Search Results

Search found 19018 results on 761 pages for 'raw input'.

Page 515/761 | < Previous Page | 511 512 513 514 515 516 517 518 519 520 521 522  | Next Page >

  • Issue with WIC image resizing on ASP.NET MVC 2

    - by Dave
    I am attempting to implement image resizing on user uploads in ASP.NET MVC 2 using a version of the method found: here on asp.net. This works great on my dev machine, but as soon as I put it on my production machine, I start getting the error 'Exception from HRESULT: 0x88982F60' which is supposed to mean that there is an issue decoding the image. However, when I use WICExplorer to open the image, it looks ok. I've also tried this with dozens of images of various sources and still get the error (though possible, I doubt all of them are corrupted). Here is the relevant code (with my debugging statements in there): MVC Controller [Authorize, HttpPost] public ActionResult Upload(string file) { //Check file extension string fx = file.Substring(file.LastIndexOf('.')).ToLowerInvariant(); string key; if (ConfigurationManager.AppSettings["ImageExtensions"].Contains(fx)) { key = Guid.NewGuid().ToString() + fx; } else { return Json("extension not found"); } //Check file size if (Request.ContentLength <= Convert.ToInt32(ConfigurationManager.AppSettings["MinImageSize"]) || Request.ContentLength >= Convert.ToInt32(ConfigurationManager.AppSettings["MaxImageSize"])) { return Json("content length out of bounds: " + Request.ContentLength); } ImageResizerResult irr, irr2; //Check if this image is coming from FF, Chrome or Safari (XHR) HttpPostedFileBase hpf = null; if (Request.Files.Count <= 0) { //Scale and encode image and thumbnail irr = ImageResizer.CreateMaxSizeImage(Request.InputStream); irr2 = ImageResizer.CreateThumbnail(Request.InputStream); } //Or IE else { hpf = Request.Files[0] as HttpPostedFileBase; if (hpf.ContentLength == 0) return Json("hpf.length = 0"); //Scale and encode image and thumbnail irr = ImageResizer.CreateMaxSizeImage(hpf.InputStream); irr2 = ImageResizer.CreateThumbnail(hpf.InputStream); } //Check if image and thumbnail encoded and scaled correctly if (irr == null || irr.output == null || irr2 == null || irr2.output == null) { if (irr != null && irr.output != null) irr.output.Dispose(); if (irr2 != null && irr2.output != null) irr2.output.Dispose(); if(irr == null) return Json("irr null"); if (irr2 == null) return Json("irr2 null"); if (irr.output == null) return Json("irr.output null. irr.error = " + irr.error); if (irr2.output == null) return Json("irr2.output null. irr2.error = " + irr2.error); } if (irr.output.Length > Convert.ToInt32(ConfigurationManager.AppSettings["MaxImageSize"]) || irr2.output.Length > Convert.ToInt32(ConfigurationManager.AppSettings["MaxImageSize"])) { if(irr.output.Length > Convert.ToInt32(ConfigurationManager.AppSettings["MaxImageSize"])) return Json("irr.output.Length > maximage size. irr.output.Length = " + irr.output.Length + ", irr.error = " + irr.error); return Json("irr2.output.Length > maximage size. irr2.output.Length = " + irr2.output.Length + ", irr2.error = " + irr2.error); } //Store scaled and encoded image and thumbnail .... return Json("success"); } The code is always failing when checking if the output stream is null (i.e. irr.output == null is true). ImageResizerResult and ImageResizer public class ImageResizerResult : IDisposable { public MemoryIStream output; public int width; public int height; public string error; public void Dispose() { output.Dispose(); } } public static class ImageResizer { private static Object thislock = new Object(); public static ImageResizerResult CreateMaxSizeImage(Stream input) { uint maxSize = Convert.ToUInt32(ConfigurationManager.AppSettings["MaxImageDimension"]); try { lock (thislock) { // Read the source image var photo = ByteArrayFromStream(input); var factory = (IWICComponentFactory)new WICImagingFactory(); var inputStream = factory.CreateStream(); inputStream.InitializeFromMemory(photo, (uint)photo.Length); var decoder = factory.CreateDecoderFromStream(inputStream, null, WICDecodeOptions.WICDecodeMetadataCacheOnDemand); var frame = decoder.GetFrame(0); // Compute target size uint width, height, outWidth, outHeight; frame.GetSize(out width, out height); if (width > height) { //Check if width is greater than maxSize if (width > maxSize) { outWidth = maxSize; outHeight = height * maxSize / width; } //Width is less than maxSize, so use existing dimensions else { outWidth = width; outHeight = height; } } else { //Check if height is greater than maxSize if (height > maxSize) { outWidth = width * maxSize / height; outHeight = maxSize; } //Height is less than maxSize, so use existing dimensions else { outWidth = width; outHeight = height; } } // Prepare output stream to cache file var outputStream = new MemoryIStream(); // Prepare JPG encoder var encoder = factory.CreateEncoder(Consts.GUID_ContainerFormatJpeg, null); encoder.Initialize(outputStream, WICBitmapEncoderCacheOption.WICBitmapEncoderNoCache); // Prepare output frame IWICBitmapFrameEncode outputFrame; var arg = new IPropertyBag2[1]; encoder.CreateNewFrame(out outputFrame, arg); var propBag = arg[0]; var propertyBagOption = new PROPBAG2[1]; propertyBagOption[0].pstrName = "ImageQuality"; propBag.Write(1, propertyBagOption, new object[] { 0.85F }); outputFrame.Initialize(propBag); outputFrame.SetResolution(96, 96); outputFrame.SetSize(outWidth, outHeight); // Prepare scaler var scaler = factory.CreateBitmapScaler(); scaler.Initialize(frame, outWidth, outHeight, WICBitmapInterpolationMode.WICBitmapInterpolationModeFant); // Write the scaled source to the output frame outputFrame.WriteSource(scaler, new WICRect { X = 0, Y = 0, Width = (int)outWidth, Height = (int)outHeight }); outputFrame.Commit(); encoder.Commit(); return new ImageResizerResult { output = outputStream, height = (int)outHeight, width = (int)outWidth }; } } catch (Exception e) { return new ImageResizerResult { error = "Create maxsizeimage = " + e.Message }; } } } Thoughts on where this is going wrong? Thanks in advance for the effort.

    Read the article

  • .net activeX object

    - by Ali YILDIRIM
    Hi, I am trying to use my .net image editor user control as an activeX object in a web form. After internet search, I created a asp.net web site from VS2008 and added the following code <object classid="res/ImageEditor.dll#ImageEditor.Editor" height="400" width="400" id="myControl1" name="myControl1" > </object> <INPUT id="Button1" type="button" value="Btn" name="Btn" onclick="return Button1_onclick()"> </script> <script language=javascript> function Button1_onclick() { alert(document.getElementById("myControl1").WatermarkText); } </script> I have two problems 1-) When i first create the project i see the user control on browser but, after rebuilding the user control and changing the dll file at web site, the object no more appears on browser. Instead i see something like an error image. 2-) i can not access public properties. The user control is marked as "make com visible", and register for com is checked at properties.

    Read the article

  • WPF Keyboard Remapping

    - by m1dst
    Hello, I am trying to remap the input of a textbox. For example. If a user enters a N then I would like to change it to a 9. I thought it might be best to try and catch it in the PreviewKeyDown event although I will also need to process paste attempts (I can solve that bit I think). Is PreviewKeyDown a good place to start? If so, how do I send the replacement key. I know that e.Handled = true will stop the original key being processed. Thanks.

    Read the article

  • Trying to issue a mouseclick event on a QWebElement in QWebView QtWebKit

    - by Bad Man
    I'm trying to send a mouse click event on a certain element in the QtWebKit DOM but I'm obviously doing it wrong: QWebElement el=this->page()->mainFrame()->findFirstElement("input[type=submit]"); el.setFocus(); QMouseEvent pressEvent(QMouseEvent::MouseButtonPress, el.geometry().center(), Qt::MouseButton::LeftButton, Qt::LeftButton, Qt::NoModifier); QCoreApplication::sendEvent(this->page()->mainFrame(), &pressEvent); QMouseEvent releaseEvent(QMouseEvent::MouseButtonRelease, el.geometry().center(), Qt::MouseButton::LeftButton, Qt::LeftButton, Qt::NoModifier); QCoreApplication::sendEvent(this->page()->mainFrame(), &releaseEvent); Any ideas? (p.s. I am extending QWebView if it wasn't obvious)

    Read the article

  • Integer Linear Programming Java: Multiple Open Source and Commercial tools are available. Which one

    - by Sandeep Jindal
    Hi, I need to use Integer Linear Programming API/Tool for my application. Though my application is in Java but I don’t mind calling an EXE (Tool) from Java providing input using file (MPS, etc). My search analysis is as follows: There are multiple Open Source and Commercial tools available to solve ILP Following I found and think are useful for my needs. 1. Gnu LP Kit(GLPK): I think this is the oldest and probably most stable and efficient 2. IP_Solve: Has good reviews about it. 3. JavaILP: Found this, but not much reviews about it 4. Apache Common-Math: Supports LP but not ILP, so ruled out. 5. Coin-OR Can you please suggest which one shall be the best in terms of stability, efficiency, acceptance, etc Regards Sandeep Jindal

    Read the article

  • Python-daemon doesn't kill its kids

    - by Brian M. Hunt
    When using python-daemon, I'm creating subprocesses likeso: import multiprocessing class Worker(multiprocessing.Process): def __init__(self, queue): self.queue = queue # we wait for things from this in Worker.run() ... q = multiprocessing.Queue() with daemon.DaemonContext(): for i in xrange(3): Worker(q) while True: # let the Workers do their thing q.put(_something_we_wait_for()) When I kill the parent daemonic process (i.e. not a Worker) with a Ctrl-C or SIGTERM, etc., the children don't die. How does one kill the kids? My first thought is to use atexit to kill all the workers, likeso: with daemon.DaemonContext(): workers = list() for i in xrange(3): workers.append(Worker(q)) @atexit.register def kill_the_children(): for w in workers: w.terminate() while True: # let the Workers do their thing q.put(_something_we_wait_for()) However, the children of daemons are tricky things to handle, and I'd be obliged for thoughts and input on how this ought to be done. Thank you.

    Read the article

  • WPF DataGridTextColumn Can't type point for float data

    - by Alvin
    I had a WPF DataGrid and use DataGridTextColumn Binding to a Collection. The items in Collection had some float property. When my program launched, I modify the value of float property in DataGrid, if I type a integer value, it works well. But if I type char . for a float value, char . can't be typed. I had to type all the numbers first, and then jump to the . position to type char . to finish my input. So how can I type . in my situation? Thanks.

    Read the article

  • C# Pragma to suppress break on thrown error

    - by Courtney de Lautour
    First off I run my applications with exceptions thrown on any error (handled or not). Second I am using a TypeConverter to convert from a user input string to the actual object. Third TypeConverter offers no TryConvert method so I'm stuck using exceptions for validation, using this rather ugly bit of code here: try { this._newValue = null; #pragma Magic_SuppressBreakErrorThrown System.Exception this._newValue = this.Converter.ConvertFromString(this._textBox.Text); #pragma Magic_ResumeBreakErrorThrown System.Exception this.HideInvalidNotification(); } catch (Exception exception) { if (exception.InnerException is FormatException) { this.ShowInvalidNotification(this._textBox.Text); } else { throw; } } I'm finding it rather distracting to have VS break execution every-time I type the - of -1, or some other invalid character. I could use something similar to this but not all the types I'm converting to have a TryParse method either. I'm hoping there may be some way to disable breaking for the section of code within the try without changing my exception settings.

    Read the article

  • Performing both client side and server side validation using jQuery and CodeIgniter

    - by Vasu
    What is the right way of doing both client side and server side validation using jQuery and CodeIgniter? I am using the jQuery form plugin for form submit. I would like to use jQuery validation plugin (http://docs.jquery.com/Plugins/Validation) for client side validation and CodeIgniter form validation on the server side. However the two don't seem to gel together (or I am unable to get my head around it). Can someone help please? Whether its a client side validation or server side validation, the user should see consistent UI displaying error messages next to the input fields.

    Read the article

  • Extending Code Igniter Model functions to external PHP Scripts

    - by Fábio Antunes
    Hello everybody. I'm doing a small web app, which uses CKeditor for user input, and CKfinder for file management (images/flash). Those who know CKFinder, also know that the config file for CKFinder as a function named CheckAuthentication() that returns false or true, giving or not permissions to use CKFinder. This is were a Custom PHP Code checks if the user as authorization to access CKFinder or not. Well for my app I'm using Code Igniter, and of course I've created a model were i handle everything about User Permissions, Loggin, Session Cookies, etc. And i also have a function witch its propose is just to check if the user is Logged in. So I would like to know if someone knows a way that i can call the function isLoggedIn() inside the model security from inside the function CheckAuthentication() in CKFinder config file. Thanks in advance.

    Read the article

  • InvokeMember("click") webBrowser help

    - by Tom
    I am trying to automate a web page via the weBrowser and the button that i'm trying to click has no ID only a value. here's the html code for it: Accept I can't useGetElementById as the button has no ID. If I do HtmlElement goButton = this.webBrowser1.Document.All["Accept"]; goButton.InvokeMember("click"); My script stops showing a nullreference error highlighting the "goButton.InvokeMember("click");" If I do var inputControls = (from HtmlElement element in webBrowser1.Document.GetElementsByTagName("input") select element).ToList(); HtmlElement submitButton = inputControls.First(x = x.Name == "Accept"); My script give me an "Sequence contains no matching element" error at the "HtmlElement submitButton" line and sometimes the page has more than one of these Accept buttons, so I would need to be able to tell the difference between each one as well or at least be able to click on one without the script breaking Any help with this will be greatly appreciated

    Read the article

  • ASP.NET MVC ajax - data transfer

    - by Grienders
    How can I get result from action? I need to show the commentID on the page (aspx) after successes comment insert. controller [AcceptVerbs(HttpVerbs.Post )] public ActionResult ShowArticleByAjax(Guid id, string commentBody) { Guid commentID = Comment.InsertComment(id, commentBody); //How can I tranfer commentID to the aspx page ??? return PartialView("CommentDetails",Article.GetArticleByID(id)); } ascx <%using (Ajax.BeginForm("ShowArticleByAjax", new { id = Model.ID }, new AjaxOptions { HttpMethod = "Post", UpdateTargetId = "divCommentDetails", OnSuccess = "successAddComment", OnFailure = "failureAddComment", OnBegin = "beginAddComment" })) { %> <p> <%=Html.TextArea("commentBody", new { cols = "100%", rows = "10" })%> </p> <p> <input name="submit" type="image" src="../../Content/Images/Design/button_s.gif" id="submit" /> </p> <%} %> aspx doesn't matter

    Read the article

  • POJO's versus Cursors in Android

    - by Kilnr
    I usually tend to define the model layer of my apps using POJO's, such as Article, Comment, etc. I was about to implement an AlphabetIndexer in the adapter of one of my ListViews. Right now this adapter accepts a Collection of Articles, which I normally get from my wrapper around an SQLiteDatabase. The signature of the AlphabetIndexer constructer is as follows: public AlphabetIndexer (Cursor cursor, int sortedColumnIndex, CharSequence alphabet) Since this doesn't accept a Collection or something similar, just a Cursor, it got me wondering: maybe I shouldn't be creating objects for my model, and just use the Cursors returned from the database? So the question is, I guess: what should I do, represent data with Collections of POJO's, or just work with Cursors throughout my app? Any input?

    Read the article

  • Button inside text box

    - by user542719
    My code shows a button inside a textbox, but when the input value changes, the size of the text box also changes. That I don't like. Is there any solution such that the textbox size remains fixed? Or any other idea on how to create a button inside textbox? The following is my code: JPanel panel = new JPanel(); panel.setLayout( new FlowLayout(FlowLayout.CENTER, 0, 0) ); panel.add(textField); panel.add(button); panel.setBackground( textField.getBackground() ); panel.setBorder( textField.getBorder() ); textField.setBorder(null);

    Read the article

  • No-Model Formtastic Form

    - by Kevin Sylvestre
    I am looking to reproduce the following with Formtastic: <% form_tag '/search', :method => 'get' do %> <%= text_field_tag :q, params[:q] %> <% end %> So far I have: <% semantic_form_for :search, :html => { :method => :get } do |form| %> <% form.inputs do %> <%= form.input :q %> <% end %> <% end %> However, this requires access to the parameter hash using: params[:search][:q] Instead of my required: params[:q] I'd like to use Formtastic for all forms in the application I am working on, and so far I have only had problems with this one. Any ideas?

    Read the article

  • WF4 - Display workflow design in asp.net and highlight an activity

    - by jikan_the_useless
    i need to display current status of a document approval workflow task in asp.net web page with a specific activity highlighted. i have seen the visual workflow tracker example (in wf&wcf samples) but i have two issues, 1-i have to render workflow in asp.net not in a wpf app. 2-i don't need to display current status with workflow running, all activities that need to highlighted are the one that require user input. e.g. "waiting for approval from department head" etc. if i could just convert the workflow xaml to jpg after highlighting a specific activity by activity id that created a bookmark and waiting to resume the bookmark it would do the work.

    Read the article

  • Using chunked encoding in a POST request to an asmx web service on IIS 6 generates a 404

    - by user175869
    Hi, I'm using a CXF client to communicate with a .net web service running on IIS 6. This request (anonymised): POST /EngineWebService_v1/EngineWebService_v1.asmx HTTP/1.1 Content-Type: text/xml; charset=UTF-8 SOAPAction: "http://.../Report" Accept: */* User-Agent: Apache CXF 2.2.5 Cache-Control: no-cache Pragma: no-cache Host: uat9.gtios.net Connection: keep-alive Transfer-Encoding: chunked followed by 7 chunks of 4089 bytes and one of 369 bytes, generates the following output after the first chunk has been sent: HTTP/1.1 404 Not Found Content-Length: 103 Date: Wed, 10 Feb 2010 13:00:08 GMT Connection: Keep-Alive Content-Type: text/html Anyone know how to get IIS to accept chunked input for a POST? Thanks

    Read the article

  • Django and floatformat tag

    - by Hellnar
    Hello, I want to modify / change the way the floatformat works. By default it changes the input decimal as such: {{ 1.00|floatformat }} -> 1 {{ 1.50|floatformat }} -> 1.5 {{ 1.53|floatformat }} -> 1.53 I want to change this abit as such: If there is a floating part, it should keep the first 2 floating digits. If no floating (which means .00) it should simply cut out the floating part. IE: {{ 1.00|floatformat }} -> 1 {{ 1.50|floatformat }} -> 1.50 {{ 1.53|floatformat }} -> 1.53

    Read the article

  • SPARC T4-4 Beats 8-CPU IBM POWER7 on TPC-H @3000GB Benchmark

    - by Brian
    Oracle's SPARC T4-4 server delivered a world record TPC-H @3000GB benchmark result for systems with four processors. This result beats eight processor results from IBM (POWER7) and HP (x86). The SPARC T4-4 server also delivered better performance per core than these eight processor systems from IBM and HP. Comparisons below are based upon system to system comparisons, highlighting Oracle's complete software and hardware solution. This database world record result used Oracle's Sun Storage 2540-M2 arrays (rotating disk) connected to a SPARC T4-4 server running Oracle Solaris 11 and Oracle Database 11g Release 2 demonstrating the power of Oracle's integrated hardware and software solution. The SPARC T4-4 server based configuration achieved a TPC-H scale factor 3000 world record for four processor systems of 205,792 QphH@3000GB with price/performance of $4.10/QphH@3000GB. The SPARC T4-4 server with four SPARC T4 processors (total of 32 cores) is 7% faster than the IBM Power 780 server with eight POWER7 processors (total of 32 cores) on the TPC-H @3000GB benchmark. The SPARC T4-4 server is 36% better in price performance compared to the IBM Power 780 server on the TPC-H @3000GB Benchmark. The SPARC T4-4 server is 29% faster than the IBM Power 780 for data loading. The SPARC T4-4 server is up to 3.4 times faster than the IBM Power 780 server for the Refresh Function. The SPARC T4-4 server with four SPARC T4 processors is 27% faster than the HP ProLiant DL980 G7 server with eight x86 processors on the TPC-H @3000GB benchmark. The SPARC T4-4 server is 52% faster than the HP ProLiant DL980 G7 server for data loading. The SPARC T4-4 server is up to 3.2 times faster than the HP ProLiant DL980 G7 for the Refresh Function. The SPARC T4-4 server achieved a peak IO rate from the Oracle database of 17 GB/sec. This rate was independent of the storage used, as demonstrated by the TPC-H @3000TB benchmark which used twelve Sun Storage 2540-M2 arrays (rotating disk) and the TPC-H @1000TB benchmark which used four Sun Storage F5100 Flash Array devices (flash storage). [*] The SPARC T4-4 server showed linear scaling from TPC-H @1000GB to TPC-H @3000GB. This demonstrates that the SPARC T4-4 server can handle the increasingly larger databases required of DSS systems. [*] The SPARC T4-4 server benchmark results demonstrate a complete solution of building Decision Support Systems including data loading, business questions and refreshing data. Each phase usually has a time constraint and the SPARC T4-4 server shows superior performance during each phase. [*] The TPC believes that comparisons of results published with different scale factors are misleading and discourages such comparisons. Performance Landscape The table lists the leading TPC-H @3000GB results for non-clustered systems. TPC-H @3000GB, Non-Clustered Systems System Processor P/C/T – Memory Composite(QphH) $/perf($/QphH) Power(QppH) Throughput(QthH) Database Available SPARC Enterprise M9000 3.0 GHz SPARC64 VII+ 64/256/256 – 1024 GB 386,478.3 $18.19 316,835.8 471,428.6 Oracle 11g R2 09/22/11 SPARC T4-4 3.0 GHz SPARC T4 4/32/256 – 1024 GB 205,792.0 $4.10 190,325.1 222,515.9 Oracle 11g R2 05/31/12 SPARC Enterprise M9000 2.88 GHz SPARC64 VII 32/128/256 – 512 GB 198,907.5 $15.27 182,350.7 216,967.7 Oracle 11g R2 12/09/10 IBM Power 780 4.1 GHz POWER7 8/32/128 – 1024 GB 192,001.1 $6.37 210,368.4 175,237.4 Sybase 15.4 11/30/11 HP ProLiant DL980 G7 2.27 GHz Intel Xeon X7560 8/64/128 – 512 GB 162,601.7 $2.68 185,297.7 142,685.6 SQL Server 2008 10/13/10 P/C/T = Processors, Cores, Threads QphH = the Composite Metric (bigger is better) $/QphH = the Price/Performance metric in USD (smaller is better) QppH = the Power Numerical Quantity QthH = the Throughput Numerical Quantity The following table lists data load times and refresh function times during the power run. TPC-H @3000GB, Non-Clustered Systems Database Load & Database Refresh System Processor Data Loading(h:m:s) T4Advan RF1(sec) T4Advan RF2(sec) T4Advan SPARC T4-4 3.0 GHz SPARC T4 04:08:29 1.0x 67.1 1.0x 39.5 1.0x IBM Power 780 4.1 GHz POWER7 05:51:50 1.5x 147.3 2.2x 133.2 3.4x HP ProLiant DL980 G7 2.27 GHz Intel Xeon X7560 08:35:17 2.1x 173.0 2.6x 126.3 3.2x Data Loading = database load time RF1 = power test first refresh transaction RF2 = power test second refresh transaction T4 Advan = the ratio of time to T4 time Complete benchmark results found at the TPC benchmark website http://www.tpc.org. Configuration Summary and Results Hardware Configuration: SPARC T4-4 server 4 x SPARC T4 3.0 GHz processors (total of 32 cores, 128 threads) 1024 GB memory 8 x internal SAS (8 x 300 GB) disk drives External Storage: 12 x Sun Storage 2540-M2 array storage, each with 12 x 15K RPM 300 GB drives, 2 controllers, 2 GB cache Software Configuration: Oracle Solaris 11 11/11 Oracle Database 11g Release 2 Enterprise Edition Audited Results: Database Size: 3000 GB (Scale Factor 3000) TPC-H Composite: 205,792.0 QphH@3000GB Price/performance: $4.10/QphH@3000GB Available: 05/31/2012 Total 3 year Cost: $843,656 TPC-H Power: 190,325.1 TPC-H Throughput: 222,515.9 Database Load Time: 4:08:29 Benchmark Description The TPC-H benchmark is a performance benchmark established by the Transaction Processing Council (TPC) to demonstrate Data Warehousing/Decision Support Systems (DSS). TPC-H measurements are produced for customers to evaluate the performance of various DSS systems. These queries and updates are executed against a standard database under controlled conditions. Performance projections and comparisons between different TPC-H Database sizes (100GB, 300GB, 1000GB, 3000GB, 10000GB, 30000GB and 100000GB) are not allowed by the TPC. TPC-H is a data warehousing-oriented, non-industry-specific benchmark that consists of a large number of complex queries typical of decision support applications. It also includes some insert and delete activity that is intended to simulate loading and purging data from a warehouse. TPC-H measures the combined performance of a particular database manager on a specific computer system. The main performance metric reported by TPC-H is called the TPC-H Composite Query-per-Hour Performance Metric (QphH@SF, where SF is the number of GB of raw data, referred to as the scale factor). QphH@SF is intended to summarize the ability of the system to process queries in both single and multiple user modes. The benchmark requires reporting of price/performance, which is the ratio of the total HW/SW cost plus 3 years maintenance to the QphH. A secondary metric is the storage efficiency, which is the ratio of total configured disk space in GB to the scale factor. Key Points and Best Practices Twelve Sun Storage 2540-M2 arrays were used for the benchmark. Each Sun Storage 2540-M2 array contains 12 15K RPM drives and is connected to a single dual port 8Gb FC HBA using 2 ports. Each Sun Storage 2540-M2 array showed 1.5 GB/sec for sequential read operations and showed linear scaling, achieving 18 GB/sec with twelve Sun Storage 2540-M2 arrays. These were stand alone IO tests. The peak IO rate measured from the Oracle database was 17 GB/sec. Oracle Solaris 11 11/11 required very little system tuning. Some vendors try to make the point that storage ratios are of customer concern. However, storage ratio size has more to do with disk layout and the increasing capacities of disks – so this is not an important metric in which to compare systems. The SPARC T4-4 server and Oracle Solaris efficiently managed the system load of over one thousand Oracle Database parallel processes. Six Sun Storage 2540-M2 arrays were mirrored to another six Sun Storage 2540-M2 arrays on which all of the Oracle database files were placed. IO performance was high and balanced across all the arrays. The TPC-H Refresh Function (RF) simulates periodical refresh portion of Data Warehouse by adding new sales and deleting old sales data. Parallel DML (parallel insert and delete in this case) and database log performance are a key for this function and the SPARC T4-4 server outperformed both the IBM POWER7 server and HP ProLiant DL980 G7 server. (See the RF columns above.) See Also Transaction Processing Performance Council (TPC) Home Page Ideas International Benchmark Page SPARC T4-4 Server oracle.com OTN Oracle Solaris oracle.com OTN Oracle Database 11g Release 2 Enterprise Edition oracle.com OTN Sun Storage 2540-M2 Array oracle.com OTN Disclosure Statement TPC-H, QphH, $/QphH are trademarks of Transaction Processing Performance Council (TPC). For more information, see www.tpc.org. SPARC T4-4 205,792.0 QphH@3000GB, $4.10/QphH@3000GB, available 5/31/12, 4 processors, 32 cores, 256 threads; IBM Power 780 QphH@3000GB, 192,001.1 QphH@3000GB, $6.37/QphH@3000GB, available 11/30/11, 8 processors, 32 cores, 128 threads; HP ProLiant DL980 G7 162,601.7 QphH@3000GB, $2.68/QphH@3000GB available 10/13/10, 8 processors, 64 cores, 128 threads.

    Read the article

  • jQuery datepicker getMinDate '+1d'

    - by Adrian Adkison
    Once I have set the minDate property of a datepicker with the convenient string syntax $(elem).datepicker('option','minDate','+1d +3m'); how can I get the date object of the minDate? To help illustrate, there is a method $(elem).datepicker('getDate'); which returns the date that is entered in the input in the format of a date object. I would like the same thing but for datepicker('getMinDate'). There is an option like this $(elem).datepicker('option','minDate'); but this returns '+1d +3m' which is not helpful. I need the actual date object to compare with another date object. Any ideas?

    Read the article

  • JQuery dirtyForm not working on text boxes in ajaxToolkit:TabPanel

    - by dustinson
    I'm a newb to jQ so please forgive my ignorance. I'm using Asa Wilson's plugin jquery.dirtyform.js to prompt a user of unsaved changes before they nav away from a page (ASP.Net C# 3.5). It basically loops through all controls and appends a class and handler to each input. Controls w/i an ajaxToolkit:TabPanel are ignored, unfortunately. I'd appreciate if anyone knows of this type of error and how to resolve it short of manually manipulating each control (as I have this logic in the master page). Thank you.

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • ASPX ajax form post help

    - by StealthRT
    Hey all, i have this peice of code that allows a user to select a jpg image, resize it and uploads it to the server driectory. The problem being is that it reloads the aspx page when it saves the image. My question is-is there any way to do this same thing but with ajax so that it doesn't leave the page after submitting it? I've done this pleanty of times with classic asp pages but never with a aspx page. Here is the code for the ASPX page: <%@ Page Trace="False" Language="vb" aspcompat="false" debug="true" validateRequest="false"%> <%@ Import Namespace=System.Drawing %> <%@ Import Namespace=System.Drawing.Imaging %> <%@ Import Namespace=System.Drawing.Text %> <%@ Import Namespace=System %> <%@ Import Namespace=System.IO %> <%@ Import Namespace=System.Web %> <%@ Import Namespace=System.ServiceProcess %> <%@ Import Namespace=Microsoft.Data.Odbc %> <%@ Import Namespace=System.Data.Odbc %> <%@ Import Namespace=MySql.Data.MySqlClient %> <%@ Import Namespace=MySql.Data %> <%@ Import Namespace=System.Drawing.Drawing2D %> <%@ Import Namespace="System.Data" %> <%@ Import Namespace="System.Data.ADO" %> <%@ Import Namespace=ADODB %> <SCRIPT LANGUAGE="VBScript" runat="server"> const Lx = 200 const Ly = 60 const upload_dir = "/img/avatar/" const upload_original = "tmpAvatar" const upload_thumb = "thumb" const upload_max_size = 256 dim fileExt dim newWidth, newHeight as integer dim l2 dim fileFld as HTTPPostedFile Dim originalimg As System.Drawing.Image dim msg dim upload_ok as boolean </script> <% Dim theID, theEmail, maleOrFemale theID = Request.QueryString("ID") theEmail = Request.QueryString("eMail") maleOrFemale = Request.QueryString("MF") randomize() upload_ok = false if lcase(Request.ServerVariables("REQUEST_METHOD"))="post" then fileFld = request.files(0) if fileFld.ContentLength > upload_max_size * 1024 then msg = "Sorry, the image must be less than " & upload_max_size & "Kb" else try fileExt = System.IO.Path.GetExtension(fileFld.FileName).ToLower() if fileExt = ".jpg" then originalImg = System.Drawing.Image.FromStream(fileFld.InputStream) if originalImg.Height > Ly then newWidth = Ly * (originalImg.Width / originalImg.Height) newHeight = Ly end if Dim thumb As New Bitmap(newWidth, newHeight) Dim gr_dest As Graphics = Graphics.FromImage(thumb) dim sb = new SolidBrush(System.Drawing.Color.White) gr_dest.SmoothingMode = System.Drawing.Drawing2D.SmoothingMode.HighQuality gr_dest.CompositingQuality = System.Drawing.Drawing2D.CompositingQuality.HighQuality gr_dest.FillRectangle(sb, 0, 0, thumb.Width, thumb.Height) gr_dest.DrawImage(originalImg, 0, 0, thumb.Width, thumb.Height) try originalImg.save(Server.MapPath(upload_dir & upload_original & fileExt), originalImg.rawformat) thumb.save(Server.MapPath(upload_dir & theID & fileExt), originalImg.rawformat) msg = "Uploaded " & fileFld.FileName & " to " & Server.MapPath(upload_dir & upload_original & fileExt) upload_ok = true File.Delete(Server.MapPath(upload_dir & upload_original & fileExt)) catch msg = "Sorry, there was a problem saving your avatar. Please try again." end try if not thumb is nothing then thumb.Dispose() thumb = nothing end if else msg = "That image does not seem to be a JPG. Upload only JPG images." end if catch msg = "That image does not seem to be a JPG." end try end if if not originalImg is nothing then originalImg.Dispose() originalImg = nothing end if end if %><head> <meta http-equiv="pragma" content="no-cache" /> </head> <html> <script type="text/javascript" src="js/jquery-1.3.min.js"></script> <form enctype="multipart/form-data" method="post" runat="server" id="sendImg"> <input type="file" name="upload_file" id="upload_file" style="-moz-opacity: 0; opacity:0; filter: alpha(opacity=0); margin-top: 5px; float:left; cursor:pointer;" onChange="$('#sendImg').submit();" > <input type="submit" value="Upload" style="visibility:hidden; display:none;"> </form> </body> </html> Any help would be great! :o) David

    Read the article

  • Codeigniter and Paypal: How it works

    - by Abs
    Hello all, Two random question as I try to integerate Paypal IPN into my Codeigniter based web app. 1) Are these two lines the same? $data['pp_info'] = $this->input->post(); $data['pp_info'] = $_POST; 2) A user agrees to pay a monthly recurring fee to use your service using paypal - first payment you are aware they have paid as you get data returned from paypal. But how do you keep track if users has paid for the following months? How do you know the user has not cancelled from their paypal account? Thanks all for any help

    Read the article

  • How to void authorized transaction in authorize.net gateway using ActiveMerchant

    - by m7d
    Goal: Only have successful purchases show up on a customer's billing statement. I don't want declined authorizations showing up on their billing statement (as seen in an online banking system) as pending. A customer often will accidentally input an incorrect billing address, for example, followed by a correct one. Together, the two attempts, one successful and one not both show up on their billing statement as pending prior to settlement. This can scare the customer as it looks potentially like they will be charged twice. Details: When I do an AUTH_CAPTURE (via ActiveMerchant's purchase) or an AUTH (via ActiveMerchant's authorize) which is declined and subsequently want to void that authorization (via ActiveMerchant's void) so as not to have it appear on a customer's billing statement as pending (even though it will settle out after a few days), the gateway can't find the transaction to void using the authorization code returned from the authorization or capture method calls on the gateway. This is specific to the authorize.net AIM gateway. Please advise. Thanks!

    Read the article

< Previous Page | 511 512 513 514 515 516 517 518 519 520 521 522  | Next Page >