Search Results

Search found 31206 results on 1249 pages for 'version detection'.

Page 515/1249 | < Previous Page | 511 512 513 514 515 516 517 518 519 520 521 522  | Next Page >

  • How to append new elements to Xml from stream

    - by Wololo
    I have a method which returns some xml in a memory stream private MemoryStream GetXml() { XmlWriterSettings settings = new XmlWriterSettings(); settings.Indent = true; using (MemoryStream memoryStream = new MemoryStream()) { using (XmlWriter writer = XmlWriter.Create(memoryStream, settings)) { writer.WriteStartDocument(); writer.WriteStartElement("root"); writer.WriteStartElement("element"); writer.WriteString("content"); writer.WriteEndElement(); writer.WriteEndElement(); writer.WriteEndDocument(); writer.Flush(); } return memoryStream; } } In this example the format of the xml will be: <?xml version="1.0" encoding="utf-8"?> <root> <element>content</element> </root> How can i insert a new element under the root e.g <?xml version="1.0" encoding="utf-8"?> <root> <element>content</element> ----->New element here <------ </root>

    Read the article

  • C: Fifo between threads, writing and reading strings

    - by Yonatan
    Hello once more dear internet, I writing a small program that among other things, writes a log file of commands received. to do that, I want to use a thread that all it should do is just attempt to read from a pipe, while the main thread will write into that pipe whenever it should. Since i don't know the length of each string command, i thought about writing and reading the pointer to the char buf[MAX_MESSAGE_LEN]. Since what i've tried so far doesn't work, i'll post my best effort :P char str[] = "hello log thread 123456789 10 11 12 13 14 15 16 17 18 19\n"; if (pipe(pipe_fd) != 0) return -1; pthread_t log_thread; pthread_create(&log_thread,NULL, log_thread_start, argv[2]); success_write = 0; do { write(pipe_fd[1],(void*)&str,sizeof(char*)); } while (success_write < sizeof(char*)); and the thread does this: char buffer[MAX_MSGLEN]; int success_read; success_read = 0; //while(1) { do { success_read += read(pipe_fd[0],(void*)&buffer, sizeof(char*)); } while (success_read < sizeof(char*)); //} printf("%s",buffer); (Sorry if this doesn't indent, i can't seem to figure out this editor...) oh, and pipe_fd[2] is a global parameter. So, any help with this, either by the way i thought of, or another way i could read strings without knowing the length, would be much appreciated. On a side note, i'm working on Eclipse IDE C/C++, version 1.2.1 and i can't seem to set up the compiler so it will link the pthread library to my project. I've resorted to writing my own Makefile to make it (pun intended :P) work. Anyone knows what to do ? i've looked online, but all i find are solutions that are probably good on an older version because the tabs and option keys are different. Anyways, Thanks a bunch internet ! Yonatan

    Read the article

  • Recoverable error while running XSL

    - by Kate
    XSL: <?xml version="1.0" encoding="utf-8"?> <xsl:stylesheet xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:ve="http://schemas.openxmlformats.org/markup-compatibility/2006" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:r="http://schemas.openxmlformats.org/officeDocument/2006/relationships" xmlns:m="http://schemas.openxmlformats.org/officeDocument/2006/math" xmlns:v="urn:schemas-microsoft-com:vml" xmlns:wp="http://schemas.openxmlformats.org/drawingml/2006/wordprocessingDrawing" xmlns:w10="urn:schemas-microsoft-com:office:word" xmlns:w="http://schemas.openxmlformats.org/wordprocessingml/2006/main" xmlns:wne="http://schemas.microsoft.com/office/word/2006/wordml" exclude-result-prefixes="wp wne w10 w ve o r m v" version="2.0"> <xsl:output method="text"/> <xsl:param name="styleName"/> <xsl:template match="w:p"> <xsl:apply-templates/><xsl:text>&#10;</xsl:text> </xsl:template> <xsl:template match="w:r[not ((parent::w:hyperlink[@w:anchor[matches(.,concat('^(',$styleName,')')),'i']]))]"> <xsl:value-of select="replace(., '.', '&#xFF00;')"/> </xsl:template> </xsl:stylesheet> While processing the above XSL, I am getting the below error, Recoverable Error: Recoverable error on line 11 FORG0006: An error occurred matching pattern {w:r[not ((parent::w:hyperlink[@w:anchor[matches(.,concat('^(',$styleName,')')),'i']]))]}: Effective boolean value is not defined for a sequence of two or more items starting with a boolean Please Help. I am not able to figure out this.

    Read the article

  • Maintenance tool for Application Database

    - by Thierry
    Hello ! Does anybody know about a good tool which help maintaining the database of an application ? I'm working on an application which uses a database (Microsoft Sql Server). When a development requires to change something in the database (e.g., structure, data migration...), we create a script (Transact-SQL script) and add it into our revision control tool (subversion - that tool also contains our code). Each script must add a line in a log table to keep a trace of all the scripts that have been ran into a database. In order to build a database for our application, one needs to run all scripts ordered by their creation date. I'm not really happy with this technique notably because it make application migration a bit hard. If we want to install a new version of the application somewhere, e.g., migrate from version 1.3 to 2.1, we must get all the scripts between these two versions. Then run them and ensure that everything is done in a transaction... For sure we could built home-made tools to help but I wonder if some tools already exists to do that kind of job.

    Read the article

  • Database cache that I'm not aware of?

    - by Martin
    I'm using asp.net mvc, linq2sql, iis7 and sqlserver express 2008. I get these intermittent server errors, primary key conflicts on insertion. I'm using a different setup on my development computer so I can't debug. After a while they go away. Restarting iis helps. I'm getting the feeling there is cache somewhere that I'm not aware of. Can somebody help me sort out these errors? Cannot insert duplicate key row in object 'dbo.EnquiryType' with unique index 'IX_EnquiryType'. Edits regarding Venemos answer Is it possible that another application is also accessing the same database simultaneously? Yes there is, but not this particular table and no inserts or updates. There is one other table with which I experience the same problem but it has to do with a different part of the model. How often an in what context do you create a new DataContext instance? Only once, using the singleton pattern. Are the primary keys generated by the database or by the application? Database. Which version of ASP.NET MVC and which version of .NET are you using? RC2 and 3.5.

    Read the article

  • waveInProc / Windows audio question...

    - by BTR
    I'm using the Windows API to get audio input. I've followed all the steps on MSDN and managed to record audio to a WAV file. No problem. I'm using multiple buffers and all that. I'd like to do more with the buffers than simply write to a file, so now I've got a callback set up. It works great and I'm getting the data, but I'm not sure what to do with it once I have it. Here's my callback... everything here works: // Media API callback void CALLBACK AudioRecorder::waveInProc(HWAVEIN hWaveIn, UINT uMsg, DWORD dwInstance, DWORD dwParam1, DWORD dwParam2) { // Data received if (uMsg == WIM_DATA) { // Get wav header LPWAVEHDR mBuffer = (WAVEHDR *)dwParam1; // Now what? for (unsigned i = 0; i != mBuffer->dwBytesRecorded; ++i) { // I can see the char, how do get them into my file and audio buffers? cout << mBuffer->lpData[i] << "\n"; } // Re-use buffer mResultHnd = waveInAddBuffer(hWaveIn, mBuffer, sizeof(mInputBuffer[0])); // mInputBuffer is a const WAVEHDR * } } // waveInOpen cannot use an instance method as its callback, // so we create a static method which calls the instance version void CALLBACK AudioRecorder::staticWaveInProc(HWAVEIN hWaveIn, UINT uMsg, DWORD_PTR dwInstance, DWORD_PTR dwParam1, DWORD_PTR dwParam2) { // Call instance version of method reinterpret_cast<AudioRecorder *>(dwParam1)->waveInProc(hWaveIn, uMsg, dwInstance, dwParam1, dwParam2); } Like I said, it works great, but I'm trying to do the following: Convert the data to short and copy into an array Convert the data to float and copy into an array Copy the data to a larger char array which I'll write into a WAV Relay the data to an arbitrary output device I've worked with FMOD a lot and I'm familiar with interleaving and all that. But FMOD dishes everything out as floats. In this case, I'm going the other way. I guess I'm basically just looking for resources on how to go from LPSTR to short, float, and unsigned char. Thanks much in advance!

    Read the article

  • xsl:for-each not supported in this context

    - by alexbf
    Hi! I have this XSLT document : <xsl:stylesheet version="1.0" xmlns:mstns="http://www.w3.org/2001/XMLSchema" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:output method="xml" version="1.0" encoding="UTF-8" indent="yes"/> <xsl:template match="/MyDocRootElement"> <xs:schema id="DataSet" targetNamespace="http://www.w3.org/2001/XMLSchema" attributeFormDefault="qualified" elementFormDefault="qualified" > <xs:element name="DataSet" msdata:IsDataSet="true"> <xs:complexType> <xs:choice maxOccurs="unbounded"> <xs:element name="Somename"> </xs:element> <xs:element name="OtherName"> </xs:element> <!-- FOR EACH NOT SUPPORTED? --> <xsl:for-each select="OtherElements/SubElement"> <xs:element name="OtherName"> </xs:element> </xsl:for-each> </xs:choice> </xs:complexType> </xs:element> </xs:schema> </xsl:template> </xsl:stylesheet> I have a validation error saying that the "for-each element is not supported in this context" I am guessing it has something to do with the xs namespace validation. Any ideas on how can I make this work? (Exclude validation?) Thanks Alex

    Read the article

  • How to use linux csplit to chop up massive XML file?

    - by Fred
    Hi everyone, I have a gigantic (4GB) XML file that I am currently breaking into chunks with linux "split" function (every 25,000 lines - not by bytes). This usually works great (I end up with about 50 files), except some of the data descriptions have line breaks, and so frequently the chunk files do not have the proper closing tags - and my parser chokes halfway through processing. Example file: (note: normally each "listing" xml node is supposed to be on its own line) <?xml version="1.0" encoding="UTF-8"?> <listings> <listing><date>2009-09-22</date><desc>This is a description WITHOUT line breaks and works fine with split</desc><more_tags>stuff</more_tags></listing> <listing><date>2009-09-22</date><desc>This is a really annoying description field WITH line breaks that screw the split function</desc><more_tags>stuff</more_tags></listing> </listings> Then sometimes my split ends up like <?xml version="1.0" encoding="UTF-8"?> <listings> <listing><date>2009-09-22</date><desc>This is a description WITHOUT line breaks and works fine with split</desc><more_tags>stuff</more_tags></listing> <listing><date>2009-09-22</date><desc>This is a really annoying description field WITH line breaks ... EOF So - I have been reading about "csplit" and it sounds like it might work to solve this issue. I cant seem to get the regular expression right... Basically I want the same output of ~50ish files Something like: *csplit -k myfile.xml '/</listing>/' 25000 {50} Any help would be great Thanks!

    Read the article

  • C#; On casting to the SAME class that came from another assembly

    - by G. Stoynev
    For complete separation/decoupling, I've implemented a DAL in an assebly that is simply being copied over via post-build event to the website BIN folder. The website then on Application Start loads that assembly via System.Reflection.Assembly.LoadFile. Again, using reflection, I construct a couple of instances from classes in that assembly. I then store a reference to these instances in the session (HttpContext.Current.Items) Later, when I try to get the object stored in the session, I am not able to cast them to their own types (was trying interfaces initially, but for debugging tried to cast to THEIR OWN TYPES), getting this error: [A]DAL_QSYSCamper.NHibernateSessionBuilder cannot be cast to [B] DAL_QSYSCamper.NHibernateSessionBuilder. Type A originates from 'DAL_QSYSCamper, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null' in the context 'Default' at location 'C:\Users\dull.anomal\AppData\Local\Temp\Temporary ASP.NET Files\root\ad6e8bff\70fa2384\assembly\dl3\aaf7a5b0\84f01b09_b10acb01\DAL_QSYSCamper.DLL'. Type B originates from 'DAL_QSYSCamper, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null' in the context 'LoadNeither' at location 'C:\Users\dull.anomal\Documents\Projects\QSYS\Deleteme\UI\MVCClient\bin\DAL_QSYSCa mper.DLL'. This is happening while debugging in VS - VS manages to stop into the source DAL project even though I've loaded from assembly and the project is not refferenced by the website project (they're both in the solution). I do understand the error, but I don't understand how and why the assembly is being used/loaded from two locations - I only load it once from the file and there's no referrence to the project. Should mention that I also use Windsor for DI. The object that tries to extract the object from the session is A) from a class from that DAL assembly; B) is injected into a website class by Windsor. I will work on adding some sample code to this question, but wanted to put it out in case it's obvious what I do wrong.

    Read the article

  • TypeError: Object #<HTMLDocument> has no method 'observe' issue with the plugin chosen

    - by NewBoy
    Hi made attempts to install the Jquery plugin chosen which enables me to customise my <select> tag in all browsers. Click here Anyway i have integrated this pluigin into my site and i have come across the following error message in my element inspector..Click here "TypeError: Object # has no method 'observe'" from the following code <script type="text/javascript"> document.observe('dom:loaded', function(evt) { var select, selects, _i, _len, _results; if (Prototype.Browser.IE && (Prototype.BrowserFeatures['Version'] === 6 || Prototype.BrowserFeatures['Version'] === 7)) { return; } selects = $$(".chzn-select"); _results = []; for (_i = 0, _len = selects.length; _i < _len; _i++) { select = selects[_i]; _results.push(new Chosen(select)); } deselects = $$(".chzn-select-deselect"); for (_i = 0, _len = deselects.length; _i < _len; _i++) { select = deselects[_i]; _results.push(new Chosen(select,{allow_single_deselect:true})); } return _results; }); </script> Does anyone know how i can solve this problem??

    Read the article

  • cython setup.py gives .o instead of .dll

    - by alok1974
    Hi, I am a newbie to cython, so pardon me if I am missing something obvious here. I am trying to build c extensions to be used in python for enhanced performance. I have fc.py module with a bunch of function and trying to generate a .dll through cython using dsutils and running on win64: c:\python26\python c:\cythontest\setup.py build_ext --inplace I have the dsutils.cfg in C:\Python26\Lib\distutils. As required the disutils.cfg has the following config settings: [build] compiler = mingw32 My startup.py looks like this: from distutils.core import setup from distutils.extension import Extension from Cython.Distutils import build_ext ext_modules = [Extension('fc', [r'C:\cythonTest\fc.pyx'])] setup( name = 'FC Extensions', cmdclass = {'build_ext': build_ext}, ext_modules = ext_modules ) I have latest version mingw for target/host amdwin64 type builds. I have the latest version of cython for python26 for win64. Cython does give me an fc.c without errors, only a few warning for type conversions, which I will handle once I have it right. Further it produces fc.def an fc.o files Instead of giving a .dll. I get no errors. I find on threads that it will create the .so or .dll automatically as required, which is not happening.

    Read the article

  • Error running web project in eclipse

    - by DarkKnight
    I am a newbie to servlets. I created a dynamic web project in eclipse. I have following files in my project home.html validateServlet.java I have defined validated servlet as an action in home.html form. However when I run it, I get http status 404. Below is the hierarchy of my project Project Java Resources src com.servlets ValidateServlet.java build WebContent META-INF WEB-INF web.xml hello.html Contents of my web.xml are as follows: <?xml version="1.0" encoding="UTF-8"?> <web-app xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns="http://java.sun.com/xml/ns/javaee" xmlns:web="http://java.sun.com/xml/ns/javaee/web- app_2_5.xsd" xsi:schemaLocation="http://java.sun.com/xml/ns/javaee http://java.sun.com/xml/ns/javaee/web-app_3_0.xsd" id="WebApp_ID" version="3.0"> <display-name>Website</display-name> <servlet> <description></description> <display-name>ValidateServlet</display-name> <servlet-name>validate</servlet-name> <servlet-class>com.oracle.coen235.servlets.ValidateServlet</servlet-class> </servlet> </web-app> In my hello.html, action is specified as , What might be the issue? I guess I am not able to generate the class file for my servlet. Can anyone guide me through this problem?

    Read the article

  • Uninstalling Android Application

    - by Sosukodo
    When I create an Android project in Eclipse and send it to my device for debugging, the app works fine but when I try to uninstall it, I get a strange message. Below are the steps to recreate my problem: Eclipse Version: 4.2.0 Build id: I20120608-1400 ADT Version: 2.0.3 v201208082019-427395 Run Eclipse Click File-New-Project... Select Android/Android Application Project Click Next. Enter Application Name: Test Build SDK: Android 4.1 Minimum Required SDK: API 8 Android 2.2 Enable: Create custom launcher icon / Create project in workspace Click Next thrice. Click Finish. Connect 4.1 Android device to computer via USB. Click Run-Run from menu. Select "Android application" on popup the "Run As" popup. Click Ok. MainActivity application runs on device. Click the Back button on the Android device. Open applications on device and find "MainActivity" app. Long press the MainActivity icon and drag to trash. Here's the puzzling part: Instead of getting a standard Do you want to uninstall this app? I get a dialog with this text: MainActivity is part of the following app: Test Do you want to uninstall this app? Why do I get this message instead of the standard one? Why is MainActivity the name of the app when I specifically stated the name of the app is "Test"?

    Read the article

  • Why won't EF4 generate a method to support my Function Import?

    - by Deane
    I have a stored proc in my database which returns an integer. I added a Function Import to my model. This appears in the EDMX file: <Function Name="GetTotalEntityCount" Aggregate="false" BuiltIn="false" NiladicFunction="false" IsComposable="false" ParameterTypeSemantics="AllowImplicitConversion" Schema="dbo" /> However, no method actually gets generated for this. It should be top level, right? using (MyContext context = new MyContext()) { context.MyMethodShouldBeRightHere(); } Nothing appears in Intellisense, I've gone through the designer.cs file and there's nothing in there, and reflected the DLL...nothing. The code generator is just not generating any code to support this stored proc. I added another table to my database and updated the model, and that came in, so the model will update, it's just specifically ignoring this stored proc. I've tried everything I can think of, and consulted every resource I can find, and as near as I can tell, I'm doing everything right. I'm using EF4, database-first. (I'm pretty sure on the version, anyway. This shows up in the generated file: Runtime Version:4.0.30319.1 )

    Read the article

  • How do I get require_login()-like functionality using the new PHP Client Library for Facebook?

    - by cc
    Howdy. I've been tasked with making a Facebook game, but I'm new to Facebook development, so I'm just getting started. Apologies in advance if this is a no-brainer to people. I'm having trouble following all the examples I see on sites, and I keep running into missing pages in the Facebook documentation when I am trying to read up. I think it's because there's a new version of the PHP Client Library for Facebook, and everything I'm finding is referring to the old client. For instance, I see this code in a lot of examples: require 'facebook.php'; $facebook = new Facebook( array( 'appId' => '(id)', 'secret' => '(secret)' ) ); $facebook_account = $facebook->require_login(); ...but there's no "require_login()" in the client library provided in the facebook.php file. From what I can tell, it looks like Facebook has very recently rolled out some new system for development, but I don't see any sample code anywhere to deal with it. The new library comes with an "example.php" file, but it appears to be only for adding "Log in with Facebook" functionality to other sites (what I'm assuming is what they mean by "Facebook Connect" sites), not for just running apps in a Canvas page on Facebook itself. Specifically, what I need to do is let users visit an application page within Facebook, have it bring up the dialog box allowing them to authorize the app, have it show up in their "games" page, and then have it pass me the relevant info about the user so I can start creating the game. But I can't seem to find any tutorials or examples that show how to do this using the new library. Seems like this should be pretty straightforward, but I'm running into roadblocks. Or am I missing something about the PHP client library? Should require_login() be working for me, and there's something broken with my implementation, such as having the wrong client library or something? I downloaded from GitHub yesterday, so I'm pretty sure I have the most recent version of the code I have, but perhaps I'm downloading the wrong "facebook.php" file...?

    Read the article

  • Drupal view filter to show only one of a certain item

    - by Joel
    I'm fairly new to Drupal, and am using Node Import to take a TSV file and turn it into nodes. I'm hitting a problem, though, with automating updates to the nodes. Again, I'd like to take a Tab Separated Values text file, and load it into my site via Node Import (or whatever else anyone might suggest) and then only show updated Nodes. Here's a specific example: I have a Node with the following info: StoreId Name Address Phone Contact 01 Name1 Address1 Phone1 Contact1 02 Name2 Address2 Phone2 Contact2 etc. The info pulls into the nodes just fine (Thank you Node Import!), but we also want to process updates to the nodes. So far I have two ideas... figure out how to delete duplicate (previous) instances of the same StoreID, or just save the node with the duplicate StoreID (and new other info) and just display the most current version. In Views, I can get it to show the nodes and everything, but I can't figure out how to only display the most recent version of each StoreID. A view of views would work, but I can't seem to get that to work, either. Any ideas or other approaches I could take? Thanks in advance for the help!

    Read the article

  • PHP Pass Dynamic Array name to function

    - by Brad
    How do I pass an array key to a function to pull up the right key's data? // The array <?php $var['TEST1'] = Array ( 'Description' => 'This is a Description', 'Version' => '1.11', 'fields' => Array( 'ID' => array( 'type' => 'int', 'length' =>'11', 'misc' =>'auto_increment' ), 'DATA' => array( 'type' => 'varchar', ' length' => '255' ) ); $var['TEST2'] = Array ( 'Description' =? 'This is the 2nd Description', 'Version' => '2.1', 'fields' => Array( 'ID' => array( 'type' => 'int', 'length' =>'11', 'misc' =>'auto_increment' ), 'DATA' => array( 'type' => 'varchar', ' length' => '255' ) ) // The function <?php $obj = 'TEST1'; print_r($schema[$obj]); // <-- Fives me output. But calling the function doesn't. echo buildStructure($obj); /** * @TODO to add auto_inc support */ function buildStructure($obj) { $output = ''; $primaryKey = $schema["{$obj}"]['primary key']; foreach ($schema["{$obj}"]['fields'] as $name => $tag) // #### ERROR #### Invalid argument supplied for foreach() { $type = $tag['type']; $length = $tag['length']; $default = $tag['default']; $description = $tag['description']; $length = (isset($length)) ? "({$length})" : ''; $default = ($default == NULL ) ? "NULL" : $default; $output .= "`{$name}` {$type}{$length} DEFAULT {$default} COMMENT `{$DESCRIPTION}`, "; } return $output; }

    Read the article

  • Subversion freaking out on me!

    - by Malfist
    I have two copies of a site, one is the production copy, and the other is the development copy. I recently added everything in the production to a subversion repository hosted on our linux backup server. I created a tag of the current version and I was done. I then copied the development copy overtop of the production copy (on my local machine where I have everything checked out). There are only 10-20 files changed, however, when I use tortoise SVN to do a commit, it says every file has changed. The diff file generated shows subversion removing everything, and replacing it with the new version (which is the exact same). What is going on? How do I fix it? An example diff: Index: C:/Users/jhollon/Documents/Visual Studio 2008/Projects/saloon/trunk/components/index.html =================================================================== --- C:/Users/jhollon/Documents/Visual Studio 2008/Projects/saloon/trunk/components/index.html (revision 5) +++ C:/Users/jhollon/Documents/Visual Studio 2008/Projects/saloon/trunk/components/index.html (working copy) @@ -1,4 +1,4 @@ -<html> -<body bgcolor="#FFFFFF"> -</body> +<html> +<body bgcolor="#FFFFFF"> +</body> </html> \ No newline at end of file

    Read the article

  • Converting "A* Search" code from C++ to Java [on hold]

    - by mr5
    Updated! I get this code from this site It's A* Search Algorithm(finding shortest path with heuristics) I modify most of variable names and some if conditions from the original version to satisfy my syntactic taste. It works in C++ (as I can't see any trouble with it) but fails in Java version. Java Code: String findPath(int startX, int startY, int finishX, int finishY) { @SuppressWarnings("unchecked") LinkedList<Node>[] nodeList = (LinkedList<Node>[]) new LinkedList<?>[2]; nodeList[0] = new LinkedList<Node>(); nodeList[1] = new LinkedList<Node>(); Node n0; Node m0; int nlIndex = 0; // queueList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = new Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[nlIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[nlIndex].isEmpty() ) { LinkedList<Node> pq = nodeList[nlIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = new Node( pq.peek().getX(), pq.peek().getY(), pq.peek().getIterCount(), pq.peek().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[nlIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions String path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; int c = '0' + ( j + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; path = (char)c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < Node.DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!(xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( gridMap.getData( ydy, xdx ) == GridMap.WALKABLE || gridMap.getData( ydy, xdx ) == GridMap.FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = new Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[nlIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; // replace the node // by emptying one queueList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while( !(nodeList[nlIndex].peek().getX() == xdx && nodeList[nlIndex].peek().getY() == ydy ) ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nodeList[nlIndex].pop(); // remove the wanted node // empty the larger size queueList to the smaller one if( nodeList[nlIndex].size() > nodeList[ 1 - nlIndex ].size() ) nlIndex = 1 - nlIndex; while( !nodeList[nlIndex].isEmpty() ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nlIndex = 1 - nlIndex; nodeList[nlIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output1: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Misleading path) Output2: Changing these lines: n0 = new Node( a, b, c, d ); m0 = new Node( e, f, g, h ); to n0.set( a, b, c, d ); m0.set( e, f, g, h ); I get (I'm really confused) C++ Code: std::string A_Star::findPath(int startX, int startY, int finishX, int finishY) { typedef std::queue<Node> List_Container; List_Container nodeList[2]; // list of open (not-yet-tried) nodes Node n0; Node m0; int pqIndex = 0; // nodeList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[pqIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[pqIndex].empty() ) { List_Container &pq = nodeList[pqIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = Node( pq.front().getX(), pq.front().getY(), pq.front().getIterCount(), pq.front().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[pqIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions std::string path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; char c = '0' + ( j + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; path = c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!( xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( pGrid->getData(ydy,xdx) == WALKABLE || pGrid->getData(ydy, xdx) == FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[pqIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; // replace the node // by emptying one nodeList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while ( !( nodeList[pqIndex].front().getX() == xdx && nodeList[pqIndex].front().getY() == ydy ) ) { nodeList[1 - pqIndex].push( nodeList[pqIndex].front() ); nodeList[pqIndex].pop(); } nodeList[pqIndex].pop(); // remove the wanted node // empty the larger size nodeList to the smaller one if( nodeList[pqIndex].size() > nodeList[ 1 - pqIndex ].size() ) pqIndex = 1 - pqIndex; while( !nodeList[pqIndex].empty() ) { nodeList[1-pqIndex].push(nodeList[pqIndex].front()); nodeList[pqIndex].pop(); } pqIndex = 1 - pqIndex; nodeList[pqIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Just right) From what I read about Java's documentation, I came up with the conclusion: C++'s std::queue<T>::front() == Java's LinkedList<T>.peek() Java's LinkedList<T>.pop() == C++'s std::queue<T>::front() + std::queue<T>::pop() What might I be missing in my Java version? In what way does it became different algorithmically from the C++ version?

    Read the article

  • Casting Type array to Generic array?

    - by George R
    The short version of the question - why can't I do this? I'm restricted to .NET 3.5. T[] genericArray; // Obviously T should be float! genericArray = new T[3]{ 1.0f, 2.0f, 0.0f }; // Can't do this either, why the hell not genericArray = new float[3]{ 1.0f, 2.0f, 0.0f }; Longer version - I'm working with the Unity engine here, although that's not important. What is - I'm trying to throw conversion between its fixed Vector2 (2 floats) and Vector3 (3 floats) and my generic Vector< class. I can't cast types directly to a generic array. using UnityEngine; public struct Vector { private readonly T[] _axes; #region Constructors public Vector(int axisCount) { this._axes = new T[axisCount]; } public Vector(T x, T y) { this._axes = new T[2] { x, y }; } public Vector(T x, T y, T z) { this._axes = new T[3]{x, y, z}; } public Vector(Vector2 vector2) { // This doesn't work this._axes = new T[2] { vector2.x, vector2.y }; } public Vector(Vector3 vector3) { // Nor does this this._axes = new T[3] { vector3.x, vector3.y, vector3.z }; } #endregion #region Properties public T this[int i] { get { return _axes[i]; } set { _axes[i] = value; } } public T X { get { return _axes[0];} set { _axes[0] = value; } } public T Y { get { return _axes[1]; } set { _axes[1] = value; } } public T Z { get { return this._axes.Length (Vector2 vector2) { Vector vector = new Vector(vector2); return vector; } public static explicit operator Vector(Vector3 vector3) { Vector vector = new Vector(vector3); return vector; } #endregion }

    Read the article

  • XSLT - Comparing preceding-sibling's elements with current's node element

    - by siondream
    Hello, I have this XML file: <recursos> <recurso url="http://w3c.com"> <descripcion>Consorcio W3C</descripcion> <tipo>externo</tipo> <idioma>ingles</idioma> <contenido>General</contenido> <unidad>Unidad 2</unidad> </recurso> <recurso url="http://html.com"> <descripcion>Especificación HTML</descripcion> <tipo>externo</tipo> <idioma>castellano</idioma> <contenido>HTML</contenido> <version>4.01</version> <unidad>Unidad 3</unidad> </recurso> </recursos> I want to compare one "recurso"'s preceding sibling element "unidad" with the "unidad" of the current "recurso" to check if they're different. I was trying: <xsl:if test="preceding-sibling::recurso[position()=1]::unidad != unidad"> </xsl:if> But I know it's horribly wrong :( I hope you could help me, thank you very much.

    Read the article

  • CXF code first service, WSDL generation; soap:address changes?

    - by jcalvert
    I have a simple Java interface/implementation I am exposing via CXF. I have a jaxws element in my Spring configuration file like this: <jaxws:endpoint id="managementServiceJaxws" implementor="#managementService" address="/jaxws/ManagementService" > </jaxws:endpoint> It generates the WSDL from my annotated interface and exposes the service. Then when I hit http://myhostname/cxf/jaxws/ManagementService?wsdl I get a lovely WSDL. At the bottom in the wsdl:service element, I'll see <soap:address location="http://myhostname/cxf/jaxws/ManagementService"/> However, some time a day or so later, with no application restart, hitting that same url produces: This causes a number of problems, but what I really want is to fix it. Right now, there's a particular client to the webservice that sets the endpoint to localhost; because it runs on the same machine. Is it possible the wsdl is getting regenerated and cached and then exposing the 'localhost' version? In part I don't know the exact mechanism by which one goes from a ?wsdl request in CXF to the response. It seems almost certain that it's retrieving some cached version, given that it's supposed to be determining the address by asking the servletcontainer (Jetty). For reference I know a stopgap solution is using the hostname on the client and making sure an alias in place so that it goes over the loopback. EDIT: For reference, I confirmed that if I bring my application up and first hit it over localhost, then querying for the wsdl via the hostname shows the address as localhost. Conversely, first hitting it over the hostname causes localhost requests to show the hostname. So obviously something is getting cached here.

    Read the article

  • Handle BACK key event in child view

    - by Mick Byrne
    In my app, users can tap on image thumbnails to see a full size version. When the thumbnail is tapped a bunch of new views are created in code (i.e. no XML), appended at the end of the view hierarchy and some scaling and rotating transitions happen, then the full size, high res version of the image is displayed. Tapping on the full size image reverses the transitions and removes the new views from the view hierarchy. I want users to also be able to press the BACK key to reverse the image transitions. However, I can't seem to catch the KeyEvent. This is what I'm trying at the moment: // Set a click listener on the image to reverse everything frameView.setOnClickListener(new OnClickListener() { @Override public void onClick(View arg0) { zoomOut(); // This works fine } }); // Set the focus onto the frame and then set a key listener to catch the back buttons frameView.setFocusable(true); frameView.setFocusableInTouchMode(true); frameView.requestFocus(); frameView.setOnKeyListener(new OnKeyListener() { @Override public boolean onKey(View v, int keyCode, KeyEvent event) { // The code never even gets here !!! if(keyCode == KeyEvent.KEYCODE_BACK && event.getRepeatCount() == 0) { zoomOut(); return true; } return false; } });

    Read the article

  • Domain validates but won't save

    - by marko
    I have the following setup. Class, say, Car that has a CarPart (belongsTo=[car:Car]). When I'm creating a Car I also want to create som default CarParts, so I do def car = new Car(bla bla bla) def part = new CarPart(car:car) Now, when I do car.validate() or part.validate() it seems fine. But when I do if(car.save && part.save() I get this exception: 2012-03-24 14:02:21,943 [http-8080-4] ERROR util.JDBCExceptionReporter - Batch entry 0 insert into car_part (version, car_id, id) values ('0', '297', '298') was aborted. Call getNextException to see the cause. 2012-03-24 14:02:21,943 [http-8080-4] ERROR util.JDBCExceptionReporter - ERROR: value too long for type character varying(6) 2012-03-24 14:02:21,943 [http-8080-4] ERROR events.PatchedDefaultFlushEventListener - Could not synchronize database state with session org.hibernate.exception.DataException: Could not execute JDBC batch update Stacktrace follows: java.sql.BatchUpdateException: Batch entry 0 insert into car_part (version, deal_id, id) values ('0', '297', '298') was aborted. Call getNextException to see the cause. at org.postgresql.jdbc2.AbstractJdbc2Statement$BatchResultHandler.handleError(AbstractJdbc2Statement.java:2621) at org.postgresql.core.v3.QueryExecutorImpl.processResults(QueryExecutorImpl.java:1837) at org.postgresql.core.v3.QueryExecutorImpl.execute(QueryExecutorImpl.java:407) at org.postgresql.jdbc2.AbstractJdbc2Statement.executeBatch(AbstractJdbc2Statement.java:2754) at $Proxy20.flush(Unknown Source) at ristretto.DealController$_closure5.doCall(DealController.groovy:109) at ristretto.DealController$_closure5.doCall(DealController.groovy) at java.lang.Thread.run(Thread.java:722) Any ideas?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

< Previous Page | 511 512 513 514 515 516 517 518 519 520 521 522  | Next Page >