Search Results

Search found 62532 results on 2502 pages for 'id string'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 521/2502 | < Previous Page | 517 518 519 520 521 522 523 524 525 526 527 528  | Next Page >

  • Dataset Binding stored procedures update/insert/delete

    - by Jin
    Hi all, I am currently having a problem since the DB has been changed. I am using Datasets for a c# application, and there is a user management system. For the security issues, our current DB design is like user log into app. DB returns a session ID On use of any other stored procedures, a session ID must be specified. BUT, the DB didn't request session ID before. since I am using the datasets, I used update/insert/delete stored procedures with "TableAdaptor Configuration Wizard". Bind Commands to Existing Stored Procedures (choose stored procedures to call and specify any reuiqred parameters) Now, it seems like I have to specify session ID for Insert/Update/Delete stored procedures. How do I specify session ID parameter here? It seems like I have to pick one return parameter variable from a select statement. Thanks,

    Read the article

  • How to use RedirectToAction to redirect to the default action of different controller?

    - by atbebtg
    I am trying to do a RedirectToAction from http://mywebsite/Home/ using the following code: return RedirectToAction("Index","Profile", new { id = formValues["id"] }); The above code will succesfully take me to http://mywebsite/Profile/Index/223224 What do I have to do to make it redirect to http://mywebsite/Profile/223224 Thank you. I figured out how to do this. First I have to add custom route rule: routes.MapRoute("Profile", "Profile/{id}", new { controller = "Profile", action = "Index", id = UrlParameter.Optional }); Then I can do the following: [AcceptVerbs(HttpVerbs.Post)] public RedirectResult Index(FormCollection formValues) { return Redirect("~/Survey/" + formValues["Id"]); }

    Read the article

  • Creating a textarea with auto-resize

    - by DisgruntledGoat
    There was another thread about this, which I've tried. But there is one problem: the textarea doesn't shrink if you delete the content. I can't find any way to shrink it to the correct size - the clientHeight value comes back as the full size of the textarea, not its contents. The code from that page is below. I'd appreciate any help or pointers. function FitToContent(id, maxHeight) { var text = id && id.style ? id : document.getElementById(id); if ( !text ) return; var adjustedHeight = text.clientHeight; if ( !maxHeight || maxHeight > adjustedHeight ) { adjustedHeight = Math.max(text.scrollHeight, adjustedHeight); if ( maxHeight ) adjustedHeight = Math.min(maxHeight, adjustedHeight); if ( adjustedHeight > text.clientHeight ) text.style.height = adjustedHeight + "px"; } } window.onload = function() { document.getElementById("ta").onkeyup = function() { FitToContent( this, 500 ) }; }

    Read the article

  • Passing parameters among views in a navigation frame INSIDE a custom control

    - by NetWriter
    I created a silverlight 3 application with a navigation frame and 3 views: search, add and edit. I used the app file to pass parameters among the 3 pages, eg: ((App)Application.Current).SNIPSELECTED = currentSnip; Then in the receiving page: currentSnip = ((App)Application.Current).SNIPSELECTED; currentSnip is a SnipItem object: public class SnipItem { public string itemID {get;set;} public string category {get;set;} public string itemDescription {get;set;} public string codeSnip {get;set;} } This worked fine until I decided to make this entire application into a user control and put that inside a second silverlight application with its own navigation frame and app file. The app files are getting confused. The first app file with all my parameter passing is not being read. I know how to pass a simple parameter between views in the first application without the app file (in a query string), but how about these custom types like my currentSnip above?

    Read the article

  • Why is the output like this?

    - by javatechi
    class another { public void method(Object o) { System.out.println("This is in method which takes object"); } public void method(String s) { System.out.println("This is method which takes string"); } } public class NewClass { public static void main(String args[]) { another an = new another(); an.method(null); } } When I try to execute this, I get This is method which takes string as the output. Why not "This is in method which takes object"? Object can also be null and string can also be null, why doesn't it invoke first method?

    Read the article

  • jquery .load() function only gets called once

    - by user1288099
    the html <div class="stackwrapper" id="user1"></div> <div class="stackwrapper" id="user2"></div> <div class="userdrawings"></div> the javascript $('.stackwrapper').click(function(e){ var id=$(this).attr('id'); $('.userdrawings').load('loadSession.php?user='+id).fadeIn("slow"); }); Somehow it only works at once, only at the first click on stackwrapper, when I click on the second one, the function is not triggered again.

    Read the article

  • How to make UPDATE queries in LINQ to SQL?

    - by Alex
    I like using LINQ to SQL. The only problem is that I don't like the default way of updating tables. Let's say I have the following table with the following columns: ID (primary key), value1, value2, value3, value4, value5 When I need to update something I call UPDATE ... WHERE ID=@id LINQ to SQL call UPDATE ... WHERE ID=@id and value1=@value1 and value2=@value2 and value3=@value3 and value4=@value4 and value5=@value5 I can override this behavior by adding UpdateCheck=UpdateCheck.Never to every column, but with every update of the DataContext class with the GUI, this will be erased. Is there any way to tell LINQ to use this way of updating data?

    Read the article

  • MySQL AND alternative for eatch table in a join

    - by Scott
    I have a simple join in a query however I need to have a condition on both of the tables "confirmed='yes'" but if one of the tables doesn't have any that match the query returns with no rows. Database: .----------parties----------. | id - party_id - confirmed | |---------------------------| | 1 1 yes | | 1 2 no | | 1 3 no | +---------------------------+ .-----------events----------. | id - event_id - confirmed | |---------------------------| | 1 1 no | +---------------------------+ Query: SELECT p.party_id, e.event_id FROM parties p LEFT JOIN events e ON p.id=e.id WHERE p.id = '1' AND p.party_id IN (1,2,3) AND e.event_id IN (1) AND p.confirmed='yes' AND e.confirmed='yes' It returns nothing but I want it to return party_id 1 with a empty event_id. I hope this make sense and I not missing anything, Thanks for your help!

    Read the article

  • Full automatic application trace for .net v4

    - by JL
    I would like to implement a way to trace every line of code in an application that is written for .net v4.0. An example would be. If I had the following function. private bool hasValue(string value) { if(string.isnullorempty(value) { return false; } else { return true; }} Then when the function is called I want detailed trace logs to contain something like this: Function called |Line 10 |Signature private bool hasValue(string value)|ValuesPassed hasValue("") Line Evaluated | Line 11 | if(string.isnullorempty(value) |ValuesPassed if(string.isnullorempty("") - evaluation returned true entered line 13 |signature return false|return action taken. This tracing can be done manually, but its a lot of work, and would dirty the code. Isn't there a way to get this level of tracing automatically with .net or 3rd party plugin? Thank you

    Read the article

  • Is it bad practice to initialize a variable to a dummy value?

    - by froadie
    This question is a result of the answers to this question that I just asked. It was claimed that this code is "ugly" because it initializes a variable to a value that will never be read: String tempName = null; try{ tempName = buildFileName(); } catch(Exception e){ ... System.exit(1); } FILE_NAME = tempName; Is this indeed bad practice? Should one avoid initializing variables to dummy values that will never actually be used? (EDIT - And what about initializing a String variable to "" before a loop that will concatenate values to the String...? Or is this in a separate category? e.g. String whatever = ""; for(String str : someCollection){ whatever += str; } )

    Read the article

  • How to assign one object to another in Linq c# without making new

    - by LLL
    I m facing issue in assiging one object to another in linq sql. In this example Func<result, result> make = q => new result { Id = q.Id, lName = q.lName, GroupId = q.GroupId, Age = (from tags in q.age where tags.Del == null && tags.lId == q.Id select age).ToEntitySet(), }; p = (from q in dc.results where q.Id == Id.Value select make(q)).First(); i am making new and assigning the object, but i dont want to do this, it will cause propblem in insertion. so i want to assign without making new, how is it possible?

    Read the article

  • How to get tag parameter value with XQuery

    - by uni
    For example i have this xml. I need to get value of parameter val of tag foo with id="two" <top> <sub id="one"> <foo id="two" val="bar" /> sometext </sub> </top> Whis this query (using Qt QXmlQuery): doc('test.xml')/top/sub[@id='one']/foo[@id='two']/<p>{@val}</p> I receive <p val="bar"/>, but I need only text "bar" without any tags. I tried to remove <p> and </p> and receive syntax error, unexpected { How can i get parameter value without any tags?

    Read the article

  • suppose there is a class which contains 4 data fields.i have to read these value from xml file and s

    - by SunilRai86
    suppose there is a class which contains 4 fields.i have to read these value from xml file and set that value to fields the xml file is like that <Root> <Application > <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>ABC</ClassName> <ExecName>XYZ</ExecName> </Application> <Application> <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>abc</ClassName> <ExecName>xyz</ExecName> </Application> </Root> now i have to read all the values from xml file and set each value to particular fields. i hav done reading of the xml file and i saved the retrieved value in arraylist. the code is like that public class CXmlFileHook { string appname; string classname; string idmark; string execname; string ctor; public CXmlFileHook() { this.appname = "Not Set"; this.idmark = "Not Set"; this.classname = "Not Set"; this.execname = "Not Set"; this.ctor = "CXmlFileHook()"; } public void readFromXmlFile(string path) { XmlTextReader oRreader = new XmlTextReader(@"D:\\Documents and Settings\\sunilr\\Desktop\\MLPACK.xml"); //string[] strNodeValues = new string[4] { "?","?","?","?"}; ArrayList oArrayList = new ArrayList(); while (oRreader.Read()) { if (oRreader.NodeType == XmlNodeType.Element) { switch (oRreader.Name) { case "AppName": oRreader.Read(); //strNodeValues[0] =oRreader.Value; oArrayList.Add(oRreader.Value); break; case "IdMark": oRreader.Read(); //strNodeValues[1] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ClassName": oRreader.Read(); //strNodeValues[2] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ExecName": oRreader.Read(); //strNodeValues[3] = oRreader.Value; oArrayList.Add(oRreader.Value); break; } } } Console.WriteLine("Reading from arraylist"); Console.WriteLine("-------------------------"); for (int i = 0; i < oArrayList.Count; i++) { //Console.WriteLine("Reading from Sting[]"+ strNodeValues[i]); Console.WriteLine(oArrayList[i]); } //this.appname = strNodeValues[0]; //this.idmark = strNodeValues[1]; //this.classname = strNodeValues[2]; //this.execname = strNodeValues[3]; this.appname = oArrayList[0].ToString(); this.idmark = oArrayList[1].ToString(); this.classname = oArrayList[2].ToString(); this.execname = oArrayList[3].ToString(); } static string vInformation; public void showCurrentState(string path) { FileStream oFileStream = new FileStream(path, FileMode.Append, FileAccess.Write); StreamWriter oStreamWriter = new StreamWriter(oFileStream); oStreamWriter.WriteLine("****************************************************************"); oStreamWriter.WriteLine(" Log File "); oStreamWriter.WriteLine("****************************************************************"); CXmlFileHook oFilehook = new CXmlFileHook(); //Type t = Type.GetType(this._classname); //Type t = typeof(CConfigFileHook); DateTime oToday = DateTime.Now; vInformation += "Logfile created on : "; vInformation += oToday + Environment.NewLine; vInformation += "Public " + Environment.NewLine; vInformation += "----------------------------------------------" + Environment.NewLine; vInformation += "Private " + Environment.NewLine; vInformation += "-----------------------------------------------" + Environment.NewLine; vInformation += "ctor = " + this.ctor + Environment.NewLine; vInformation += "appname = " + this.appname + Environment.NewLine; vInformation += "idmark = " + this.idmark + Environment.NewLine; vInformation += "classname = " + this.classname + Environment.NewLine; vInformation += "execname = " + this.execname + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; vInformation += "Protected" + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; oStreamWriter.WriteLine(vInformation); oStreamWriter.Flush(); oStreamWriter.Close(); oFileStream.Close(); } } here i set set the fields according to arraylist index but i dont want is there any another solution for this....

    Read the article

  • loop for Cursor1.moveToPosition() in android

    - by Edward Sullen
    I want to get data in the first column of all row from my database and convert to String[] ... List<String> item1 = new ArrayList<String>(); // c is a cursor which pointed from a database for(int i=0;i<=nombre_row;i++) { c.moveToPosition(i); item1.add(c.getString(0)); } String[] strarray = new String[item1.size()]; item1.toArray(strarray ); I've tried to command step by step, and found that the problem is in the Loop for.... Please help... thanks in advance for all answer.

    Read the article

  • Simple jQuery Toggle of children

    - by Rick
    Um, why no worky? Trying to toggle a ul with this: $("#others").children(".btn").click(function(){ if ($(this).children("ul").is(":hidden")) { $(this).children("ul").slideDown(); } else { $(this).children("ul").slideUp(); } }); And: <div id="other"> <div id="galleries"> <a href="#" class="btn">Galleries >> </a> <ul id="select_gallery"> ... </ul> </div> <div id="events"> <a href="#" class="btn">Events >> </a> <ul id="select_event"> ... </ul> </div> </div>

    Read the article

  • Casting complex class into a dataset?

    - by iTayb
    This is the class I'm trying to turn into a dataset: public class BookStore { private List<Book> booksList; } public class Book { private string name; private string imageurl; private string subject; private string author; private int level; private int year; private int rating; private List<string> booksellers; private List<decimal> bookprices; } There are proprieties, of course. How can I turn it into a dataset? Thank you very much.

    Read the article

  • Why does this MSDN example for Func<> delegate have a superfluous Select() call?

    - by Dan
    The MSDN gives this code example in the article on the Func Generic Delegate: Func<String, int, bool> predicate = ( str, index) => str.Length == index; String[] words = { "orange", "apple", "Article", "elephant", "star", "and" }; IEnumerable<String> aWords = words.Where(predicate).Select(str => str); foreach (String word in aWords) Console.WriteLine(word); I understand what all this is doing. What I don't understand is the Select(str => str) bit. Surely that's not needed? If you leave it out and just have IEnumerable<String> aWords = words.Where(predicate); then you still get an IEnumerable back that contains the same results, and the code prints the same thing. Am I missing something, or is the example misleading?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • assigning a rank based on total sales

    - by Nathaniel_613
    I need to create a field called “rank”, that ranks each part ID based on total sales, by assigning a sequential number based on total sales, where the higher the total sales, then the lower the rank value. For example, the part ID with the most sales would have a rank value of “1” and the part ID with the next highest sales would have a rank value of “2” and the part ID with the lowest sales would rank with the highest number. If 2 different parts ID’s have the same total sales, then it is OK if they share the same rank. Please provide me the SQL to copy and paste Thank you very much in advance, Nathaniel SELECT qry_rank_01.[total sales amount], qry_rank_01.PART_ID FROM qry_rank_01;

    Read the article

  • replace \n and \r\n with <br /> in java

    - by Bala R
    This has been asked several times for several languages but I can't get it to work. I have a string like this String str = "This is a string.\nThis is a long string."; And I'm trying to replace the \n with <br /> using str = str.replaceAll("(\r\n|\n)", "<br />"); but the \n is not getting replaced. I tried to use this RegEx Tool to verify and I see the same result. The input string does not have a match for "(\r\n|\n)". What am i doing wrong ?

    Read the article

  • anonymous type and multiple properties

    - by ognjenb
    I have this error: An anonymous type cannot have multiple properties with the same name. Whether this can be resolved with alias ie, whether an alias exists in LINQ var device_query = from d in DevicesEntities.device join dt in DevicesEntities.devicetype on d.DeviceTypeId equals dt.Id join l in DevicesEntities.location on d.Id equals l.DeviceId join loc in DevicesEntities.locationname on l.LocationNameId equals loc.Id where l.DeviceId == d.Id select new { d.Id, d.DeviceTypeId, d.SerialNumber, d.FirmwareRev, d.ProductionDate, d.ReparationDate, d.DateOfLastCalibration, d.DateOfLastCalibrationCheck, d.CalCertificateFile, d.Notes, d.TestReportFile, d.WarrantyFile, d.CertificateOfOriginFile, d.QCPermissionFile, d.Reserved, d.ReservedFor, d.Weight, d.Price, d.SoftwareVersion, dt.Name, dt.ArticleNumber, dt.Type, l.StartDate, //AS LastStartDate, l.LocationNameId, loc.Name //in this line I have problem };

    Read the article

  • Dynamic "WHERE IN" on IQueryable (linq to SQL)

    - by user320235
    I have a LINQ to SQL query returning rows from a table into an IQueryable object. IQueryable<MyClass> items = from table in DBContext.MyTable select new MyClass { ID = table.ID, Col1 = table.Col1, Col2 = table.Col2 } I then want to perform a SQL "WHERE ... IN ...." query on the results. This works fine using the following. (return results with id's ID1 ID2 or ID3) sQuery = "ID1,ID2,ID3"; string[] aSearch = sQuery.Split(','); items = items.Where(i => aSearch.Contains(i.ID)); What I would like to be able to do, is perform the same operation, but not have to specify the i.ID part. So if I have the string of the field name I want to apply the "WHERE IN" clause to, how can I use this in the .Contains() method?

    Read the article

  • In JPA, a Map of embeddable values, that have an embedded entity used as the key

    - by Schmuli
    I'm still new to JPA (and Hibernate, which I'm using as my provider), so maybe this just can't be done, but anyway... Consider the following code: @Entity class Root { @Id private long id; private String name; @ElementCollection private Map<ResourceType, Resource> resources; ... } @Entity class ResourceType { @Id private long id; private String name; } @Embeddable class Resource { private ResourceType resourceType; private long value; } In the database, there is a collection table, 'Root_resources', that stores the values of the map, but the resource type appears twice (actually, the resource type ID does), once as the KEY of the map, and once as part of the value. Is there a way, similar to, say, the @MapKey annotation, to indicate that the key is one of the columns of the value (i.e. embedded)?

    Read the article

  • Generic Dictionary - Getting Conversion Error

    - by pm_2
    The following code is giving me an error: // GetDirectoryList() returns Dictionary<string, DirectoryInfo> Dictionary<string, DirectoryInfo> myDirectoryList = GetDirectoryList(); // The following line gives a compile error foreach (Dictionary<string, DirectoryInfo> eachItem in myDirectoryList) The error it gives is as follows: Cannot convert type 'System.Collections.Generic.KeyValuePair<string,System.IO.DirectoryInfo>' to 'System.Collections.Generic.Dictionary<string,System.IO.DirectoryInfo>’ My question is: why is it trying to perform this conversion? Can I not use a foreach loop on this type of object?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 517 518 519 520 521 522 523 524 525 526 527 528  | Next Page >