p> <p><?php echo anchor("upload/update_nav/$row->id", 'edit'); ?></p> <?php endforeach; ?> <?php endif; ?> </body> </html>

    Read the article

  • Implementing the server side of Webhooks

    - by Howiecamp
    If I want to Webhooks-enable a web application (I'm referring to the server-side of things, ie the server where the event happens and the callback is initiated from), are there libraries for this, or is this functionality typically part of the web server stack? Or, am I looking at this incorrectly, and to implement Webhooks I simply code my application to do an HTTP POST callback based on whatever events I care about?

    Read the article

  • How to access nested iframes?

    - by Debugger
    I need to send post message to iframe. currently its working if i have single iframe inside parent page.But I want to make it work for nested iframes. Criterias are : I can just add listener code in last leaf iframe. Do not know length of iframe nesting. Need both way communication , from parent to child also by leaf iframe to parent. I am sick of third part iframes , please suggest me some appropriate solution.

    Read the article

< Previous Page | 509 510 511 512 513 514 515 516 517 518 519 520  | Next Page >