Search Results

Search found 31206 results on 1249 pages for 'version detection'.

Page 515/1249 | < Previous Page | 511 512 513 514 515 516 517 518 519 520 521 522  | Next Page >

• C#; On casting to the SAME class that came from another assembly

  - by G. Stoynev

  For complete separation/decoupling, I've implemented a DAL in an assebly that is simply being copied over via post-build event to the website BIN folder. The website then on Application Start loads that assembly via System.Reflection.Assembly.LoadFile. Again, using reflection, I construct a couple of instances from classes in that assembly. I then store a reference to these instances in the session (HttpContext.Current.Items) Later, when I try to get the object stored in the session, I am not able to cast them to their own types (was trying interfaces initially, but for debugging tried to cast to THEIR OWN TYPES), getting this error: [A]DAL_QSYSCamper.NHibernateSessionBuilder cannot be cast to [B] DAL_QSYSCamper.NHibernateSessionBuilder. Type A originates from 'DAL_QSYSCamper, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null' in the context 'Default' at location 'C:\Users\dull.anomal\AppData\Local\Temp\Temporary ASP.NET Files\root\ad6e8bff\70fa2384\assembly\dl3\aaf7a5b0\84f01b09_b10acb01\DAL_QSYSCamper.DLL'. Type B originates from 'DAL_QSYSCamper, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null' in the context 'LoadNeither' at location 'C:\Users\dull.anomal\Documents\Projects\QSYS\Deleteme\UI\MVCClient\bin\DAL_QSYSCa mper.DLL'. This is happening while debugging in VS - VS manages to stop into the source DAL project even though I've loaded from assembly and the project is not refferenced by the website project (they're both in the solution). I do understand the error, but I don't understand how and why the assembly is being used/loaded from two locations - I only load it once from the file and there's no referrence to the project. Should mention that I also use Windsor for DI. The object that tries to extract the object from the session is A) from a class from that DAL assembly; B) is injected into a website class by Windsor. I will work on adding some sample code to this question, but wanted to put it out in case it's obvious what I do wrong.

  Read the article

• Why won't EF4 generate a method to support my Function Import?

  - by Deane

  I have a stored proc in my database which returns an integer. I added a Function Import to my model. This appears in the EDMX file: <Function Name="GetTotalEntityCount" Aggregate="false" BuiltIn="false" NiladicFunction="false" IsComposable="false" ParameterTypeSemantics="AllowImplicitConversion" Schema="dbo" /> However, no method actually gets generated for this. It should be top level, right? using (MyContext context = new MyContext()) { context.MyMethodShouldBeRightHere(); } Nothing appears in Intellisense, I've gone through the designer.cs file and there's nothing in there, and reflected the DLL...nothing. The code generator is just not generating any code to support this stored proc. I added another table to my database and updated the model, and that came in, so the model will update, it's just specifically ignoring this stored proc. I've tried everything I can think of, and consulted every resource I can find, and as near as I can tell, I'm doing everything right. I'm using EF4, database-first. (I'm pretty sure on the version, anyway. This shows up in the generated file: Runtime Version:4.0.30319.1 )

  Read the article

• xsl:for-each not supported in this context

  - by alexbf

  Hi! I have this XSLT document : <xsl:stylesheet version="1.0" xmlns:mstns="http://www.w3.org/2001/XMLSchema" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:output method="xml" version="1.0" encoding="UTF-8" indent="yes"/> <xsl:template match="/MyDocRootElement"> <xs:schema id="DataSet" targetNamespace="http://www.w3.org/2001/XMLSchema" attributeFormDefault="qualified" elementFormDefault="qualified" > <xs:element name="DataSet" msdata:IsDataSet="true"> <xs:complexType> <xs:choice maxOccurs="unbounded"> <xs:element name="Somename"> </xs:element> <xs:element name="OtherName"> </xs:element> <!-- FOR EACH NOT SUPPORTED? --> <xsl:for-each select="OtherElements/SubElement"> <xs:element name="OtherName"> </xs:element> </xsl:for-each> </xs:choice> </xs:complexType> </xs:element> </xs:schema> </xsl:template> </xsl:stylesheet> I have a validation error saying that the "for-each element is not supported in this context" I am guessing it has something to do with the xs namespace validation. Any ideas on how can I make this work? (Exclude validation?) Thanks Alex

  Read the article

• How do I get require_login()-like functionality using the new PHP Client Library for Facebook?

  - by cc

  Howdy. I've been tasked with making a Facebook game, but I'm new to Facebook development, so I'm just getting started. Apologies in advance if this is a no-brainer to people. I'm having trouble following all the examples I see on sites, and I keep running into missing pages in the Facebook documentation when I am trying to read up. I think it's because there's a new version of the PHP Client Library for Facebook, and everything I'm finding is referring to the old client. For instance, I see this code in a lot of examples: require 'facebook.php'; $facebook = new Facebook( array( 'appId' => '(id)', 'secret' => '(secret)' ) ); $facebook_account = $facebook->require_login(); ...but there's no "require_login()" in the client library provided in the facebook.php file. From what I can tell, it looks like Facebook has very recently rolled out some new system for development, but I don't see any sample code anywhere to deal with it. The new library comes with an "example.php" file, but it appears to be only for adding "Log in with Facebook" functionality to other sites (what I'm assuming is what they mean by "Facebook Connect" sites), not for just running apps in a Canvas page on Facebook itself. Specifically, what I need to do is let users visit an application page within Facebook, have it bring up the dialog box allowing them to authorize the app, have it show up in their "games" page, and then have it pass me the relevant info about the user so I can start creating the game. But I can't seem to find any tutorials or examples that show how to do this using the new library. Seems like this should be pretty straightforward, but I'm running into roadblocks. Or am I missing something about the PHP client library? Should require_login() be working for me, and there's something broken with my implementation, such as having the wrong client library or something? I downloaded from GitHub yesterday, so I'm pretty sure I have the most recent version of the code I have, but perhaps I'm downloading the wrong "facebook.php" file...?

  Read the article

• Drupal view filter to show only one of a certain item

  - by Joel

  I'm fairly new to Drupal, and am using Node Import to take a TSV file and turn it into nodes. I'm hitting a problem, though, with automating updates to the nodes. Again, I'd like to take a Tab Separated Values text file, and load it into my site via Node Import (or whatever else anyone might suggest) and then only show updated Nodes. Here's a specific example: I have a Node with the following info: StoreId Name Address Phone Contact 01 Name1 Address1 Phone1 Contact1 02 Name2 Address2 Phone2 Contact2 etc. The info pulls into the nodes just fine (Thank you Node Import!), but we also want to process updates to the nodes. So far I have two ideas... figure out how to delete duplicate (previous) instances of the same StoreID, or just save the node with the duplicate StoreID (and new other info) and just display the most current version. In Views, I can get it to show the nodes and everything, but I can't figure out how to only display the most recent version of each StoreID. A view of views would work, but I can't seem to get that to work, either. Any ideas or other approaches I could take? Thanks in advance for the help!

  Read the article

• Casting Type array to Generic array?

  - by George R

  The short version of the question - why can't I do this? I'm restricted to .NET 3.5. T[] genericArray; // Obviously T should be float! genericArray = new T[3]{ 1.0f, 2.0f, 0.0f }; // Can't do this either, why the hell not genericArray = new float[3]{ 1.0f, 2.0f, 0.0f }; Longer version - I'm working with the Unity engine here, although that's not important. What is - I'm trying to throw conversion between its fixed Vector2 (2 floats) and Vector3 (3 floats) and my generic Vector< class. I can't cast types directly to a generic array. using UnityEngine; public struct Vector { private readonly T[] _axes; #region Constructors public Vector(int axisCount) { this._axes = new T[axisCount]; } public Vector(T x, T y) { this._axes = new T[2] { x, y }; } public Vector(T x, T y, T z) { this._axes = new T[3]{x, y, z}; } public Vector(Vector2 vector2) { // This doesn't work this._axes = new T[2] { vector2.x, vector2.y }; } public Vector(Vector3 vector3) { // Nor does this this._axes = new T[3] { vector3.x, vector3.y, vector3.z }; } #endregion #region Properties public T this[int i] { get { return _axes[i]; } set { _axes[i] = value; } } public T X { get { return _axes[0];} set { _axes[0] = value; } } public T Y { get { return _axes[1]; } set { _axes[1] = value; } } public T Z { get { return this._axes.Length (Vector2 vector2) { Vector vector = new Vector(vector2); return vector; } public static explicit operator Vector(Vector3 vector3) { Vector vector = new Vector(vector3); return vector; } #endregion }

  Read the article

• Converting "A* Search" code from C++ to Java [on hold]

  - by mr5

  Updated! I get this code from this site It's A* Search Algorithm(finding shortest path with heuristics) I modify most of variable names and some if conditions from the original version to satisfy my syntactic taste. It works in C++ (as I can't see any trouble with it) but fails in Java version. Java Code: String findPath(int startX, int startY, int finishX, int finishY) { @SuppressWarnings("unchecked") LinkedList<Node>[] nodeList = (LinkedList<Node>[]) new LinkedList<?>[2]; nodeList[0] = new LinkedList<Node>(); nodeList[1] = new LinkedList<Node>(); Node n0; Node m0; int nlIndex = 0; // queueList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = new Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[nlIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[nlIndex].isEmpty() ) { LinkedList<Node> pq = nodeList[nlIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = new Node( pq.peek().getX(), pq.peek().getY(), pq.peek().getIterCount(), pq.peek().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[nlIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions String path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; int c = '0' + ( j + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; path = (char)c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < Node.DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!(xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( gridMap.getData( ydy, xdx ) == GridMap.WALKABLE || gridMap.getData( ydy, xdx ) == GridMap.FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = new Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[nlIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; // replace the node // by emptying one queueList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while( !(nodeList[nlIndex].peek().getX() == xdx && nodeList[nlIndex].peek().getY() == ydy ) ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nodeList[nlIndex].pop(); // remove the wanted node // empty the larger size queueList to the smaller one if( nodeList[nlIndex].size() > nodeList[ 1 - nlIndex ].size() ) nlIndex = 1 - nlIndex; while( !nodeList[nlIndex].isEmpty() ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nlIndex = 1 - nlIndex; nodeList[nlIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output1: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Misleading path) Output2: Changing these lines: n0 = new Node( a, b, c, d ); m0 = new Node( e, f, g, h ); to n0.set( a, b, c, d ); m0.set( e, f, g, h ); I get (I'm really confused) C++ Code: std::string A_Star::findPath(int startX, int startY, int finishX, int finishY) { typedef std::queue<Node> List_Container; List_Container nodeList[2]; // list of open (not-yet-tried) nodes Node n0; Node m0; int pqIndex = 0; // nodeList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[pqIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[pqIndex].empty() ) { List_Container &pq = nodeList[pqIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = Node( pq.front().getX(), pq.front().getY(), pq.front().getIterCount(), pq.front().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[pqIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions std::string path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; char c = '0' + ( j + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; path = c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!( xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( pGrid->getData(ydy,xdx) == WALKABLE || pGrid->getData(ydy, xdx) == FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[pqIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; // replace the node // by emptying one nodeList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while ( !( nodeList[pqIndex].front().getX() == xdx && nodeList[pqIndex].front().getY() == ydy ) ) { nodeList[1 - pqIndex].push( nodeList[pqIndex].front() ); nodeList[pqIndex].pop(); } nodeList[pqIndex].pop(); // remove the wanted node // empty the larger size nodeList to the smaller one if( nodeList[pqIndex].size() > nodeList[ 1 - pqIndex ].size() ) pqIndex = 1 - pqIndex; while( !nodeList[pqIndex].empty() ) { nodeList[1-pqIndex].push(nodeList[pqIndex].front()); nodeList[pqIndex].pop(); } pqIndex = 1 - pqIndex; nodeList[pqIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Just right) From what I read about Java's documentation, I came up with the conclusion: C++'s std::queue<T>::front() == Java's LinkedList<T>.peek() Java's LinkedList<T>.pop() == C++'s std::queue<T>::front() + std::queue<T>::pop() What might I be missing in my Java version? In what way does it became different algorithmically from the C++ version?

  Read the article

• How to use linux csplit to chop up massive XML file?

  - by Fred

  Hi everyone, I have a gigantic (4GB) XML file that I am currently breaking into chunks with linux "split" function (every 25,000 lines - not by bytes). This usually works great (I end up with about 50 files), except some of the data descriptions have line breaks, and so frequently the chunk files do not have the proper closing tags - and my parser chokes halfway through processing. Example file: (note: normally each "listing" xml node is supposed to be on its own line) <?xml version="1.0" encoding="UTF-8"?> <listings> <listing><date>2009-09-22</date><desc>This is a description WITHOUT line breaks and works fine with split</desc><more_tags>stuff</more_tags></listing> <listing><date>2009-09-22</date><desc>This is a really annoying description field WITH line breaks that screw the split function</desc><more_tags>stuff</more_tags></listing> </listings> Then sometimes my split ends up like <?xml version="1.0" encoding="UTF-8"?> <listings> <listing><date>2009-09-22</date><desc>This is a description WITHOUT line breaks and works fine with split</desc><more_tags>stuff</more_tags></listing> <listing><date>2009-09-22</date><desc>This is a really annoying description field WITH line breaks ... EOF So - I have been reading about "csplit" and it sounds like it might work to solve this issue. I cant seem to get the regular expression right... Basically I want the same output of ~50ish files Something like: *csplit -k myfile.xml '/</listing>/' 25000 {50} Any help would be great Thanks!

  Read the article

• C: Fifo between threads, writing and reading strings

  - by Yonatan

  Hello once more dear internet, I writing a small program that among other things, writes a log file of commands received. to do that, I want to use a thread that all it should do is just attempt to read from a pipe, while the main thread will write into that pipe whenever it should. Since i don't know the length of each string command, i thought about writing and reading the pointer to the char buf[MAX_MESSAGE_LEN]. Since what i've tried so far doesn't work, i'll post my best effort :P char str[] = "hello log thread 123456789 10 11 12 13 14 15 16 17 18 19\n"; if (pipe(pipe_fd) != 0) return -1; pthread_t log_thread; pthread_create(&log_thread,NULL, log_thread_start, argv[2]); success_write = 0; do { write(pipe_fd[1],(void*)&str,sizeof(char*)); } while (success_write < sizeof(char*)); and the thread does this: char buffer[MAX_MSGLEN]; int success_read; success_read = 0; //while(1) { do { success_read += read(pipe_fd[0],(void*)&buffer, sizeof(char*)); } while (success_read < sizeof(char*)); //} printf("%s",buffer); (Sorry if this doesn't indent, i can't seem to figure out this editor...) oh, and pipe_fd[2] is a global parameter. So, any help with this, either by the way i thought of, or another way i could read strings without knowing the length, would be much appreciated. On a side note, i'm working on Eclipse IDE C/C++, version 1.2.1 and i can't seem to set up the compiler so it will link the pthread library to my project. I've resorted to writing my own Makefile to make it (pun intended :P) work. Anyone knows what to do ? i've looked online, but all i find are solutions that are probably good on an older version because the tabs and option keys are different. Anyways, Thanks a bunch internet ! Yonatan

  Read the article

• Replacing words in string

  - by abkai

  Okay, so I have the following little function: def swap(inp): inp = inp.split() out = "" for item in inp: ind = inp.index(item) item = item.replace("i am", "you are") item = item.replace("you are", "I am") item = item.replace("i'm", "you're") item = item.replace("you're", "I'm") item = item.replace("my", "your") item = item.replace("your", "my") item = item.replace("you", "I") item = item.replace("my", "your") item = item.replace("i", "you") inp[ind] = item for item in inp: ind = inp.index(item) item = item + " " inp[ind] = item return out.join(inp) Which, while it's not particularly efficient gets the job done for shorter sentences. Basically, all it does is swaps pronoun etc. perspectives. This is fine when I throw a string like "I love you" at it, it returns "you love me" but when I throw something like: you love your version of my couch because I love you, and you're a couch-lover. I get: I love your versyouon of your couch because I love I, and I'm a couch-lover. I'm confused as to why this is happening. I explicitly split the string into a list to avoid this. Why would it be able to detect it as being a part of a list item, rather than just an exact match? Also, slightly deviating to avoid having to post another question so similar; if a solution to this breaks this function, what will happen to commas, full stops, other punctuation? It made some very surprising mistakes. My expected output is: I love my version of your couch because you love I, and I'm a couch-lover. The reason I formatted it like this, is because I eventually hope to be able to replace the item.replace(x, y) variables with words in a database.

  Read the article

• Maintenance tool for Application Database

  - by Thierry

  Hello ! Does anybody know about a good tool which help maintaining the database of an application ? I'm working on an application which uses a database (Microsoft Sql Server). When a development requires to change something in the database (e.g., structure, data migration...), we create a script (Transact-SQL script) and add it into our revision control tool (subversion - that tool also contains our code). Each script must add a line in a log table to keep a trace of all the scripts that have been ran into a database. In order to build a database for our application, one needs to run all scripts ordered by their creation date. I'm not really happy with this technique notably because it make application migration a bit hard. If we want to install a new version of the application somewhere, e.g., migrate from version 1.3 to 2.1, we must get all the scripts between these two versions. Then run them and ensure that everything is done in a transaction... For sure we could built home-made tools to help but I wonder if some tools already exists to do that kind of job.

  Read the article

• Invalid Argument javascript error only on certain computers

  - by Jen

  Getting an error whenever we click a particular button/link on our site. It is generating a javascript "Invalid Argument" error. I know in the other posts it is typically because it is a syntax error in the javascript however it only just seems to have started happening and it doesn't happen on all pcs. ie. in our client's environment if I remote onto their web server and view the uat website I get the javascript error. If I remote onto their sql server and view the uat website I don't get the javascript error. If it was a syntax error then I would always get the error wouldn't I? both browsers are the same version of IE6 (yeah I know...) :) I have tried deleting temporary internet files - including viewing the files and deleting them myself - but no joy. client uses citrix.. and they're all getting the error :( Any ideas would be appreciated - Thanks! :) Update - Sorry I haven't posted specific code as there is too much to post (and I'm not sure where the error is occurring). The "button" launches a new window which in turn opens up a couple of aspx pages and calls lots of javascript. So the window opens ok, and there's a function that gets called to resize the window - but before it calls the resizing of the window/content it throws the invalid argument error. Am busy trying to get alerts to trigger to see if I can see where it's falling over but so far no luck. Again not sure why this error doesn't occur when I use a particular PC (same browser version)

  Read the article

• Conditional references in .NET project, possible to get rid of warning?

  - by Lasse V. Karlsen

  I have two references to a SQLite assembly, one for 32-bit and one for 64-bit, which looks like this (this is a test project to try to get rid of the warning, don't get hung up on the paths): <Reference Condition=" '$(Platform)' == 'x64' " Include="System.Data.SQLite, Version=1.0.61.0, Culture=neutral, PublicKeyToken=db937bc2d44ff139, processorArchitecture=AMD64"> <SpecificVersion>True</SpecificVersion> <HintPath>..\..\LVK Libraries\SQLite3\version_1.0.65.0\64-bit\System.Data.SQLite.DLL</HintPath> </Reference> <Reference Condition=" '$(Platform)' == 'x86' " Include="System.Data.SQLite, Version=1.0.65.0, Culture=neutral, PublicKeyToken=db937bc2d44ff139, processorArchitecture=x86"> <SpecificVersion>True</SpecificVersion> <HintPath>..\..\LVK Libraries\SQLite3\version_1.0.65.0\32-bit\System.Data.SQLite.DLL</HintPath> </Reference> This produces the following warning: Warning 1 The referenced component 'System.Data.SQLite' could not be found. Is it possible for me to get rid of this warning? One way I've looked at it to just configure my project to be 32-bit when I develop, and let the build machine fix the reference when building for 64-bit, but this seems a bit awkward and probably prone to errors. Any other options? The reason I want to get rid of it is that the warning is apparently being picked up by TeamCity and periodically flagged as something I need to look into, so I'd like to get completely rid of it.

  Read the article

• Cannot display converted value inside xml field

  - by zurna

  PS: My bad, there was not an error. I forgot to upload the latest version to the server... I have multimedias and images table. I save images in multimedias table with their images table id numbers. Then whenever I need image's url, with a simple function I get it from images table. The problem I am having is when I try to display image's url inside ImageURL, it just does not happen. This is very annoying. xml output <?xml version='1.0' encoding='windows-1254' ?> <rows><row id='1'> <MultimediaTitle>Hagi Goals</MultimediaTitle> /FLPM/media/images/5Y2K4T5V_sm.jpg <ImageURL><![CDATA[]]></ImageURL> <Videos> <VideoID id='1'><VideoURL>/FLPM/media/videos/0H7T9C0F.flv</VideoURL></VideoID> <VideoID id='2'><VideoURL>/FLPM/media/videos/9L6X9G9J.flv</VideoURL></VideoID> </Videos> </row> </rows>

  Read the article

• Why is UseCompatibleTextRendering needed here?

  - by HotOil

  Hi, I think I'm missing something fundamental. Please tell me what it is, if you can. I have developed a little C++ WinForms app using VS2008. So it is built using .NET 3.5 SP1. My development box is Win7, if that matters. The default value of UseCompatibleTextRendering property in WinForms controls is false in this version of VStudio. And this should not matter to me, I don't think. I don't have any custom-drawn text or controls. The app looks good running on my Win7 box. If I package it up (dragging along .NET 3.5) and install it on one of our WinXP desktops, the buttons and labels don't look good; the text is chopped off in them. If I set UseCompatibleTextRendering to true and then run it on the XP boxes, the text fits into the buttons and labels. My question is: Why? The installation puts .Net 3.5 on the XP boxes, so the app should be able to find and use the right version of WinForms, right? I should note that before I put my app + .NET 3.5 on these boxes, they have no .NET at all. They do not get automatic Microsoft updates; our IT guy gates the patches and upgrades. [ This sort of thing has happened before with apps I create.. they look/work great on the Engineering machines, because we maintain those and they mostly have up-to-date stuff. When they are run on the corporate boxes, they usually don't run and need the VCredist installed. ] Back to the question at hand: The text looks better with the UseCompatibleTextRendering set to false, so I'd rather keep it that way, if I can. I'd like to understand what might be missing on those XP boxes that is making the text not fit. Thanks S

  Read the article

• CXF code first service, WSDL generation; soap:address changes?

  - by jcalvert

  I have a simple Java interface/implementation I am exposing via CXF. I have a jaxws element in my Spring configuration file like this: <jaxws:endpoint id="managementServiceJaxws" implementor="#managementService" address="/jaxws/ManagementService" > </jaxws:endpoint> It generates the WSDL from my annotated interface and exposes the service. Then when I hit http://myhostname/cxf/jaxws/ManagementService?wsdl I get a lovely WSDL. At the bottom in the wsdl:service element, I'll see <soap:address location="http://myhostname/cxf/jaxws/ManagementService"/> However, some time a day or so later, with no application restart, hitting that same url produces: This causes a number of problems, but what I really want is to fix it. Right now, there's a particular client to the webservice that sets the endpoint to localhost; because it runs on the same machine. Is it possible the wsdl is getting regenerated and cached and then exposing the 'localhost' version? In part I don't know the exact mechanism by which one goes from a ?wsdl request in CXF to the response. It seems almost certain that it's retrieving some cached version, given that it's supposed to be determining the address by asking the servletcontainer (Jetty). For reference I know a stopgap solution is using the hostname on the client and making sure an alias in place so that it goes over the loopback. EDIT: For reference, I confirmed that if I bring my application up and first hit it over localhost, then querying for the wsdl via the hostname shows the address as localhost. Conversely, first hitting it over the hostname causes localhost requests to show the hostname. So obviously something is getting cached here.

  Read the article

• waveInProc / Windows audio question...

  - by BTR

  I'm using the Windows API to get audio input. I've followed all the steps on MSDN and managed to record audio to a WAV file. No problem. I'm using multiple buffers and all that. I'd like to do more with the buffers than simply write to a file, so now I've got a callback set up. It works great and I'm getting the data, but I'm not sure what to do with it once I have it. Here's my callback... everything here works: // Media API callback void CALLBACK AudioRecorder::waveInProc(HWAVEIN hWaveIn, UINT uMsg, DWORD dwInstance, DWORD dwParam1, DWORD dwParam2) { // Data received if (uMsg == WIM_DATA) { // Get wav header LPWAVEHDR mBuffer = (WAVEHDR *)dwParam1; // Now what? for (unsigned i = 0; i != mBuffer->dwBytesRecorded; ++i) { // I can see the char, how do get them into my file and audio buffers? cout << mBuffer->lpData[i] << "\n"; } // Re-use buffer mResultHnd = waveInAddBuffer(hWaveIn, mBuffer, sizeof(mInputBuffer[0])); // mInputBuffer is a const WAVEHDR * } } // waveInOpen cannot use an instance method as its callback, // so we create a static method which calls the instance version void CALLBACK AudioRecorder::staticWaveInProc(HWAVEIN hWaveIn, UINT uMsg, DWORD_PTR dwInstance, DWORD_PTR dwParam1, DWORD_PTR dwParam2) { // Call instance version of method reinterpret_cast<AudioRecorder *>(dwParam1)->waveInProc(hWaveIn, uMsg, dwInstance, dwParam1, dwParam2); } Like I said, it works great, but I'm trying to do the following: Convert the data to short and copy into an array Convert the data to float and copy into an array Copy the data to a larger char array which I'll write into a WAV Relay the data to an arbitrary output device I've worked with FMOD a lot and I'm familiar with interleaving and all that. But FMOD dishes everything out as floats. In this case, I'm going the other way. I guess I'm basically just looking for resources on how to go from LPSTR to short, float, and unsigned char. Thanks much in advance!

  Read the article

• Can anyone explain this strange behaviour?

  - by partizan

  Hi, guys. Here is the example with comments: class Program { // first version of structure public struct D1 { public double d; public int f; } // during some changes in code then we got D2 from D1 // Field f type became double while it was int before public struct D2 { public double d; public double f; } static void Main(string[] args) { // Scenario with the first version D1 a = new D1(); D1 b = new D1(); a.f = b.f = 1; a.d = 0.0; b.d = -0.0; bool r1 = a.Equals(b); // gives true, all is ok // The same scenario with the new one D2 c = new D2(); D2 d = new D2(); c.f = d.f = 1; c.d = 0.0; d.d = -0.0; bool r2 = c.Equals(d); // false! this is not the expected result } } So, what do you think about this?

  Read the article

• Handle BACK key event in child view

  - by Mick Byrne

  In my app, users can tap on image thumbnails to see a full size version. When the thumbnail is tapped a bunch of new views are created in code (i.e. no XML), appended at the end of the view hierarchy and some scaling and rotating transitions happen, then the full size, high res version of the image is displayed. Tapping on the full size image reverses the transitions and removes the new views from the view hierarchy. I want users to also be able to press the BACK key to reverse the image transitions. However, I can't seem to catch the KeyEvent. This is what I'm trying at the moment: // Set a click listener on the image to reverse everything frameView.setOnClickListener(new OnClickListener() { @Override public void onClick(View arg0) { zoomOut(); // This works fine } }); // Set the focus onto the frame and then set a key listener to catch the back buttons frameView.setFocusable(true); frameView.setFocusableInTouchMode(true); frameView.requestFocus(); frameView.setOnKeyListener(new OnKeyListener() { @Override public boolean onKey(View v, int keyCode, KeyEvent event) { // The code never even gets here !!! if(keyCode == KeyEvent.KEYCODE_BACK && event.getRepeatCount() == 0) { zoomOut(); return true; } return false; } });

  Read the article

• MapView EXC_BAD_ACCESS (SIGSEGV) and KERN_INVALID_ADDRESS

  - by user768113

  I'm having some 'issues' with my application... well, it crashes in an UIViewController that is presented modally, there the user enters information through UITextFields and his location is tracked by a MapView. Lets call this view controller "MapViewController" When the user submits the form, I call a different ViewController - modally again - that processes this info and a third one answers accordingly, then go back to a MenuVC using unwinding segues, which then calls MapViewController and so on. This sequence is repeated many times, but it always crashes in MapViewController. Looking at the crash log, I think that the MapView can be the problem of this or some element in the UI (because of the UIKit framework). I tried to use NSZombie in order to track a memory issue but it doesn't give me a clue about whats happening. Here is the crash log Hardware Model: iPad3,4 Process: MyApp [2253] OS Version: iOS 6.1.3 (10B329) Report Version: 104 Exception Type: EXC_BAD_ACCESS (SIGSEGV) Exception Codes: KERN_INVALID_ADDRESS at 0x00000044 Crashed Thread: 0 Thread 0 name: Dispatch queue: com.apple.main-thread Thread 0 Crashed: 0 IMGSGX554GLDriver 0x328b9be0 0x328ac000 + 56288 1 IMGSGX554GLDriver 0x328b9b8e 0x328ac000 + 56206deallocated instance 2 IMGSGX554GLDriver 0x328bc2f2 0x328ac000 + 66290 3 IMGSGX554GLDriver 0x328baf44 0x328ac000 + 61252 4 libGPUSupportMercury.dylib 0x370f86be 0x370f6000 + 9918 5 GLEngine 0x34ce8bd2 0x34c4f000 + 629714 6 GLEngine 0x34cea30e 0x34c4f000 + 635662 7 GLEngine 0x34c8498e 0x34c4f000 + 219534 8 GLEngine 0x34c81394 0x34c4f000 + 205716 9 VectorKit 0x3957f4de 0x394c7000 + 754910 10 VectorKit 0x3955552e 0x394c7000 + 582958 11 VectorKit 0x394d056e 0x394c7000 + 38254 12 VectorKit 0x394d0416 0x394c7000 + 37910 13 VectorKit 0x394cb7ca 0x394c7000 + 18378 14 VectorKit 0x394c9804 0x394c7000 + 10244 15 VectorKit 0x394c86a2 0x394c7000 + 5794 16 QuartzCore 0x354a07a4 0x35466000 + 239524 17 QuartzCore 0x354a06fc 0x35466000 + 239356 18 IOMobileFramebuffer 0x376f8fd4 0x376f4000 + 20436 19 IOKit 0x344935aa 0x34490000 + 13738 20 CoreFoundation 0x33875888 0x337e9000 + 575624 21 CoreFoundation 0x338803e4 0x337e9000 + 619492 22 CoreFoundation 0x33880386 0x337e9000 + 619398 23 CoreFoundation 0x3387f20a 0x337e9000 + 614922 24 CoreFoundation 0x337f2238 0x337e9000 + 37432 25 CoreFoundation 0x337f20c4 0x337e9000 + 37060 26 GraphicsServices 0x373ad336 0x373a8000 + 21302 27 UIKit 0x3570e2b4 0x356b7000 + 357044 28 MyApp 0x000ea12e 0xe9000 + 4398 29 MyApp 0x000ea0e4 0xe9000 + 4324 I think thats all, additionally, I would like to ask you: if you are using unwind segues then you are releasing view controllers from the memory heap, right? Meanwhile, performing segues let you instantiate those controllers. Technically, MenuVC should be the only VC alive in the heap during the app life cycle if you understand me.

  Read the article

• WCF service not working after program update

  - by Boesj

  I have recently added a WCF service reference to my program. When I perform a clean install of this program, everything seems to work as expected. But, when I install the program on a client which already has a previous version (without the new service reference) installed, I get a exception telling me the default endpoint for this particular service could not be found. It seems that the appname.exe.config is not being updated with the new endpoint settings. Is there any reason for this and how can I force the installer to overwrite the config file? I'm using the default Visual Studio 2008 installer project with RemovePreviousVersions set to True. Update: My program encrypts the settings section after the first run with the following code Configuration config = ConfigurationManager.OpenExeConfiguration(ConfigurationUserLevel.None); ConfigurationSection section = config.GetSection(sectionKey); if (section != null) { if (!section.SectionInformation.IsProtected) { if (!section.ElementInformation.IsLocked) { section.SectionInformation.ProtectSection("DataProtectionConfigurationProvider"); section.SectionInformation.ForceSave = true; config.Save(ConfigurationSaveMode.Full); } } } When I do not run the program before installing the new version the app.config gets updated.

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Difference in calling redefined functions in F# and Clojure

  - by Michiel Borkent

  In F#: > let f x = x + 2;; val f : int -> int > let g x = f x;; val g : int -> int > g 10;; val it : int = 12 > let f x = x + 3;; val f : int -> int > g 10;; val it : int = 12 In Clojure: (defn f [x] (+ x 2)) (defn g [x] (f x)) (g 10) ;; => 12 (defn f [x] (+ x 3)) (g 10) ;; => 13 Note that in Clojure the most recent version of f gets called in the last line. In F# however still the old version of f is called. Why is this?

  Read the article

• XSLT - Comparing preceding-sibling's elements with current's node element

  - by siondream

  Hello, I have this XML file: <recursos> <recurso url="http://w3c.com"> <descripcion>Consorcio W3C</descripcion> <tipo>externo</tipo> <idioma>ingles</idioma> <contenido>General</contenido> <unidad>Unidad 2</unidad> </recurso> <recurso url="http://html.com"> <descripcion>Especificación HTML</descripcion> <tipo>externo</tipo> <idioma>castellano</idioma> <contenido>HTML</contenido> <version>4.01</version> <unidad>Unidad 3</unidad> </recurso> </recursos> I want to compare one "recurso"'s preceding sibling element "unidad" with the "unidad" of the current "recurso" to check if they're different. I was trying: <xsl:if test="preceding-sibling::recurso[position()=1]::unidad != unidad"> </xsl:if> But I know it's horribly wrong :( I hope you could help me, thank you very much.

  Read the article

• How to provide i18n service for developer and end user

  - by user247245

  Many android applications have quite poor i18n-support, and for an understandable reason, as it adds much work for the developer. From a both intuitive and cultural point of view it would be a good thing if end-users could translate the apps themself, and OTA share the translation, without reinstalling the app itself. In concept; as wikipedia, some add content easily, others only use what's there. It's of course important that the service is as easy as possible to use, both for app-developers, and people willing to transcribe. To keep it simple, this is the solution I'm concidering; Developer perspective: Developer uses a customized setContentView when open activities/layouts that will seach for thanslations of xml-entries. (below) The customized version is provided as a free downloadable library/class..., turning the i18n feature to more or less a one liner. User perspective: User downloads app without any translation As app launches, it checks locale running at phone, and will look for a translated xml-file at shared space in SD. If no or old transcribed xml (above), try to download new from internet-service (ansync). This is all done by library above, no need for intents. Translator perspective: Separate app to provide translations for any app using the i18n service above. (Could be just a webapp), with some form of QA on translators/input. QUESTION: Now, for this to work efficiently, it has to be AeasyAP for the developer to even bother, and the most fluent solution would be a customized version of setContentView, that simply loads the translated values from external xml, instead of the ones in the apk. Is this possible at all, and if not, what's your suggested solutions? (And of course, Happy New Year, feliz ano novo, blwyddyn newydd dda, Gott Nytt År, kontan ane nouvo, szczesliwego nowego roku ...) Regards, /T

  Read the article

< Previous Page | 511 512 513 514 515 516 517 518 519 520 521 522  | Next Page >