Search Results

Search found 3525 results on 141 pages for 'infinite sequence'.

Page 52/141 | < Previous Page | 48 49 50 51 52 53 54 55 56 57 58 59  | Next Page >

  • Binary Search Tree - Postorder logic

    - by daveb
    I am looking at implementing code to work out binary search tree. Before I do this I was wanting to verify my input data in postorder and preorder. I am having trouble working out what the following numbers would be in postorder and preorder I have the following numbers 4, 3, 14 ,8 ,1, 15, 9, 5, 13, 10, 2, 7, 6, 12, 11, that I am intending to put into an empty binary tree in that order. The order I arrived at for the numbers in POSTORDER is 2, 1, 6, 3, 7, 11, 12, 10, 9, 8, 13, 15, 14, 4. Have I got this right? I was wondering if anyone here would be able to kindly verify if the postorder sequence I came up with is indeed the correct sequence for my input i.e doing left subtree, right subtree and then root. The order I got for pre order (Visit root, do left subtree, do right subtree) is 4, 3, 1, 2, 5, 6, 14 , 8, 7, 9, 10, 12, 11, 15, 13. I can't be certain I got this right. Very grateful for any verification. Many Thanks

    Read the article

  • How to modify ASCII table in C ? [closed]

    - by drigoSkalWalker
    Like this: My ASCII Chart 0 1 2 3 4 5 6 7 8 9 A B C D E F 0 NUL SOH STX ETX EOT ENQ ACK BEL BS HT LF VT FF CR SO SI 1 DLE DC1 DC2 DC3 DC4 NAK SYN ETB CAN EM SUB ESC FS GS RS US 2 SP ! " # $ % & ' ( ) * + , - . / 3 0 1 2 3 4 5 6 7 8 9 : ; ? 4 @ A B C D E F G H I J K L M N O 5 P Q R S T U V W X Y Z [ \ ] ^ _ 6 ` a b c d e f g h i j k l m n o 7 p q r s t u v w x y z { | } ~ DEL I want to call a function, alter the ASCII sequence in this function and when it returns, the ASCII sequence back to the original. Thanks in advance! EDIT: What I want is it: I want to change the order of chars, for examble, A is 65, if I want to make A equal a 0? without to make a function to do it, for example, I could accomplish it with a function that compare an array of chars, and store it in another way with the correct value (the new table), but do it is too expensive, is there another way? thanks in advance again!

    Read the article

  • TFS 2010 Build gives WorkItemStore error when Create Work Item on Failure is enabled

    - by Derek Morrison
    I'm using TFS 2010 Build. I have a build definition that uses the DefaultTemplate.xaml template that's stock in TFS 2010, and the Create Work Item on Failure property is set to True in the build definition. I deliberately made a change in my project that breaks the build. When the build runs, I see the compilation error reflected in the TFS Build log within Visual Studio, but I get the error "Value cannot be null. Parameter name: WorkItemStore" when TFS Build next tries to generate a Work Item for the broken build. I tracked down the activity in DefaultTemplate.xaml (see the rather lengthy path to it below) where the Work Item is created for a broken build, and I see it uses the Microsoft.TeamFoundation.Build.Workflow.Activities.OpenWorkItem class to create the Work Item. The appropriate values seemed to be filled out in the Properties window for the Create Work Item activity, so I don't see where I can pass WorkItemStore to it and I don't even know appropriate values for this setting. Path to the Create Work Item activity: Process Sequence Run On Agent Try Compile, Test, and Associate Changesets and Work Items Sequence Compile, Test, and Associate Changesets and Work Items Try Compile and Test Compile and Test For Each Configuration in BuildSettings.PlatformConfigurations Compile and Test for Configuration If BuildSettings.HasProjectsToBuild For Each Project in BuildSettings.ProjectsToBuild Try to Compile the Project Handle Exception If CreateWorkItem Create Work Item for non-Shelveset Builds Create Work Item

    Read the article

  • How can I make an even more random number in ActionScript 2.0

    - by Theo
    I write a piece of software that runs inside banner ads which generates millions of session IDs every day. For a long time I've known that the random number generator in Flash is't random enough to generate sufficiently unique IDs, so I've employed a number of tricks to get even more random numbers. However, in ActionScript 2.0 it's not easy, and I'm seeing more and more collisions, so I wonder if there is something I've overlooked. As far as I can tell the problem with Math.random() is that it's seeded by the system time, and when you have sufficient numbers of simultaneous attempts you're bound to see collisions. In ActionScript 3.0 I use the System.totalMemory, but there's no equivalent in ActionScript 2.0. AS3 also has Font.enumerateFonts, and a few other things that are different from system to system. On the server side I also add the IP address to the session ID, but even that isn't enough (for example, many large companies use a single proxy server and that means that thousands of people all have the same IP -- and since they tend to look at the same sites, with the same ads, roughly at the same time, there are many session ID collisions). What I need isn't something perfectly random, just something that is random enough to dilute the randomness I get from Math.random(). Think of it this way: there is a certain chance that two people will generate the same random number sequence using only Math.random(), but the chance of two people generating the same sequence and having, say, the exact same list of fonts is significantly lower. I cannot rely on having sufficient script access to use ExternalInterface to get hold of things like the user agent, or the URL of the page. I don't need suggestions of how to do it in AS3, or any other system, only AS2 -- using only what's available in the standard APIs. The best I've come up with so far is to use the list of microphones (Microphone.names), but I've also tried to make some fingerprinting using some of the properties in System.capabilities, I'm not sure how much randomness I can get out of that though so I'm not using that at the moment. I hope I've overlooked something.

    Read the article

  • What is the best way to iterate over a large result set in JDBC/iBatis 3?

    - by paul_sns
    We're trying to iterate over a large number of rows from the database and convert those into objects. Behavior will be as follows: Result will be sorted by sequence id, a new object will be created when sequence id changes. The object created will be sent to an external service and will sometimes have to wait before sending another one (which means the next set of data will not be immediately used) We already have invested code in iBatis 3 so an iBatis solution will be the best approach for us (we've tried using RowBounds but haven't seen how it does the iteration under the hood). We'd like to balance minimizing memory usage and reducing number of DB trips. We're also open to pure JDBC approach but we'd like the solution to work on different databases. UPDATE: We need to make as few calls to DB as possible (1 call would be the ideal scenario) while also preventing the application to use too much memory. Are there any other solutions out there for this type of problem may it be pure JDBC or any other technology? Thanks and hope to hear your insights on this.

    Read the article

  • Deterministic and non uniform long string generation from seed

    - by Limonup
    I had this weird idea for an encryption that I wanted to try out, it may be bad, and it may have done before, but I'm just doing it for fun. The short version of the question is: Is it possible to generate a long, deterministic and non-uniformly distributed string/sequence of numbers from a small seed? Long(er) version: I was thinking to encrypt a text by changing encoding. The new encoding would be generated via Huffman algorithm. To work well, the Huffman algorithm would need a fairly long text with non uniform distribution. Then characters can have different bit-lengths which would be the primary strength of this encryption. The problem is that its impractical to enter in/remember a long text each time you want to decrypt the text. So I was wondering if it was possible to generate a text from password seed? It doesn't matter what the text is, as long as it has non uniform distribution of characters and that the exact same sequence can be recreated each time you give it the same seed. Preferably, are there any functions/extensions in Python that can do this? EDIT: To expand on the "strength" of varying bit length: if I have a string "test", ASCII values 116, 101, 115, 116, which gives bit values of 1110100 1100101 1110011 1110100 Then, say my Huffman algorithm generates encoding like t = 101 e = 1100111 s = 10001 The final string is 101 1100111 10001 101, if we encode this back to ASCII, we get 1011100 1111000 1101000, which is 3 entirely different characters. Obviously its impossible to perform any kind of frequency analysis or something like that on this.

    Read the article

  • Is F# a good language for card game AI?

    - by Anthony Brien
    I'm writing a Mahjong Game in C# (the Chinese traditional game, not the solitaire kind). While writing the code for the bot player's AI, I'm wondering if a functional language like F# would be a more suitable language than what I currently use which is C# with a lot of Linq. I don't know much about F# which is why I ask here. To illustrate what I try to solve, here's a quick summary of Mahjong: Mahjong plays a bit like Gin Rummy. You have 13 tiles in your hand, and each turn, you draw a tile and discard another one, trying to improve your hand towards a winning Mahjong hand, which consists or 4 sets and a pair. Sets can be a 3 of a kind (pungs), 4 of a kind (kongs) or a sequence of 3 consecutive tiles (chows). You can also steal another player's discard, if it can complete one of your sets. The code I had to write to detect if the bot can declare 3 consecutive tiles set (chow) is pretty tedious. I have to find all the unique tiles in the hand, and then start checking if there's a sequence of 3 tiles that contain that one in the hand. Detecting if the bot can go Mahjong is even more complicated since it's a combination of detecting if there's 4 sets and a pair in his hand. And that's just a standard Mahjong hand. There's also numerous "special" hands that break those rules but are still a Mahjong hand. For example, "13 unique wonders" consists of 13 specific tiles, "Jade Empire" consists of only tiles colored green, etc. In a perfect world, I'd love to be able to just state the 'rules' of Mahjong, and have the language be able to match a set of 13 tiles against those rules to retrieve which rules it fulfills, for example, checking if it's a Mahjong hand or if it includes a 4 of a kind. Is this something F#'s pattern matching feature can help solve?

    Read the article

  • How can you transform a set of numbers into mostly whole ones?

    - by Alice
    Small amount of background: I am working on a converter that bridges between a map maker (Tiled) that outputs in XML, and an engine (Angel2D) that inputs lua tables. Most of this is straight forward However, Tiled outputs in pixel offsets (integers of absolute values), while Angel2D inputs OpenGL units (floats of relative values); a conversion factor between these two is needed (for example, 32px = 1gu). Since OpenGL units are abstract, and the camera can zoom in or out if the objects are too small or big, the actual conversion factor isn't important; I could use a random number, and the user would merely have to zoom in or out. But it would be best if the conversion factor was selected such that most numbers outputted were small and whole (or fractions of small whole numbers), because that makes it easier to work with (and the whole point of the OpenGL units is that they are easy to work with). How would I find such a conversion factor reliably? My first attempt was to use the smallest number given; this resulted in no fractions below 1, but often lead to lots of decimal places where the factors didn't line up. Then I tried the mode of the sequence, which lead to the largest number of 1's possible, but often lead to very long floats for background images. My current approach gets the GCD of the whole sequence, which, when it works, works great, but can easily be thrown off course by a single bad apple. Note that while I could easily just pass the numbers I am given along, or pick some fixed factor, or use one of the conversions I specified above, I am looking for a method to reliably scale this list of integers to small, whole numbers or simple fractions, because this would most likely be unsurprising to the end user; this is not a one off conversion. The end users tend to use 1.0 as their "base" for manipulations (because it's simple and obvious), so it would make more sense for the sizes of entities to cluster around this.

    Read the article

  • WebService Stubs WSDL Axis2

    - by tt0686
    Good afternoon in my timezone. I have a wsdl file with the following snippet of code: <schema targetNamespace="http://util.cgd.pt" xmlns="http://www.w3.org/2001/XMLSchema"> <import namespace="http://schemas.xmlsoap.org/soap/encoding/" /> <complexType name="Attribute"> <sequence> <element name="fieldType" nillable="true" type="xsd:string" /> <element name="dataType" nillable="true" type="xsd:string" /> <element name="name" nillable="true" type="xsd:string" /> <element name="value" nillable="true" type="xsd:string" /> </sequence> </complexType> <complexType name="ArrayOffAttribute"> <complexContent> <restriction base="soapenc:Array"> <attribute ref="soapenc:arrayType" wsdl:arrayType="tns3:Attribute[]" /> </restriction> </complexContent> </complexType> When i use jax-rpc or Axis1 to generate the stubs the type Attribute is generated, but when i use Axis2 the type Attribute is not generated and a new type is created ArrayOffAttribute, this new type extends the axis2.databinding.types.soapencoding.Array and permits to add elements through the array.addObject(object), my question is, i am migrating one Java EE application from webservices using jax-rpc to start using Axis2, and the methods are using the Attribute type to fullfill attributes fields, now in Axis2 and do not have attribute type , what should i use in the ArrayOffAttribute.addObject(?) ? Could be something wrong with Axis2 ? i am stop here :( Thanks in advance Best regards

    Read the article

  • How to detect a WCF session crash before calling a contract method?

    - by brain_pusher
    I am using a session mode for my WCF service. The problem is the following: if session is broken and no longer exists, client can't know it before calling a contract. For example, if the service has been restarted, the client's session id is invalid, because that session has been closed on the server side. I check the channel state before calling the contract and its value is CommunicationState.Opened even if session is already broken. So, when I call the contract after this check I get a CommunicationException with this message: The remote endpoint no longer recognizes this sequence. This is most likely due to an abort on the remote endpoint. The value of wsrm:Identifier is not a known Sequence identifier. The reliable session was faulted. Is there any workaround? I need a way to get an appropriate session state before calling a contract so that I can restore it without getting an exception. P.S. The CommunicationException type is general, so I can't detect a session crash by catching this exception. P.P.S. I have asked the similar question here, but in that case I didn't know the reason, now I don't know how to evade it.

    Read the article

  • Add child to existing parent record in entity framework.

    - by Shawn Mclean
    My relationship between the parent and child is that they are connected by an edge. It is similiar to a directed graph structure. DAL: public void SaveResource(Resource resource) { context.AddToResources(resource); //Should also add children. context.SaveChanges(); } public Resource GetResource(int resourceId) { var resource = (from r in context.Resources .Include("ToEdges").Include("FromEdges") where r.ResourceId == resourceId select r).SingleOrDefault(); return resource; } Service: public void AddChildResource(int parentResourceId, Resource childResource) { Resource parentResource = repository.GetResource(parentResourceId); ResourceEdge inEdge = new ResourceEdge(); inEdge.ToResource = childResource; parentResource.ToEdges.Add(inEdge); repository.SaveResource(parentResource); } Error: An object with the same key already exists in the ObjectStateManager. The existing object is in the Unchanged state. An object can only be added to the ObjectStateManager again if it is in the added state. Image: I have been told this is the sequence in submitting a child to an already existing parent: Get parent - Attach Child to parent - submit parent. That is the sequence I used. The code above is extracted from an ASP.NET MVC 2 application using the repository pattern.

    Read the article

  • How to define multiple elements in XML Schema with the same name and different attribute value allow

    - by David Skyba
    I would like to create XML Schema for this chunk of xml, I would like to restrict the values of "name" attribute, so that in output document on and only one instance of day is allowed for each week day: <a> <day name="monday" /> <day name="tuesday" /> <day name="wednesday" /> </a> I have tried to use this: <xs:complexType name="a"> <xs:sequence> <xs:element name="day" minOccurs="1" maxOccurs="1"> <xs:complexType> <xs:attribute name="name" use="required"> <xs:simpleType> <xs:restriction base="xs:string"> <xs:enumeration value="monday" /> </xs:restriction> </xs:simpleType> </xs:attribute> </xs:complexType> </xs:element> <xs:element name="day" minOccurs="1" maxOccurs="1"> <xs:complexType> <xs:attribute name="name" use="required"> <xs:simpleType> <xs:restriction base="xs:string"> <xs:enumeration value="tuesday" /> </xs:restriction> </xs:simpleType> </xs:attribute> </xs:complexType> </xs:element> </xs:sequence> </xs:complexType> but XML Schema validator in eclipse says error "Multiple elements with name 'day', with different types, appear in the model group.". Is there any other way?

    Read the article

  • How to approach parallel processing of messages?

    - by Dan
    I am redesigning the messaging system for my app to use intel threading building blocks and am stumped trying to decide between two possible approaches. Basically, I have a sequence of message objects and for each message type, a sequence of handlers. For each message object, I apply each handler registered for that message objects type. The sequential version would be something like this (pseudocode): for each message in message_sequence <- SEQUENTIAL for each handler in (handler_table for message.type) apply handler to message <- SEQUENTIAL The first approach which I am considering processes the message objects in turn (sequentially) and applies the handlers concurrently. Pros: predictable ordering of messages (ie, we are guaranteed a FIFO processing order) (potentially) lower latency of processing each message Cons: more processing resources available than handlers for a single message type (bad parallelization) bad use of processor cache since message objects need to be copied for each handler to use large overhead for small handlers The pseudocode of this approach would be as follows: for each message in message_sequence <- SEQUENTIAL parallel_for each handler in (handler_table for message.type) apply handler to message <- PARALLEL The second approach is to process the messages in parallel and apply the handlers to each message sequentially. Pros: better use of processor cache (keeps the message object local to all handlers which will use it) small handlers don't impose as much overhead (as long as there are other handlers also to be run) more messages are expected than there are handlers, so the potential for parallelism is greater Cons: Unpredictable ordering - if message A is sent before message B, they may both be processed at the same time, or B may finish processing before all of A's handlers are finished (order is non-deterministic) The pseudocode is as follows: parallel_for each message in message_sequence <- PARALLEL for each handler in (handler_table for message.type) apply handler to message <- SEQUENTIAL The second approach has more advantages than the first, but non-deterministic ordering is a big disadvantage.. Which approach would you choose and why? Are there any other approaches I should consider (besides the obvious third approach: parallel messages and parallel handlers, which has the disadvantages of both and no real redeeming factors as far as I can tell)? Thanks!

    Read the article

  • Performance: float to int cast and clipping result to range

    - by durandai
    I'm doing some audio processing with float. The result needs to be converted back to PCM samples, and I noticed that the cast from float to int is surprisingly expensive. Whats furthermore frustrating that I need to clip the result to the range of a short (-32768 to 32767). While I would normally instictively assume that this could be assured by simply casting float to short, this fails miserably in Java, since on the bytecode level it results in F2I followed by I2S. So instead of a simple: int sample = (short) flotVal; I needed to resort to this ugly sequence: int sample = (int) floatVal; if (sample > 32767) { sample = 32767; } else if (sample < -32768) { sample = -32768; } Is there a faster way to do this? (about ~6% of the total runtime seems to be spent on casting, while 6% seem to be not that much at first glance, its astounding when I consider that the processing part involves a good chunk of matrix multiplications and IDCT) EDIT The cast/clipping code above is (not surprisingly) in the body of a loop that reads float values from a float[] and puts them into a byte[]. I have a test suite that measures total runtime on several test cases (processing about 200MB of raw audio data). The 6% were concluded from the runtime difference when the cast assignment "int sample = (int) floatVal" was replaced by assigning the loop index to sample. EDIT @leopoldkot: I'm aware of the truncation in Java, as stated in the original question (F2I, I2S bytecode sequence). I only tried the cast to short because I assumed that Java had an F2S bytecode, which it unfortunately does not (comming originally from an 68K assembly background, where a simple "fmove.w FP0, D0" would have done exactly what I wanted).

    Read the article

  • WSDL AXIS Arrays

    - by SKS
    I am trying to create wsdl definition for the below soap response, < reasonCode Required="TRUE" < ValidCodeRR< /ValidCode < ValidCodeRB< /ValidCode < ValidCodeRT< /ValidCode < ValidCodeAR< /ValidCode < /reasonCode Below is the wsdl definition I have, < xsd:complexType < xsd:sequence < xsd:element name="ValidCode" type="xsd:string" minOccurs="0" maxOccurs="20" / < /xsd:sequence < xsd:attribute name="Required" type="xsd:string" / < /xsd:complexType < /xsd:element I am using Axis 1 to generate the webservices client and for the above wsdl definition, the tool generates the reasonCode as a string array like below. private java.lang.String[] reasonCode It ignores the attribute required. Does anyone know how to write wsdl defintion, such that axis creates reasonCode as an element with an attribute "required". Any help on this would be greatly appreciated. Thanks, SK

    Read the article

  • Problem: writing parameter values to data driven MSTEST output

    - by Shubh
    Hi, I am trying to extract some information about the parameter variants used in an MSTEST data driven test case from trx file. Currently, For data driven tests, I get the output of same testcase with different inputs as a sequence of tags , but there is no info about the value of the variants. Example: Suppose we have a [data driven]TestMethod1() and the data rows contain variations a and b. There are two variations a=1,b=2 for which the test passes and a=3,b=4 for which the test fails. If we can output the info that it was a=1,b=2 which passed and a=3 b=4 which failed in the trx file; the output will be meaningful. Better information about test case runs from the output file alone(without any dependencies). Investigating the test failure without rerunning the whole set If the data rows change in data source(now a=1,b=2 pass and a=5,b=6 fail) , easy to decipher that the errors are different; although the fail sequence is still the same(row 0 pass row 1 fail but now row1 is different) Has any of you gone through a similar problem? What did you follow? I tried to put the parameter value information in the Description attribute of TestMethod, it didnt work. Any other methods you think can work too? thanks, Shubhankar

    Read the article

  • Validating and filling default values in XML based on XSD in Python

    - by PoltoS
    I have an XML like <a> <b/> <b c="2"/> </a> I have my XSD <xs:element name="a"> <xs:complexType> <xs:sequence> <xs:element name="b" maxOccurs="unbounded"> <xs:attribute name="c" default="1"/> </xs:element> </xs:sequence> </xs:complexType> </xs:element> I want to use my XSD to validate my original XML and fill all default values: <a> <b c="1"/> <b c="2"/> </a> How do I get it in Python? With validation there is no problem (e.g. XMLSchema). The problem are the default values.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How do I correctly reference georss: point in my xsd?

    - by Chris Hinch
    I am putting together an XSD schema to describe an existing GeoRSS feed, but I am stumbling trying to use the external georss.xsd to validate an element of type georss:point. I've reduced the problem to the smallest components thusly: XML: <?xml version="1.0" encoding="utf-8"?> <this> <apoint>45.256 -71.92</apoint> </this> XSD: <xs:schema xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:georss="http://www.georss.org/georss"> <xs:import namespace="http://www.georss.org/georss" schemaLocation="http://georss.org/xml/1.1/georss.xsd"/> <xs:element name="this"> <xs:complexType> <xs:sequence> <xs:element name="apoint" type="georss:point"/> </xs:sequence> </xs:complexType> </xs:element> </xs:schema> If I make apoint type "xs: string" instead of "georss: point", the XML validates happily against the XSD, but as soon as I reference an imported type (georss: point), my XML validator (Notepad++ | XML Tools) "cannot parse the schema". What am I doing wrong?

    Read the article

  • git changes modification time of files

    - by tanascius
    In the GitFaq I can read, that Git sets the current time as the timestamp on every file it modifies, but only those. However, I tried this command sequence (EDIT: added complete command sequence) $ git init test && cd test Initialized empty Git repository in d:/test/.git/ exxxxxxx@wxxxxxxx /d/test (master) $ touch filea fileb exxxxxxx@wxxxxxxx /d/test (master) $ git add . exxxxxxx@wxxxxxxx /d/test (master) $ git commit -m "first commit" [master (root-commit) fcaf171] first commit 0 files changed, 0 insertions(+), 0 deletions(-) create mode 100644 filea create mode 100644 fileb exxxxxxx@wxxxxxxx /d/test (master) $ ls -l > filea exxxxxxx@wxxxxxxx /d/test (master) $ touch fileb -t 200912301000 exxxxxxx@wxxxxxxx /d/test (master) $ ls -l total 1 -rw-r--r-- 1 exxxxxxx Administ 132 Feb 12 18:36 filea -rw-r--r-- 1 exxxxxxx Administ 0 Dec 30 10:00 fileb exxxxxxx@wxxxxxxx /d/test (master) $ git status -a warning: LF will be replaced by CRLF in filea # On branch master warning: LF will be replaced by CRLF in filea # Changes to be committed: # (use "git reset HEAD <file>..." to unstage) # # modified: filea # exxxxxxx@wxxxxxxx /d/test (master) $ git checkout . exxxxxxx@wxxxxxxx /d/test (master) $ ls -l total 0 -rw-r--r-- 1 exxxxxxx Administ 0 Feb 12 18:36 filea -rw-r--r-- 1 exxxxxxx Administ 0 Feb 12 18:36 fileb Now my question: Why did git change the timestamp of file fileb? I'd expect the timestamp to be unchanged. Are my commands causing a problem? Maybe it is possible to do something like a git checkout . --modified instead? I am using git version 1.6.5.1.1367.gcd48 under mingw32/windows xp.

    Read the article

  • CCAnimate/CCAnimation cause inconsistent setTexture behavior in cocos2d on iPhone

    - by chillid
    Hi, I have a character that goes through multiple states. The state changes are reflected by means of a sprite image (texture) change. The state change is triggered by a user tapping on the sprite. This works consistently and quite well. I then added an animation during State0. Now, when the user taps - setTexture gets executed to change the texture to reflect State1, however some of the times (unpredictable) it does not change the texture. The code flows as below: // 1. // Create the animation sequence CGRect frame1Rect = CGRectMake(0,32,32,32); CGRect frame2Rect = CGRectMake(32,32,32,32); CCTexture2D* texWithAnimation = [[CCTextureCache sharedTextureCache] addImage:@"Frames0_1_thinkNthickoutline32x32.png"]; id anim = [[[CCAnimation alloc] initWithName:@"Sports" delay:1/25.0] autorelease]; [anim addFrame:[CCSpriteFrame frameWithTexture:texWithAnimation rect:frame1Rect offset:ccp(0,0)]]; [anim addFrame:[CCSpriteFrame frameWithTexture:texWithAnimation rect:frame2Rect offset:ccp(0,0)]]; // Make the animation sequence repeat forever id myAction = [CCAnimate actionWithAnimation: anim restoreOriginalFrame:NO]; // 2. // Run the animation: sports = [[CCRepeatForever alloc] init]; [sports initWithAction:myAction]; [self.sprite runAction:sports]; // 3. stop action on state change and change texture: NSLog(@"Stopping action"); [sprite stopAction:sports]; NSLog(@"Changing texture for kCJSports"); [self setTexture: [[CCTextureCache sharedTextureCache] addImage:@"SportsOpen.png"]]; [self setTextureRect:CGRectMake(0,0,32,64)]; NSLog(@"Changed texture for kCJSports"); Note that all the NSLog lines get logged - and the texture RECT changes - but the image/texture changes only some of the times - fails for around 10-30% of times. Locking/threading/timing issue somewhere? My app (game) is single threaded and I only use the addImage and not the Async version. Any help much appreciated.

    Read the article

  • C# iterator is executed twice when composing two IEnumerable methods

    - by achristoph
    I just started learning about C# iterator but got confused with the flow of the program after reading the output of the program. The foreach with uniqueVals seems to be executed twice. My understanding is that the first few lines up to the line before "Nums in Square: 3" should not be there. Can anyone help to explain why this happens? The output is: Unique: 1 Adding to uniqueVals: 1 Unique: 2 Adding to uniqueVals: 2 Unique: 2 Unique: 3 Adding to uniqueVals: 3 Nums in Square: 3 Unique: 1 Adding to uniqueVals: 1 Square: 1 Number returned from Unique: 1 Unique: 2 Adding to uniqueVals: 2 Square: 2 Number returned from Unique: 4 Unique: 2 Unique: 3 Adding to uniqueVals: 3 Square: 3 Number returned from Unique: 9 static class Program { public static IEnumerable<T> Unique<T>(IEnumerable<T> sequence) { Dictionary<T, T> uniqueVals = new Dictionary<T, T>(); foreach (T item in sequence) { Console.WriteLine("Unique: {0}", item); if (!uniqueVals.ContainsKey(item)) { Console.WriteLine("Adding to uniqueVals: {0}", item); uniqueVals.Add(item, item); yield return item; Console.WriteLine("After Unique yield: {0}", item); } } } public static IEnumerable<int> Square(IEnumerable<int> nums) { Console.WriteLine("Nums in Square: {0}", nums.Count()); foreach (int num in nums) { Console.WriteLine("Square: {0}", num); yield return num * num; Console.WriteLine("After Square yield: {0}", num); } } static void Main(string[] args) { var nums = new int[] { 1, 2, 2, 3 }; foreach (int num in Square(Unique(nums))) Console.WriteLine("Number returned from Unique: {0}", num); Console.Read(); } }

    Read the article

  • myXmlDataDoc.DataSet.ReadXml problem

    - by alex
    Hi: I am using myXmlDataDoc.DataSet.ReadXml(xml_file_name, XmlReadMode.InferSchema); to populate the tables within the dataset created by reading in a xml schema using: myStreamReader = new StreamReader(xsd_file_name); myXmlDataDoc.DataSet.ReadXmlSchema(myStreamReader); The problems I am facing is when it comes to read the xml tag: The readXml function puts the element in a different table and everything in the tables are 0s. Here is the print out of the datatable: TableName: test_data 100 2 1 TableName: parameters 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 9 0 10 0 11 0 12 0 In my xsd file, I represent an array using this: <xs:element name="test_data"> <xs:complexType> <xs:complexContent> <xs:extension base="test_base"> <xs:sequence> <xs:element name="a" type="xs:unsignedShort"/> <xs:element name="b" type="xs:unsignedShort"/> <xs:element name="c" type="xs:unsignedInt"/> <xs:element name="parameters" minOccurs="0" maxOccurs="12" type="xs:unsignedInt"/> </xs:sequence> </xs:extension> </xs:complexContent> </xs:complexType> And here is my xml file: 100 2 1 1 2 3 4 5 6 7 8 9 10 11 12 I am expecting after the readXml function call, the "parameters" is part of the test_data table. TableName: test_data 100 2 1 1 2 3 4 5 6 7 8 9 10 11 12 Does anyone knows what's wrong? Thanks

    Read the article

  • Is there a general-purpose printf-ish routine defined in any C standard

    - by supercat
    In many C libraries, there is a printf-style routine which is something like the following: int __vgprintf(void *info, (void)(*print_function(void*, char)), const char *format, va_list params); which will format the supplied string and call print_function with the passed-in info value and each character in sequence. A function like fprintf will pass __vgprintf the passed-in file parameter and a pointer to a function which will cast its void* to a FILE* and output the passed-in character to that file. A function like snprintf will create a struct holding a char* and length, and pass the address of that struct to a function which will output each character in sequence, space permitting. Is there any standard for such a function, which could be used if e.g. one wanted a function to output an arbitrary format to a TCP port? A common approach is to allocate a buffer one hopes is big enough, use snprintf to put the data there, and then output the data from the buffer. It would seem cleaner, though, if there were a standard way to to specify that the print formatter should call a user-supplied routine with each character.

    Read the article

  • Schema for element with Attributes and Child nodes

    - by Matthew
    I am trying to write xsd type schema for an element that has a custom type to include addition attributes to extend a base type. I am running into trouble getting the syntax right. <xs:element name="graphs"> <xs:complexType> <xs:sequence> <xs:element name="graph" minOccurs="1" maxOccurs="unbounded" type="graphType"> <!-- child elements --> </xs:element> </xs:sequence> </xs:complexType> </xs:element> <xs:complexType name="graphType"> <xs:simpleContent> <xs:extension base="xs:string"> <xs:attribute name="title" type="xs:string"/> <xs:attribute name="type" type="xs:string"/> </xs:extension> </xs:simpleContent> </xs:complexType> I thought this would be something very common, but having read many tuts and forums, I cant seem to find an answer that works for me.

    Read the article

< Previous Page | 48 49 50 51 52 53 54 55 56 57 58 59  | Next Page >