Search Results

Search found 31206 results on 1249 pages for 'version detection'.

Page 517/1249 | < Previous Page | 513 514 515 516 517 518 519 520 521 522 523 524  | Next Page >

  • Converting string to a simple type

    - by zespri
    .Net framework contains a great class named Convert that allows conversion between simple types, DateTime type and String type. Also the class support conversion of the types implementing IConvertible interface. The class has been implemented in the very first version of .Net framework. There were a few things in the first .Net framework that were not done quite right. For example .Parse methods on simple types would throw an exception if the string couldn't be parsed and there would be no way to check if exception is going to be thrown in advance. A future version of .Net Framework removed this deficiency by introducing the TryParse method that resolved this problem. The Convert class dates back to time of the old Parse method, so the ChangeType method on this class in implemented old style - if conversion can't be performed an exception is thrown. Take a look at the following code: public static T ConvertString<T>(string s, T @default) { try { return (T)Convert.ChangeType(s, typeof(T), CultureInfo.InvariantCulture); } catch (Exception) { return @default; } } This code basically does what I want. However I would pretty much like to avoid the ugly try/catch here. I'm sure, that similar to TryParse, there is a modern method of rewriting this code without the catch-all. Could you suggest one?

    Read the article

  • jquery fail to retrieve accurate data from sibling field.

    - by i need help
    wonder what's wrong <table id=tblDomainVersion> <tr> <td>Version</td> <td>No of sites</td> </tr> <tr> <td class=clsversion>1.25</td> <td><a id=expanddomain>3 sites</a><span id=spanshowall></span></td> </tr> <tr> <td class=clsversion>1.37</td> <td><a id=expanddomain>7 sites</a><span id=spanshowall></span></td> </tr> </table> $('#expanddomain').click(function() { //the siblings result incorrect //select first row will work //select second row will no response var versionforselected= $('#expanddomain').parent().siblings("td.clsversion").text(); alert(versionforselected); $.ajax({ url: "ajaxquery.php", type: "POST", data: 'version='+versionforselected, timeout: 900000, success: function(output) { output= jQuery.trim(output); $('#spanshowall').html(output); }, }); });

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Why is UseCompatibleTextRendering needed here?

    - by HotOil
    Hi, I think I'm missing something fundamental. Please tell me what it is, if you can. I have developed a little C++ WinForms app using VS2008. So it is built using .NET 3.5 SP1. My development box is Win7, if that matters. The default value of UseCompatibleTextRendering property in WinForms controls is false in this version of VStudio. And this should not matter to me, I don't think. I don't have any custom-drawn text or controls. The app looks good running on my Win7 box. If I package it up (dragging along .NET 3.5) and install it on one of our WinXP desktops, the buttons and labels don't look good; the text is chopped off in them. If I set UseCompatibleTextRendering to true and then run it on the XP boxes, the text fits into the buttons and labels. My question is: Why? The installation puts .Net 3.5 on the XP boxes, so the app should be able to find and use the right version of WinForms, right? I should note that before I put my app + .NET 3.5 on these boxes, they have no .NET at all. They do not get automatic Microsoft updates; our IT guy gates the patches and upgrades. [ This sort of thing has happened before with apps I create.. they look/work great on the Engineering machines, because we maintain those and they mostly have up-to-date stuff. When they are run on the corporate boxes, they usually don't run and need the VCredist installed. ] Back to the question at hand: The text looks better with the UseCompatibleTextRendering set to false, so I'd rather keep it that way, if I can. I'd like to understand what might be missing on those XP boxes that is making the text not fit. Thanks S

    Read the article

  • Another boost error

    - by user1676605
    On this code I get the enourmous error static void ParseTheCommandLine(int argc, char *argv[]) { int count; int seqNumber; namespace po = boost::program_options; std::string appName = boost::filesystem::basename(argv[0]); po::options_description desc("Generic options"); desc.add_options() ("version,v", "print version string") ("help", "produce help message") ("sequence-number", po::value<int>(&seqNumber)->default_value(0), "sequence number") ("pem-file", po::value< vector<string> >(), "pem file") ; po::positional_options_description p; p.add("pem-file", -1); po::variables_map vm; po::store(po::command_line_parser(argc, argv). options(desc).positional(p).run(), vm); po::notify(vm); if (vm.count("pem file")) { cout << "Pem files are: " << vm["pem-file"].as< vector<string> >() << "\n"; } cout << "Sequence number is " << seqNumber << "\n"; exit(1); ../../../FIXMarketDataCommandLineParameters/FIXMarketDataCommandLineParameters.hpp|98|error: no match for ‘operator<<’ in ‘std::operator<< [with _Traits = std::char_traits](((std::basic_ostream &)(& std::cout)), ((const char*)"Pem files are: ")) << ((const boost::program_options::variable_value*)vm.boost::program_options::variables_map::operator[](((const std::string&)(& std::basic_string, std::allocator (((const char*)"pem-file"), ((const std::allocator&)((const std::allocator*)(& std::allocator()))))))))-boost::program_options::variable_value::as with T = std::vector, std::allocator , std::allocator, std::allocator ’|

    Read the article

  • why create CLSID_CaptureGraphBuilder2 instance always failed in a machine

    - by Yigang Wu
    It's a real strange issue, the machine information below is from DXDiag. There is no error reported, but create CLSID_CaptureGraphBuilder2 instance always failed in the machine. It's okay to create CLSID_FilterGraph. Before create CLSID_CaptureGraphBuilder2, I have called CoInitialize and created CLSID_FilterGraph. Only this machine has the error, what dll related with this interface or any function needed to call before to make it work? Thanks in advance. System Information Time of this report: 4/24/2010, 09:46:58 Machine name: TURION Operating System: Windows XP Home Edition (5.1, Build 2600) Service Pack 3 (2600.xpsp_sp3_qfe.100216-1510) Language: Japanese (Regional Setting: Japanese) System Manufacturer: To Be Filled By O.E.M. System Model: MS-7145 BIOS: Default System BIOS Processor: AMD Turion(tm) 64 Mobile Technology MT-30, MMX, 3DNow, ~1.6GHz Memory: 768MB RAM Page File: 376MB used, 1401MB available Windows Dir: C:\WINDOWS DirectX Version: DirectX 9.0c (4.09.0000.0904) DX Setup Parameters: Not found DxDiag Version: 5.03.2600.5512 32bit Unicode DxDiag Notes DirectX Files Tab: No problems found. Display Tab 1: No problems found. Sound Tab 1: No problems found. Sound Tab 2: No problems found. Music Tab: No problems found. Input Tab: No problems found. Network Tab: No problems found.

    Read the article

  • How do I place widgets above and below a listview?

    - by Jay Askren
    I have a list view and want to put stuff both above(on the y axis) and below(y axis) it including images, text views, and a row of buttons. Below is a simplified version of what I am creating. Unfortunately the list covers(i.e. above on the z axis) the header so the header text is not visible instead of being underneath (on the y axis) <?xml version="1.0" encoding="utf-8"?> <RelativeLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="wrap_content" android:layout_height="wrap_content"> <TextView android:id="@+id/footer" android:text="footer" android:layout_height="wrap_content" android:layout_width="fill_parent" android:layout_alignParentBottom="true" /> <ListView android:id="@+id/list_view" android:layout_height="fill_parent" android:layout_width="fill_parent" android:layout_above="@id/footer" android:background="#ff9999ff"/> <TextView android:id="@+id/header" android:text="header" android:layout_height="wrap_content" android:layout_width="fill_parent" android:layout_alignParentTop="true" android:layout_above="@id/list_view" android:baselineAlignBottom="false" /> </RelativeLayout> Here is the corresponding Activity class: public class SampleListActivity extends Activity { @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.list_activity); } }

    Read the article

  • Why does the Maven goal "package" include the resources in the jar, but the goal "jar:jar" doesnt?

    - by Bernhard V
    Hi, when I package my project with the Maven goal "package", the resources are included as well. They are originally located in the directory "src/main/resources". Because I want to create an executable jar and add the classpath to the manifest, I'm using maven-jar-plugin. I've configured it as the following likes: <plugin> <groupId>org.apache.maven.plugins</groupId> <artifactId>maven-jar-plugin</artifactId> <version>2.2</version> <configuration> <archive> <manifest> <addClasspath>true</addClasspath> <mainClass>at.sozvers.stp.zpv.ekvkumsetzer.Main</mainClass> </manifest> </archive> </configuration> </plugin> Why won't the jar file created with "jar:jar" include my resources as well. As far as I'm concerned it should use the same directories as the "package" goal (which are in my case inherited from the Maven Super POM).

    Read the article

  • Mysql Query is not working, why?

    - by Furkan Kadioglu
    Im using this example: www.jtable.org Now i download to jtable php version. And i edited script. Jtable simple version is working but my edition is doesnt working. I can do list, but i cant do add a row; this codes having problem. But php doesnt giving any error. else if($_GET["action"] == "create") { //Insert record into database $result = mysql_query("INSERT INTO veriler(bolge, sehir, firma, adres, tel, web) VALUES('" . $_POST["bolge"] . "', '" . $_POST["sehir"] . "', '" . $_POST["firma"] . "', '" . $_POST["adres"] . "', '" . $_POST["tel"] . "', '" . $_POST["web"] . "'"); //Get last inserted record (to return to jTable) $result = mysql_query("SELECT * FROM veriler WHERE id = LAST_INSERT_ID();"); $row = mysql_fetch_array($result); //Return result to jTable $jTableResult = array(); $jTableResult['Result'] = "OK"; $jTableResult['Record'] = $row; print json_encode($jTableResult); } if you doesnt understand, please ask me question. Where is the problem?

    Read the article

  • some problem with iOS 4.2.1

    - by bicbac
    Hi, I've been developing an app with MacBook Pro (MBP) so far. Last week one of my friends gave me new macbook air 11"(MBA). so Now I can test my code with more than one machine with the same version of developing tools - Both machine has Xcode (3.2.5) and iOS SDK 4.2.1). After some point my app starts get terminated suddenly(iPhone sumulator), and I was using MBP. I got no error message whatsoever. it just stops. I reckon the crash comes from dealing with memory, like 'release'/ 'double-release'. (I'm not 100% sure though). Anyway I thought there must be some mistake within my code for sure. -Confusion starts from this part.- With my MBA, on the other hand, I don'y see any crash. It just works fine. There is nothing different between MBA & MBP except the h/w specifications. Same code, same versions of XCode and iOS SDK. Is the fact that no crash at MBA suggesting that I have to look somewhere else than the code itself? I red some article and Q&As on iOS4.2.1 and XCode 3.2.5 that the most recent version of XCode doesn't recognize the iOS 4.2.1 since the 4.2.1 came out later the 3.2.5. Is it the reason? I have no idea at this moment what should be the next move. thanks

    Read the article

  • Reading the .vcproj file with C#

    - by Dulantha Fernando
    We create the vcproj file with the makefileproj keyword so we can use our own build in VS. My question is, using C#, how do you read the "C++" from the following vcproj file: <?xml version="1.0" encoding="Windows-1252"?> <VisualStudioProject ProjectType="Visual C++" Version="8.00" Name="TestCSProj" ProjectGUID="{840501C9-6AFE-8CD6-1146-84208624C0B0}" RootNamespace="TestCSProj" Keyword="MakeFileProj" > <Platforms> <Platform Name="x64" /> <Platform Name="C++" ===> I need to read "C++" /> </Platforms> I used XmlNode and got upto the second Platform: String path = "C:\\blah\\TestCSProj\\TestCSProj\\TestCSProj.vcproj"; FileStream fs = new FileStream(path, FileMode.Open, FileAccess.Read, FileShare.ReadWrite); XmlDocument xmldoc = new XmlDocument(); xmldoc.Load(fs); XmlNodeList oldFiles = xmldoc.GetElementsByTagName("Platform"); XmlAttribute name = oldFiles[1].Attributes[0]; Console.WriteLine(name.Name); This will print Name, but I need "C++". How do I read that? Thank you very much in advance

    Read the article

  • View Source and Chrome Developer Tools showing different output

    - by patricksweeney
    I have a page located here. Viewing it in Chrome and Firefox show a really small h1 title, and also it changes color as if it is a link. The template that generates everything looks exactly how it should be. When diagnosing the issue, the relevant section of code looks like this when I go to view source: <div class="page-heading"> <h1>Title Here</h1> </div> However, when I go to view it in Chrome's Developer tools, it is throwing in extraneous malformed anchor tags, which is obviously causing the hovering behavior. This is what it looks like to the dev tools: <div class="page-heading"> <h1> <a style="font-family: arial; font-size: 9px" <="" a="">Title Here</a> </h1> </div> In addition, when viewing a local copy of the site, the output shown in the dev tools is the same as viewing the source and they both render correctly locally. Oddly enough, all version of IE render it correctly. The current version of both Chrome and Firefox both render it weirdly. Initially I thought it may be a user agent stylesheet problem, but if anything the CSS is fine, it's the HTML that is malformed.

    Read the article

  • With ASP.NET MVC, what is the preferred way to Ajaxify a simple form?

    - by Swoop
    I am trying to add a simple comments/message box to a web page. When the user enters the comment and hits submit, I would like to save this message to the database and add the comment to the list displayed on the page, without refreshing the entire page. However, I am not sure of the best way to do that these days. I am using ASP.NET MVC 2. I have been trying to read up on using JQuery for this type of functionality, but I am having problems getting a full picture of the correct approach that isn't also out of date (i.e. it is using an preview version of MVC 1 or older version of JQuery). I can either find snippets of different pieces without the information of how they work together, or the information appears to be quite dated and no longer valid. Can someone point me in the right direction for something like this? Ideally, I am looking for a simple example of the JQuery code, a snippet of any key differences in an HTML form from a normal post method, and the basic method used in the MVC Controller. I need something to help the lightbulb of understanding to turn on. :) Any help would be greatly appreciated!!

    Read the article

  • Echoing variable construct instead of content

    - by danp
    I'm merging two different versions of a translations array. The more recent version has a lot of changes, over several thousand lines of code. To do this, I loaded and evaluated the new file (which uses the same structure and key names), then loaded and evaluated the older version, overwriting the new untranslated values in the array with the values we already have translated. So far so good! However, I want to be able to echo out the constructor for this new merged array so I can cut and paste it into the new translation file, and have job done (apart from completing the rest of the translations..). The code looks like this (lots of different keys, not just index): $lang["index"]["chart1_label1"] = "Subscribed"; $lang["index"]["chart1_label2"] = "Unsubscribed"; And the old.. $lang["index"]["chart1_label1"] = "Subscrito"; $lang["index"]["chart1_label2"] = "Não subscrito"; After loading the two files, I end up with a merged $lang array, which I then want to echo out in the same form, so it can be used by the project. However, when I do something like this.. foreach ($lang as $key => $value) { if (is_array($value)) { foreach ($value as $key2 => $value2) { echo "$lang['".$key."']"; // ... etc etc } } } ..obviously I get "ArrayIndex" etc etc instead of "$lang". How to echo out $lang without it being evaluated..? Once this is working, can add in the rest of the brackets etc (I realise they are missing), but just want to make this part work first. If there's a better way to do this, all ears too! Thanks.

    Read the article

  • xsl:template match doesn't find matches

    - by dmo
    I'm trying to convert some Xaml to HTML using the .NET XslCompiledTransform and am running into difficulties getting the xslt to match Xaml tags. For instance with this Xaml input: <FlowDocument PagePadding="5,0,5,0" AllowDrop="True" NumberSubstitution.CultureSource="User" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation"> <Paragraph>a</Paragraph> </FlowDocument> And this xslt: <?xml version="1.0" encoding="utf-8"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:msxsl="urn:schemas-microsoft-com:xslt" exclude-result-prefixes="msxsl" > <xsl:output method="html" indent="yes"/> <xsl:template match="/"> <html> <body> <xsl:apply-templates /> </body> </html> </xsl:template> <xsl:template match="FlowDocument"> <xsl:apply-templates /> </xsl:template> <xsl:template match="Paragraph" > <p> <xsl:apply-templates /> </p> </xsl:template> I get this output: <html> <body> a </body> </html> Rather than the expected: <html> <body> <p>a</p> </body> </html> Could this be a problem with the namespace? This is my first attempt at an xsl transform, so I'm at a loss.

    Read the article

  • Sharepoint Active directory forms authentication

    - by Sushant
    Hi, I am devloping a sharepoint website in Forms authentication mode. I am trying to authenticate myself/ my company users against company's active directory. The ldap path I received from my technical team is LDAP://infinmumcfac.inf.com OU=Infotech,DC=inf,DC=com I got this piece of code from microsoft site. <membership defaultProvider="LdapMembershipProvider"> <providers> <add name="LdapMembership" type="Microsoft.Office.Server.Security.LDAPMembershipProvider, Microsoft.Office.Server, Version=12.0.0.0, Culture=neutral, PublicKeyToken=71E9BCE111E9429C" server="DC" port="389" useSSL="false" userDNAttribute="distinguishedName" userNameAttribute="sAMAccountName" userContainer="CN=Users,DC=userName,DC=local" userObjectClass="person" userFilter="(|(ObjectCategory=group)(ObjectClass=person))" scope="Subtree" otherRequiredUserAttributes="sn,givenname,cn" /> </providers> </membership> The site asked me to change the Server and Usercontainer attribute. I have modified the code to <membership defaultProvider="LdapMembershipProvider"> <providers> <add name="LdapMembership" type="Microsoft.Office.Server.Security.LDAPMembershipProvider, Microsoft.Office.Server, Version=12.0.0.0, Culture=neutral, PublicKeyToken=71E9BCE111E9429C" server=” infinmumcfac.inf.com” port="389" useSSL="false" userDNAttribute="distinguishedName" userNameAttribute="sAMAccountName" userContainer=" OU=Infotech,DC=inf,DC=com " userObjectClass="person" userFilter="(|(ObjectCategory=group)(ObjectClass=person))" scope="Subtree" otherRequiredUserAttributes="sn,givenname,cn" /> </providers> </membership> I placed this code in web.config file of central administration site and my sharepoint website . I am still facing login issues. Any help or insight would be highly grateful.Thanking in anticipation.

    Read the article

  • AIX 6.1 unable to build apache module

    - by user3715581
    In Aix 6.1/ Apache version 2.2.8 packaged as part of IBM WebSphere. We should have had mod_dumpio for this version but for some reasons IBM did not include it. So we are trying to build this module(in few many ways) but none of them worked. 1) Using apxs:- Failed with the "xlc_r" not found as compile option for libtool. So based on an article online, we changed to "gcc" and we have to remove -qmaxmem and -qHALT to make it work. Result we see a .lo created but LoadModule fails(unable to find .loader section). 2) Using gcc:- Command "gcc -fpic -DSHARED_MODULE -I -c mod_dumpio.c" After running this command, we can see .o file created and then we tried to execute "ld -Bshareable -o mod_dumpio.so mod_dumpio.o" whereas AIX complaining about -Bshareable so we tried using this command "gcc -shared -I -o mod_dumpio.so mod_dumpio.o" whereas the error was "libgcc_s" not found. Then we added -static-libgcc to the above command and it was not resolving .h file functions (Unknown symbols). From IBM AIX site, libgcc_s costs around $2k. We think our second approach may work but we dont know how to instruct gcc to look for .h files while building .so from .o. Any help is appreciated.

    Read the article

  • Flex 3 (Action Script): How to access a function from a loaded swf-file ?

    - by Trantec
    Hi, i load in ActionScript a swf file. So far no Problem, but I didn't found a way to access one of it's functions, the best thing would be if I could access the main function in the mxml part of the swf. Here is the code of the main-mxml file that belongs to the swf that should load and access another swf: <?xml version="1.0" encoding="utf-8"?> <mx:Application xmlns:mx="http://www.adobe.com/2006/mxml" layout="absolute" initialize="basket();"> <mx:Script> <![CDATA[ import mx.controls.SWFLoader; private function basket(): void { var swfLoader: SWFLoader = new SWFLoader(); swfLoader.addEventListener( Event.COMPLETE, handleSWFLoaded ); try { swfLoader.load( "../../data/InternalSWF.swf" ); } catch (error: Error) { trace( "Couldn't load file !" ); } } private function handleSWFLoaded( event: Event ): void { var swfApp:* = event.target.content; // This both ways don't work... //if (swfApp.hasOwnProperty("initApp")) { // var initApp:Function = (swfApp["initApp"] as Function); // initApp(); //} // swfApp.initApp(); } ]]> </mx:Script> <mx:Text id="output" width="100%" textAlign="center" /> </mx:Application> The if-Statement "if (swfApp.hasOwnProperty("initApp")) {" is never true and the call "swfApp.initApp()" says that this function does not exist. In the original version I added event listeners for HTTPStatusEvent.HTTP_STATUS, IOErrorEvent.IO_ERROR and SecurityErrorEvent.SECURITY_ERROR. But except for HTTP_STATUS = 0 none of them are called. Is the whole idea of how i try to do this wrong ?

    Read the article

  • Kohana Auth Library Deployment

    - by Steve
    My Kohana app runs perfectly on my local machine. When I deployed my app to a server (and adjust the config files appropriately), I can no longer log into the app. I've traced through the app login routine on both my local version and the server version and they both agree with each other all the way through until you get to the auth.php controller logged_in() routine where suddenly, at line 140 - the is_object($this-user) test - the $user object no longer exists!?!?!? The login() function call that calls the logged_in() function successfully passes the following test, which causes a redirect to the logged_in() function. if(Auth::instance()->login($user, $post['password'])) Yes, the password and hash, etc all work perfectly. Here is the offending code: public function logged_in() { if ( ! is_object($this->user)) { // No user is currently logged in url::redirect('auth/login'); } etc... } As the code is the same between my local installation and the server, I reckon it must be some server setting that is messing with me. FYI: All the rest of the code works because I have a temporary backdoor available that allows me to use the application (view pages of tables, etc) without being logged in. Any ideas?

    Read the article

  • Passing an arbritrary JavaScript object in Xul

    - by Tom Brito
    I'm following this example to pass an object to a window, but when it as an argument it's with "undefined" value. This is my first window (obs. dump is the way to print to console when debug options are turned on): <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <!DOCTYPE window SYSTEM "chrome://XulWindowArgTest/locale/XulWindowArgTest.dtd"> <window id="windowID" width="400" height="300" xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul"> <script> <![CDATA[ function onClickMe(event) { dump("begin\n"); try { var args = { param1: true, param2: 42 }; args.wrappedJSObject = args; var watcher = Components.classes["@mozilla.org/embedcomp/window-watcher;1"].getService(Components.interfaces.nsIWindowWatcher); watcher.openWindow(null, "chrome://XulWindowArgTest/content/about.xul", "windowName", "chrome", args); } catch (e) { dump("error: " + e + "\n"); } dump("end\n"); } ]]> </script> <button label="Click me !" oncommand="onClickMe();" /> </window> and my second window: <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <!DOCTYPE window SYSTEM "chrome://XulWindowArgTest/locale/XulWindowArgTest.dtd"> <window xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul" onload="onload()"> <script> <![CDATA[ function onload() { dump('arg = ' + window.arguments[0].wrappedJSObject + "\n"); } ]]> </script> <label value="test" /> </window> when the second window loads, it calls the onload and prints: arg = undefined Any idea how to fix it?

    Read the article

  • Android Organizing Strings.xml

    - by Neb
    I'm making an android app and since I've just started I want to try get the most organised code/resources. In my strings.xml file so far I have this: <?xml version="1.0" encoding="utf-8"?> <resources> <string name="app_name">GameController</string> <string name="stop">Stop</string> <string name="start">Start</string> <string name="preferences">Preferences</string> <string name="back">Back</string> </resources> All of the strings except app_name are used in an options menu. But since I will be adding much more strings I was thinking that it might be better to do something like this: <?xml version="1.0" encoding="utf-8"?> <resources> <string name="app_name">GameController</string> <string name="menu_stop">Stop</string> <string name="menu_start">Start</string> <string name="menu_preferences">Preferences</string> <string name="menu_back">Back</string> </resources> Is it the best way or should I use another system?

    Read the article

  • Can I have two names for the same variable?

    - by Roman
    The short version of the question: I do: x = y. Then I change x, and y is unchanged. What I want is to "bind" x and y in such a way that I change y whenever I change x. The extended version (with some details): I wrote a class ("first" class) which generates objects of another class ("second" class). In more details, every object of the second class has a name as a unique identifier. I call a static method of the first class with a name of the object from the second class. The first class checks if such an object was already generated (if it is present in the static HashMap of the first class). If it is already there, it is returned. If it is not yet there, it is created, added to the HashMap and returned. And then I have the following problem. At some stage of my program, I take an object with a specific name from the HashMap of the first class. I do something with this object (for example change values of some fields). But the object in the HashMap does not see these changes! So, in fact, I do not "take" an object from the HashMap, I "create a copy" of this object and this is what I would like to avoid.

    Read the article

  • optimistic and pessimistic locks

    - by billmce
    Working on my first php/Codeigniter project and I’ve scoured the ‘net for information on locking access to editing data and haven’t found very much information. I expect it to be a fairly regular occurrence for 2 users to attempt to edit the same form simultaneously. My experience (in the stateful world of BBx, filePro, and other RAD apps) is that the data being edited is locked using a pessimistic lock—one user has access to the edit form at the time. The second user basically has to wait for the first to finish. I understand this can be done using Ajax sending XMLHttpRequests to maintain a ‘lock’ database. The php world, lacking state, seems to prefer optimistic locking. If I understand it correctly it works like this: both users get to access the data and they each record a ‘before changes’ version of the data. Before saving their changes, the data is once again retrieved and compared the ‘before changes’ version. If the two versions are identical then the users changes are written. If they are different; the user is shown what has changed since he/she started editing and some mechanism is added to resolve the differences—or the user is shown a ‘Sorry, try again’ message. I’m interested in any experience people here have had with implementing both pessimistic and optimistic locking. If there are any libraries, tools, or ‘how-to’s available I’m appreciate a link. Thanks

    Read the article

  • C# ? Can anyone explain the strange behaviour?

    - by partizan
    Hi, guys. Here is the example with comments: class Program { // first version of structure public struct D1 { public double d; public int f; } // during some changes in code then we got D2 from D1 // Field f type became double while it was int before public struct D2 { public double d; public double f; } static void Main(string[] args) { // Scenario with the first version D1 a = new D1(); D1 b = new D1(); a.f = b.f = 1; a.d = 0.0; b.d = -0.0; bool r1 = a.Equals(b); // gives true, all is ok // The same scenario with the new one D2 c = new D2(); D2 d = new D2(); c.f = d.f = 1; c.d = 0.0; d.d = -0.0; bool r2 = c.Equals(d); // false, oops! this is not the result i've expected for } } So, what do you think about this?

    Read the article

  • INotifyPropertyChanged Setter Style

    - by Ivovic
    In order to reflect changes in your data to the UI you have to implement INotifyPropertyChanged, okay. If I look at examples, articles, tutorials etc most of the time the setters look like something in that manner: public string MyProperty { //get [...] set { if (_correspondingField == value) { return; } _correspondingField = value; OnPropertyChanged("MyProperty"); } } No problem so far, only raise the event if you have to, cool. But you could rewrite this code to this: public string MyProperty { //get [...] set { if (_correspondingField != value) { _correspondingField = value; OnPropertyChanged("MyProperty"); } } } It should do the same (?), you only have one place of return, it is less code, it is less boring code and it is more to the point ("only act if necessary" vs "if not necessary do nothing, the other way round act"). So if the second version has its pros compared to the first one, why I see this style rarely? I don't consider myself being smarter than those people that write frameworks, published articles etc, therefore the second version has to have drawbacks. Or is it wrong? Or do I think too much? Thanks in advance

    Read the article

< Previous Page | 513 514 515 516 517 518 519 520 521 522 523 524  | Next Page >