Search Results

Search found 62532 results on 2502 pages for 'id string'.

Page 522/2502 | < Previous Page | 518 519 520 521 522 523 524 525 526 527 528 529  | Next Page >

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • How to assign one object to another in Linq c# without making new

    - by LLL
    I m facing issue in assiging one object to another in linq sql. In this example Func<result, result> make = q => new result { Id = q.Id, lName = q.lName, GroupId = q.GroupId, Age = (from tags in q.age where tags.Del == null && tags.lId == q.Id select age).ToEntitySet(), }; p = (from q in dc.results where q.Id == Id.Value select make(q)).First(); i am making new and assigning the object, but i dont want to do this, it will cause propblem in insertion. so i want to assign without making new, how is it possible?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • In JPA, a Map of embeddable values, that have an embedded entity used as the key

    - by Schmuli
    I'm still new to JPA (and Hibernate, which I'm using as my provider), so maybe this just can't be done, but anyway... Consider the following code: @Entity class Root { @Id private long id; private String name; @ElementCollection private Map<ResourceType, Resource> resources; ... } @Entity class ResourceType { @Id private long id; private String name; } @Embeddable class Resource { private ResourceType resourceType; private long value; } In the database, there is a collection table, 'Root_resources', that stores the values of the map, but the resource type appears twice (actually, the resource type ID does), once as the KEY of the map, and once as part of the value. Is there a way, similar to, say, the @MapKey annotation, to indicate that the key is one of the columns of the value (i.e. embedded)?

    Read the article

  • MySQL AND alternative for each table in a join

    - by Scott
    I have a simple join in a query however I need to have a condition on both of the tables "confirmed='yes'" but if one of the tables doesn't have any that match the query returns with no rows. Database: .----------parties----------. | id - party_id - confirmed | |---------------------------| | 1 1 yes | | 1 2 no | | 1 3 no | +---------------------------+ .-----------events----------. | id - event_id - confirmed | |---------------------------| | 1 1 no | +---------------------------+ Query: SELECT p.party_id, e.event_id FROM parties p LEFT JOIN events e ON p.id=e.id WHERE p.id = '1' AND p.party_id IN (1,2,3) AND e.event_id IN (1) AND p.confirmed='yes' AND e.confirmed='yes' It returns nothing but I want it to return party_id 1 with a empty event_id. I hope this make sense and I not missing anything, Thanks for your help!

    Read the article

  • parse json news feed array android

    - by user1827260
    I have an json feed from bbc in this format { "name": "ticker", "entries": [ { "headline": "text", "prompt": "LATEST", "isBreaking": "false", "mediaType": "Standard", "url": "" }, { "headline": "text", "prompt": "LATEST", "isBreaking": "false", "mediaType": "Standard", "url": "" }, etc........... My code is as follows: ArrayList mylist = new ArrayList(); JSONObject json = JSONfunctions.getJSONfromURL("http:/......"); try{ JSONArray item = json.getJSONArray("entries"); for (int i = 0; i<item.length(); i++) { HashMap<String, String> map = new HashMap<String, String>(); JSONObject e = item.getJSONObject(i); JSONObject title = e.JSONObject("headline"); map.put("title", "Title:" + e.getString("headline"); } It gives me the error "java.lang.String cannot be converted to JSONObject" I also tried leaving out JSONObject title = e.JSONObject("headline"); and it gives me a path error (note

    Read the article

  • How to validate phone number(US format) in Java?

    - by Maxood
    I just want to know where am i wrong here: import java.io.*; class Tokens{ public static void main(String[] args) { //String[] result = "this is a test".split(""); String[] result = "4543 6546 6556".split(""); boolean flag= true; String num[] = {"0","1","2","3","4","5","6","7","8","9"}; String specialChars[] = {"-","@","#","*"," "}; for (int x=1; x<result.length; x++) { for (int y=0; y<num.length; y++) { if ((result[x].equals(num[y]))) { flag = false; continue; } else { flag = true; } if (flag == true) break; } if (flag == false) break; } System.out.println(flag); } }

    Read the article

  • Obtaining Index value of dictionary

    - by Maudise
    I have a piece of code which looks at the following public Test As Dictionary(Of String, String()) Which is brought in tester = New Dictionary(Of String, String()) tester.add("Key_EN", {"Option 1_EN", "Option 2_EN", "Option 3_EN"}) tester.add("Key_FR", {"Option 1_FR", "Option 2_FR", "Option 3_FR"}) tester.add("Key_DE", {"Option 1_DE", "Option 2_DE", "Option 3_DE"}) There's then a combo box which looks at the following dim Language as string Language = "_EN" ' note this is done by a drop down combo box to select _EN or _FR etc. cboTestBox.items.AddRange(tester("Key" & Language)) What I need to be able to do is to see what index position the answer is in and convert it back to the Key_EN. So, for example _DE is selected, then the options of "Option 1_DE", "Option 2_DE", "Option 3_DE" would be displayed. If they chose Option 3_DE then I need to be able to convert this to Option 3_EN. Many thanks Maudise

    Read the article

  • Python "string_escape" vs "unicode_escape"

    - by Mike Boers
    According to the docs, the builtin string encoding string_escape: Produce[s] a string that is suitable as string literal in Python source code ...while the unicode_escape: Produce[s] a string that is suitable as Unicode literal in Python source code So, they should have roughly the same behaviour. BUT, they appear to treat single quotes differently: >>> print """before '" \0 after""".encode('string-escape') before \'" \x00 after >>> print """before '" \0 after""".encode('unicode-escape') before '" \x00 after The string_escape escapes the single quote while the Unicode one does not. Is it safe to assume that I can simply: >>> escaped = my_string.encode('unicode-escape').replace("'", "\\'") ...and get the expected behaviour?

    Read the article

  • Approach to Selecting top item matching a criteria

    - by jkelley
    I have a SQL problem that I've come up against routinely, and normally just solved w/ a nested query. I'm hoping someone can suggest a more elegant solution. It often happens that I need to select a result set for a user, conditioned upon it being the most recent, or the most sizeable or whatever. For example: Their complete list of pages created, but I only want the most recent name they applied to a page. It so happens that the database contains many entries for each page, and only the most recent one is desired. I've been using a nested select like: SELECT pg.customName, pg.id FROM ( select id, max(createdAt) as mostRecent from pages where userId = @UserId GROUP BY id ) as MostRecentPages JOIN pages pg ON pg.id = MostRecentPages.id AND pg.createdAt = MostRecentPages.mostRecent Is there a better syntax to perform this selection?

    Read the article

  • Java spliting strings

    - by N0b
    Hi I've got a Java problem. I'm trying split a string when ever a " " occurs, for example the sentence test abc. Then move the first letter in each word from first to last. I got the moving the letter to work on the original string using String text = JOptionPane.showInputDialog(null,"Skriv in en normal text:"); char firstLetter = text.charAt(0); normal = text.substring(1,text.length()+0) + firstLetter; So my question is how would I split the string then start moving the letters around in each part of the cut string? Thanks in advance

    Read the article

  • Simple parameter checking function, here just want the % to be allowed

    - by abas_rafiq
    I'm using PDO's bindParam. This is the function which checks every GET variable on the website. After changing it will echo it out: function Check_Get_Param($val){ $value1=addslashes($val); $string1=htmlspecialchars($value1); $string2=strip_tags($string1); $string3=intval($string2); return $string3; } Hhere this will output the result: Check_Get_Param($_GET['id']); Now the idea is any id or id= any or id = % $_GET['id'] = % will result 0 as % is not integer. How to allow % also? How do I modify this function or any other function that I could filter the GET parameters so I could keep out the web from injections?

    Read the article

  • Parent element selection problem?

    - by Starx
    My HTML is something like this <div id="mydiv" class="common"> <input type="text" id="text1" value="" /> <input type="text" id="text2" value="" /> </div> I am assigning a function on the onclick event of the textbox like this $(document).ready(function() { $(".common input").click(function() { //////// What I am trying to do is access the id of its parent // in this case it is "mydiv" alert($(this:parent).attr('id')); }); But it is not working

    Read the article

  • Validate NSString

    - by Chris
    I am validating an NSString to ensure that the string does not contain apostrophes. The code I'm using to do this is NSCharacterSet * invalidNumberSet = [NSCharacterSet characterSetWithCharactersInString:@"'"]; NSScanner * scanner = [NSScanner scannerWithString:string]; NSString * scannerResult; [scanner setCharactersToBeSkipped:nil]; [scanner scanUpToCharactersFromSet:invalidNumberSet intoString:&scannerResult]; if(![string isEqualToString:scannerResult]) { return 2; } Returning 2 represents an error. This code works, except for the case where the string is an apostrophe. To get around this issue, I added the following code above the preceding block. if([string isEqualToString:@"'"]); { return 2; } This code is evaluating to true, regardless of the input. I need to either prevent the first block from crashing with the input of ', or get the second block to work. What am I missing?

    Read the article

  • programming help

    - by user208639
    class Person holds personal data Its constructor receives 3 parameters, two Strings representing first and last names and an int representing age public Person(String firstName, String lastName, int age) { its method getName has no parameters and returns a String with format "Lastname, Firstname" its method getAge takes no parameters and returns an int representing the current age its method birthday increases age value by 1 and returns the new age value Create the class Person and paste the whole class into the textbox below public class Person { public Person(String first, String last, int age) { getName = "Lastname, Firstname"; System.out.print(last + first); getAge = age + 1; return getAge; System.out.print(getAge); birthday = age + 1; newAge = birthday; return newAge; } } im getting errors such as "cannot find symbol - variable getName" but when i declare a variable it still not working, i also wanted to ask if i am heading in the right direction or is it all totally wrong? im using a program called BlueJ to work on.

    Read the article

  • Java: howto write equals() shorter

    - by erikb
    I get headaches when I have to write nearly 10 lines of code to say 2 Objects are equal, when their type is equal and both's attribute is equal. You can easily see that in this way of writing the number of lines increase drastically with your number of attributes. public class Id implements Node { private String name; public Id(String name) { this.name = name; } public boolean equals(Object o) { if (o == null) return false; if (null == (Id) o) return false; Id i = (Id) o; if ((this.name != null && i.name == null) || (this.name == null && i.name != null)) return false; return (this.name == null && i.name == null) || this.name.equals(i.name); } }

    Read the article

  • How do submit an object to a struts2 action using jQuery?

    - by James Drinkard
    I have an object that I'm populating from a selection off a table row that a user selects. I have a jQuery function that captures the click event and a hidden form field populates an id I need. However, I'm not sure as to the proper way to send off that object to a struts2 action? I tried using this: $(function() { $('#tbl tr').click(function() { var id = $(this).closest('tr').find('input:hidden').val(); var page = "<s:url action='update/deleteInfo.action'/>?model.isDelete=true&model.info.id=id"; console.log(page); window.location.href=(page); }); }); The model object has an isDelete boolean variable and the model has a nested info object that has an id variable with getter/setters. However, when I send this across, the model object isn't populated with these entries. Is there a way to do this or a better way than the url tag?

    Read the article

  • Which function should i use for testin if a var isset or not?

    - by streetparade
    I'm sometimes confused to using which one of them, say i have a function called getmember($id) function getmember($id) { // now this is the confusing part // how do i test if a $id was set or not set? //solution 1 if(empty($id)) { return false; } // solution 2 if(isset($id)) { return false; } } Thats sometimes not clear tome some times if a parameter in a function is set like function($var="") Then i do if($var ==="") { return false; } What should i use the next time isset ? emtyp ? or ===''

    Read the article

  • MySQL: Return grouped fields where the group is not empty, efficiently

    - by Ryan Badour
    In one statement I'm trying to group rows of one table by joining to another table. I want to only get grouped rows where their grouped result is not empty. Ex. Items and Categories SELECT Category.id FROM Item, Category WHERE Category.id = Item.categoryId GROUP BY Category.id HAVING COUNT(Item.id) > 0 The above query gives me the results that I want but this is slow, since it has to count all the rows grouped by Category.id. What's a more effecient way? I was trying to do a Group By LIMIT to only retrieve one row per group. But my attempts failed horribly. Any idea how I can do this? Thanks

    Read the article

  • insert into select from other table

    - by user3815079
    I need to add multiple records based on data from another table where the event is the same. I've found on this forum insert into table2(id,name) select "001",first_name from table1 where table1.id="001" as possible solution for my question. So I thought this should be the following syntax: insert into reservations(event,seat) select "99",id from seats where seats.id>0 to add all seats to event 99. However when I run this query mysql gives the message 'MySQL returned an empty resultset (0 rows). (query 0.0028 sec)' and no records were added. I translated the message so could be sligthly different. When I only use the "select "99",id from seats where seats.id0" query, it returns me 1080 rows.

    Read the article

  • Android strange behavior with listview and custom cursor adapter

    - by Michael Little
    I have a problem with a list view and a custom cursor adapter and I just can't seem to figure out what is wrong with my code. Basically, in my activity I call initalize() that does a bunch of stuff to handle getting the proper data and initializing the listview. On first run of the activity you can see from the images that one of the items is missing from the list. If I go to another activity and go back to this activity the item that was missing shows up. I believe it has something to do with setContentView(R.layout.parent). If I move that to my initialize() then the item never shows up even when returning from another activity. So, for some reason, returning from another activity bypasses setContentView(R.layout.parent) and everything works fine. I know it's impossible for me to bypass setContentView(R.layout.parent) so I need to figure out what the problem is. Also, I did not include the layout because it is nothing more then two textviews. Also, the images I have attached do not show that the missing item is the last one on the list. Custom Cursor Adapter: public class CustomCursorAdapter extends SimpleCursorAdapter { private Context context; private int layout; public CustomCursorAdapter (Context context, int layout, Cursor c, String[] from, int[] to) { super(context, layout, c, from, to); this.context = context; this.layout = layout; } public View newView(Context context, Cursor cursor, ViewGroup parent) { LayoutInflater inflater = LayoutInflater.from(context); final View view = inflater.inflate(layout, parent, false); return view; } @Override public void bindView(View v, Context context, Cursor c) { if (c.getColumnName(0).matches("section")){ int nameCol = c.getColumnIndex("section"); String section = c.getString(nameCol); TextView section_text = (TextView) v.findViewById(R.id.text1); if ((section.length() > 0)) { section_text.setText(section); } else { //so we don't have an empty spot section_text.setText(""); section_text.setVisibility(2); section_text.setHeight(1); } } else if (c.getColumnName(0).matches("code")) { int nameCol = c.getColumnIndex("code"); String mCode = c.getString(nameCol); TextView code_text = (TextView) v.findViewById(R.id.text1); if (code_text != null) { int i = 167; byte[] data = {(byte) i}; String strSymbol = EncodingUtils.getString(data, "windows-1252"); mCode = strSymbol + " " + mCode; code_text.setText(mCode); code_text.setSingleLine(); } } if (c.getColumnName(1).matches("title")){ int nameCol = c.getColumnIndex("title"); String mTitle = c.getString(nameCol); TextView title_text = (TextView) v.findViewById(R.id.text2); if (title_text != null) { title_text.setText(mTitle); } } else if (c.getColumnName(1).matches("excerpt")) { int nameCol = c.getColumnIndex("excerpt"); String mExcerpt = c.getString(nameCol); TextView excerpt_text = (TextView) v.findViewById(R.id.text2); if (excerpt_text != null) { excerpt_text.setText(mExcerpt); excerpt_text.setSingleLine(); } } } The Activity: public class parent extends ListActivity { private static String[] TITLE_FROM = { SECTION, TITLE, _ID, }; private static String[] CODE_FROM = { CODE, EXCERPT, _ID, }; private static String ORDER_BY = _ID + " ASC"; private static int[] TO = { R.id.text1, R.id.text2, }; String breadcrumb = null; private MyData data; private SQLiteDatabase db; CharSequence parent_id = ""; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); data = new MyData(this); db = data.getReadableDatabase(); setContentView(R.layout.parent); initialize(); } public void initialize() { breadcrumb = null; Bundle bun = getIntent().getExtras(); TextView tvBreadCrumb; tvBreadCrumb = (TextView)findViewById(R.id.breadcrumb); if (bun == null) { //this is the first run tvBreadCrumb.setText(null); tvBreadCrumb.setHeight(0); parent_id = "0"; try { Cursor cursor = getData(parent_id); showSectionData(cursor); } finally { data.close(); } } else { CharSequence state = bun.getString("state"); breadcrumb = bun.getString("breadcrumb"); tvBreadCrumb.setText(breadcrumb); CharSequence code = bun.getString("code"); parent_id = code; if (state.equals("chapter")) { try { Cursor cursor = getData(parent_id); showSectionData(cursor); } finally { data.close(); } } else if (state.equals("code")) { try { Cursor cursor = getCodeData(parent_id); showCodeData(cursor); } finally { data.close(); } } } } @Override public void onStart() { //initialize(); super.onResume(); } @Override public void onResume() { initialize(); super.onResume(); } private Cursor getData(CharSequence parent_id) { Cursor cTitles = db.query(TITLES_TABLE_NAME, TITLE_FROM, "parent_id = " + parent_id, null, null, null, ORDER_BY); Cursor cCodes = db.query(CODES_TABLE_NAME, CODE_FROM, "parent_id = " + parent_id, null, null, null, ORDER_BY); Cursor[] c = {cTitles, cCodes}; Cursor cursor = new MergeCursor(c); startManagingCursor(cursor); return cursor; } private Cursor getCodeData(CharSequence parent_id2) { Bundle bun = getIntent().getExtras(); CharSequence intent = bun.getString("intent"); CharSequence searchtype = bun.getString("searchtype"); //SQLiteDatabase db = data.getReadableDatabase(); if (intent != null) { String sWhere = null; if(searchtype.equals("code")) { sWhere = "code LIKE '%"+parent_id2+"%'"; } else if(searchtype.equals("within")){ sWhere = "definition LIKE '%"+parent_id2+"%'"; } //This is a search request Cursor cursor = db.query(CODES_TABLE_NAME, CODE_FROM, sWhere, null, null, null, ORDER_BY); startManagingCursor(cursor); return cursor; } else { Cursor cursor = db.query(CODES_TABLE_NAME, CODE_FROM, "parent_id = "+ parent_id2, null, null, null, ORDER_BY); startManagingCursor(cursor); return cursor; } } private void showSectionData(Cursor cursor) { CustomCursorAdapter adapter= new CustomCursorAdapter(this, R.layout.item, cursor, TITLE_FROM, TO); setListAdapter(adapter); } private void showCodeData(Cursor cursor) { CustomCursorAdapter adapter = new CustomCursorAdapter(this, R.layout.item, cursor, CODE_FROM, TO); setListAdapter(adapter); Bundle bun = getIntent().getExtras(); CharSequence intent = bun.getString("intent"); if (intent != null) { Cursor cursor1 = ((CursorAdapter)getListAdapter()).getCursor(); startManagingCursor(cursor1); TextView tvBreadCrumb; tvBreadCrumb = (TextView)findViewById(R.id.breadcrumb); tvBreadCrumb.setText(cursor1.getCount() + " Records Found"); //cursor1.close(); //mdl } }

    Read the article

  • How to implement Survey page using ASP.NET MVC?

    - by Aleks
    I need to implement the survey page using ASP.NET MVC (v.4) That functionality has already been implemented in our project using ASP.NET WebForms. (I really searched a lot for real examples of similar functionality implemented via MVC, but failed) Goal: staying on the same page (in webforms -'Survey.aspx') each time user clicks 'Next Page', load next bunch of questions (controls) which user is going to answer. Type of controls in questions are defined only in run-time (retrieved from Data Base). To explain better the question I manually created (rather simple) mark-up below of 'two' pages (two loads of controls): <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="Survey.aspx.cs" Inherits="WebSite.Survey" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> </head> <body> <form id="form1" runat="server"> <div><h2>Internal Survey</h2></div> <div><h3>Page 1</h3></div> <div style="padding-bottom: 10px"><div><b>Did you have internet disconnections during last week?</b></div> <asp:RadioButtonList ID="RadioButtonList1" runat="server"> <asp:ListItem>Yes</asp:ListItem> <asp:ListItem>No</asp:ListItem> </asp:RadioButtonList> </div> <div style="padding-bottom: 10px"><div><b>Which days of the week suit you best for meeting up ?</b></div> <asp:CheckBoxList ID="CheckBoxList1" runat="server"> <asp:ListItem>Monday</asp:ListItem> <asp:ListItem>Tuesday</asp:ListItem> <asp:ListItem>Wednesday</asp:ListItem> <asp:ListItem>Thursday</asp:ListItem> <asp:ListItem>Friday</asp:ListItem> </asp:CheckBoxList> </div> <div style="padding-bottom: 10px"> <div><b>How satisfied are you with your job? </b></div> <asp:RadioButtonList ID="RadioButtonList2" runat="server"> <asp:ListItem>Very Good</asp:ListItem> <asp:ListItem>Good</asp:ListItem> <asp:ListItem>Bad</asp:ListItem> <asp:ListItem>Very Bad</asp:ListItem> </asp:RadioButtonList> </div> <div style="padding-bottom: 10px"> <div><b>How satisfied are you with your direct supervisor ? </b></div> <asp:RadioButtonList ID="RadioButtonList3" runat="server"> <asp:ListItem>Not Satisfied</asp:ListItem> <asp:ListItem>Somewhat Satisfied</asp:ListItem> <asp:ListItem>Neutral</asp:ListItem> <asp:ListItem>Satisfied</asp:ListItem> <asp:ListItem>Very Satisfied</asp:ListItem> </asp:RadioButtonList> </div> <div style="padding-bottom: 10px"> <asp:Button ID="Button1" runat="server" Text="Next Page" onclick="Button1_Click" /> </div> </form> </body> </html> PAGE 2 <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="Survey.aspx.cs" Inherits="WebSite.Survey" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> </head> <body> <form id="form1" runat="server"> <div><h2>Internal Survey</h2></div> <div><h3>Page 2</h3></div> <div style="padding-bottom: 10px"><div><b>Did admininstators fix your internet connection in time ?</b></div> <asp:RadioButtonList ID="RadioButtonList1" runat="server"> <asp:ListItem>Yes</asp:ListItem> <asp:ListItem>No</asp:ListItem> </asp:RadioButtonList> </div> <div style="padding-bottom: 10px"><div><b>What's your overal impression about the job ?</b></div> <asp:TextBox ID="TextBox1" runat="server" Height="88px" Width="322px"></asp:TextBox> </div> <div style="padding-bottom: 10px"> <div><b>Select day which best suits you for admin support ? </b></div> <asp:DropDownList ID="DropDownList1" runat="server"> <asp:ListItem>Select day</asp:ListItem> <asp:ListItem>Monday</asp:ListItem> <asp:ListItem>Wednesday</asp:ListItem> <asp:ListItem>Friday</asp:ListItem> </asp:DropDownList> </div> <div style="padding-bottom: 10px"> <asp:Button ID="Button1" runat="server" Text="Next Page" onclick="Button1_Click" /> </div> </form> </body> </html>

    Read the article

  • current_user and Comments on Posts - Create another association or loop posts? - Ruby on Rails

    - by bgadoci
    I have created a blog application using Ruby on Rails and have just added an authentication piece and it is working nicely. I am now trying to go back through my application to adjust the code such that it only shows information that is associated with a certain user. Currently, Users has_many :posts and Posts has_many :comments. When a post is created I am successfully inserting the user_id into the post table. Additionally I am successfully only displaying the posts that belong to a certain user upon their login in the /views/posts/index.html.erb view. My problem is with the comments. For instance on the home page, when logged in, a user will see only posts that they have written, but comments from all users on all posts. Which is not what I want and need some direction in correcting. I want only to display the comments written on all of the logged in users posts. Do I need to create associations such that comments also belong to user? Or is there a way to adjust my code to simply loop through post to display this data. I have put the code for the PostsController, CommentsController, and /posts/index.html.erb below and also my view code but will post more if needed. class PostsController < ApplicationController before_filter :authenticate auto_complete_for :tag, :tag_name auto_complete_for :ugtag, :ugctag_name def index @tag_counts = Tag.count(:group => :tag_name, :order => 'count_all DESC', :limit => 20) conditions, joins = {}, :votes @ugtag_counts = Ugtag.count(:group => :ugctag_name, :order => 'count_all DESC', :limit => 20) conditions, joins = {}, :votes @vote_counts = Vote.count(:group => :post_title, :order => 'count_all DESC', :limit => 20) conditions, joins = {}, :votes unless(params[:tag_name] || "").empty? conditions = ["tags.tag_name = ? ", params[:tag_name]] joins = [:tags, :votes] end @posts= current_user.posts.paginate( :select => "posts.*, count(*) as vote_total", :joins => joins, :conditions=> conditions, :group => "votes.post_id, posts.id ", :order => "created_at DESC", :page => params[:page], :per_page => 5) @popular_posts=Post.paginate( :select => "posts.*, count(*) as vote_total", :joins => joins, :conditions=> conditions, :group => "votes.post_id, posts.id", :order => "vote_total DESC", :page => params[:page], :per_page => 3) respond_to do |format| format.html # index.html.erb format.xml { render :xml => @posts } format.json { render :json => @posts } format.atom end end def show @post = Post.find(params[:id]) respond_to do |format| format.html # show.html.erb format.xml { render :xml => @post } end end def new @post = Post.new respond_to do |format| format.html # new.html.erb format.xml { render :xml => @post } end end def edit @post = Post.find(params[:id]) end def create @post = current_user.posts.create(params[:post]) respond_to do |format| if @post.save flash[:notice] = 'Post was successfully created.' format.html { redirect_to(@post) } format.xml { render :xml => @post, :status => :created, :location => @post } else format.html { render :action => "new" } format.xml { render :xml => @post.errors, :status => :unprocessable_entity } end end end def update @post = Post.find(params[:id]) respond_to do |format| if @post.update_attributes(params[:post]) flash[:notice] = 'Post was successfully updated.' format.html { redirect_to(@post) } format.xml { head :ok } else format.html { render :action => "edit" } format.xml { render :xml => @post.errors, :status => :unprocessable_entity } end end end def destroy @post = Post.find(params[:id]) @post.destroy respond_to do |format| format.html { redirect_to(posts_url) } format.xml { head :ok } end end end CommentsController class CommentsController < ApplicationController before_filter :authenticate, :except => [:show, :create] def index @comments = Comment.find(:all, :include => :post, :order => "created_at DESC").paginate :page => params[:page], :per_page => 5 respond_to do |format| format.html # index.html.erb format.xml { render :xml => @comments } format.json { render :json => @comments } format.atom end end def show @comment = Comment.find(params[:id]) respond_to do |format| format.html # show.html.erb format.xml { render :xml => @comment } end end # GET /posts/new # GET /posts/new.xml # GET /posts/1/edit def edit @comment = Comment.find(params[:id]) end def update @comment = Comment.find(params[:id]) respond_to do |format| if @comment.update_attributes(params[:comment]) flash[:notice] = 'Comment was successfully updated.' format.html { redirect_to(@comment) } format.xml { head :ok } else format.html { render :action => "edit" } format.xml { render :xml => @comment.errors, :status => :unprocessable_entity } end end end def create @post = Post.find(params[:post_id]) @comment = @post.comments.build(params[:comment]) respond_to do |format| if @comment.save flash[:notice] = "Thanks for adding this comment" format.html { redirect_to @post } format.js else flash[:notice] = "Make sure you include your name and a valid email address" format.html { redirect_to @post } end end end def destroy @comment = Comment.find(params[:id]) @comment.destroy respond_to do |format| format.html { redirect_to Post.find(params[:post_id]) } format.js end end end View Code for Comments <% Comment.find(:all, :order => 'created_at DESC', :limit => 3).each do |comment| -%> <div id="side-bar-comments"> <p> <div class="small"><%=h comment.name %> commented on:</div> <div class="dark-grey"><%= link_to h(comment.post.title), comment.post %><br/></div> <i><%=h truncate(comment.body, :length => 100) %></i><br/> <div class="small"><i> <%= time_ago_in_words(comment.created_at) %> ago</i></div> </p> </div> <% end -%>

    Read the article

  • vertical accordion from horizontal

    - by Sify Juhy
    //# jQuery - Horizontal Accordion //# Version 2.00.00 Alpha 1 //# //# portalZINE(R) - New Media Network //# http://www.portalzine.de //# //# Alexander Graef //# [email protected] //# //# Copyright 2007-2009 (function($) { $.hrzAccordion = { setOnEvent: function(i, container, finalWidth, settings){ $("#"+container+"Handle"+i).bind(settings.eventTrigger,function() { var status = $('[rel='+container+'ContainerSelected]').data('status'); if(status ==1 && settings.eventWaitForAnim === true){ return false; } if( $("#"+container+"Handle"+i).attr("rel") != container+"HandleSelected"){ settings.eventAction; $('[id*='+container+'Handle]').attr("rel",""); $('[id*='+container+'Handle]').attr("class",settings.handleClass); $("#"+container+"Handle"+i).addClass(settings.handleClassSelected); $("."+settings.contentWrapper).css({width: finalWidth+"px" }); switch(settings.closeOpenAnimation) { case 1: if($('[rel='+container+'ContainerSelected]').get(0) ){ $('[rel='+container+'ContainerSelected]').data('status',1); //current_width = $('[rel='+container+'ContainerSelected]').width(); $('[rel='+container+'ContainerSelected]').animate({width: "0px",opacity:"0"}, { queue:true, duration:settings.closeSpeed ,easing:settings.closeEaseAction,complete: function(){ $('[rel='+container+'ContainerSelected]').data('status',0); } ,step: function(now){ width = $(this).width(); //new_width = finalWidth- (finalWidth * (width/current_width)); new_width = finalWidth - width; $('#'+container+'Content'+i).width(Math.ceil(new_width)).css("opacity","1"); }}); }else{ $('[rel='+container+'ContainerSelected]').data('status',1); $('#'+container+'Content'+i).animate({width: finalWidth,opacity:"1"}, { queue:false, duration:settings.closeSpeed ,easing:settings.closeEaseAction,complete: function(){ $('[rel='+container+'ContainerSelected]').data('status',0); }}); } break; case 2: $('[id*='+container+'Content]').css({width: "0px"}); $('#'+container+'Content'+i).animate({width: finalWidth+"px",opacity:"1"}, { queue:false, duration:settings.openSpeed ,easing:settings.openEaseAction, complete: settings.completeAction }); break; } $('[id*='+container+'Content]').attr("rel",""); $("#"+container+"Handle"+i).attr("rel",container+"HandleSelected"); $("#"+container+"Content"+i).attr("rel",container+"ContainerSelected"); } }); } }; $.fn.extend({ hrzAccordionLoop: function(options) { return this.each(function(a){ var container = $(this).attr("id") || $(this).attr("class"); var elementCount = $('#'+container+' > li, .'+container+' > li').size(); var settings = $(this).data('settings'); variable_holder="interval"+container ; var i =0; var loopStatus = "start"; variable_holder = window.setInterval(function(){ $("#"+container+"Handle"+i).trigger(settings.eventTrigger); if(loopStatus =="start"){ i = i + 1; }else{ i = i-1; } if(i==elementCount && loopStatus == "start"){ loopStatus = "end"; i=elementCount-1; } if(i==0 && loopStatus == "end"){ loopStatus = "start"; i=0; } },settings.cycleInterval); }); }, hrzAccordion: function(options) { this.settings = { eventTrigger : "click", containerClass : "container", listItemClass : "listItem", contentContainerClass : "contentContainer", contentWrapper : "contentWrapper", contentInnerWrapper : "contentInnerWrapper", handleClass : "handle", handleClassOver : "handleOver", handleClassSelected : "handleSelected", handlePosition : "right", handlePositionArray : "", // left,left,right,right,right closeEaseAction : "swing", closeSpeed : 500, openEaseAction : "swing", openSpeed : 500, openOnLoad : 2, hashPrefix : "tab", eventAction : function(){ //add your own extra clickAction function here }, completeAction : function(){ //add your own onComplete function here }, closeOpenAnimation : 1,// 1 - open and close at the same time / 2- close all and than open next cycle : false, // not integrated yet, will allow to cycle through tabs by interval cycleInterval : 10000, fixedWidth : "", eventWaitForAnim : true }; if(options){ $.extend(this.settings, options); } var settings = this.settings; return this.each(function(a){ var container = $(this).attr("id") || $(this).attr("class"); $(this).data('settings', settings); $(this).wrap("<div class='"+settings.containerClass+"'></div>"); var elementCount = $('#'+container+' > li, .'+container+' > li').size(); var containerWidth = $("."+settings.containerClass).width(); var handleWidth = $("."+settings.handleClass).css("width"); handleWidth = handleWidth.replace(/px/,""); var finalWidth; var handle; if(settings.fixedWidth){ finalWidth = settings.fixedWidth; }else{ finalWidth = containerWidth-(elementCount*handleWidth)-handleWidth; } $('#'+container+' > li, .'+container+' > li').each(function(i) { $(this).attr('id', container+"ListItem"+i); $(this).attr('class',settings.listItemClass); $(this).html("<div class='"+settings.contentContainerClass+"' id='"+container+"Content"+i+"'>" +"<div class=\""+settings.contentWrapper+"\">" +"<div class=\""+settings.contentInnerWrapper+"\">" +$(this).html() +"</div></div></div>"); if($("div",this).hasClass(settings.handleClass)){ var html = $("div."+settings.handleClass,this).attr("id",""+container+"Handle"+i+"").html(); $("div."+settings.handleClass,this).remove(); handle = "<div class=\""+settings.handleClass+"\" id='"+container+"Handle"+i+"'>"+html+"</div>"; }else{ handle = "<div class=\""+settings.handleClass+"\" id='"+container+"Handle"+i+"'></div>"; } if(settings.handlePositionArray){ splitthis = settings.handlePositionArray.split(","); settings.handlePosition = splitthis[i]; } switch(settings.handlePosition ){ case "left": $(this).prepend( handle ); break; case "right": $(this).append( handle ); break; case "top": $("."+container+"Top").append( handle ); break; case "bottom": $("."+container+"Bottom").append( handle ); break; } $("#"+container+"Handle"+i).bind("mouseover", function(){ $("#"+container+"Handle"+i).addClass(settings.handleClassOver); }); $("#"+container+"Handle"+i).bind("mouseout", function(){ if( $("#"+container+"Handle"+i).attr("rel") != "selected"){ $("#"+container+"Handle"+i).removeClass(settings.handleClassOver); } }); $.hrzAccordion.setOnEvent(i, container, finalWidth, settings); if(i == elementCount-1){ $('#'+container+",."+container).show(); } if(settings.openOnLoad !== false && i == elementCount-1){ var location_hash = location.hash; location_hash = location_hash.replace("#", ""); if(location_hash.search(settings.hashPrefix) != '-1' ){ var tab = 1; location_hash = location_hash.replace(settings.hashPrefix, ""); } if(location_hash && tab ==1){ $("#"+container+"Handle"+(location_hash)).attr("rel",container+"HandleSelected"); $("#"+container+"Content"+(location_hash)).attr("rel",container+"ContainerSelected"); $("#"+container+"Handle"+(location_hash-1)).trigger(settings.eventTrigger); }else{ $("#"+container+"Handle"+(settings.openOnLoad)).attr("rel",container+"HandleSelected"); $("#"+container+"Content"+(settings.openOnLoad)).attr("rel",container+"ContainerSelected"); $("#"+container+"Handle"+(settings.openOnLoad-1)).trigger(settings.eventTrigger); } } }); if(settings.cycle === true){ $(this).hrzAccordionLoop(); } }); } }); })(jQuery); **Given is the code used for the accordion...please check out this Accordion Link. in the link there are four examples of accordions. i want the last accordion i.e example 4 to be vertical ...kindly help me.

    Read the article

  • WordPress 'comment is awaiting moderation.' message not appearing when a comment is submitted?

    - by cs
    Everything is pretty standard from WP samples, with minor modifications. But when a comment is submitted, it does not show the "your comment is awaiting moderation" message. The comments.php: <div id="comment-block"> <h4><?php comments_number('No Responses', 'One Response', '% Responses' );?> to &#8220;<?php the_title(); ?>&#8221;</h4> <ul id="commentlist"> <?php wp_list_comments('type=comment&callback=mytheme_comment'); ?> </ul> <?php // this is displayed if there are no comments so far ?> <?php if ('open' == $post->comment_status) : ?> <!-- If comments are open, but there are no comments. --> <?php else : // comments are closed ?> <!-- If comments are closed. --> <p class="nocomments">Comments are closed.</p> <?php endif; ?> <?php if ('open' == $post->comment_status) : ?> <h4>Leave a reply</h4> <div class="cancel-comment-reply"> <small><?php cancel_comment_reply_link(); ?></small> </div> <?php if ( get_option('comment_registration') && !$user_ID ) : ?> <p>You must be <a href="<?php echo get_option('siteurl'); ?>/wp-login.php?redirect_to=<?php echo urlencode(get_permalink()); ?>">logged in</a> to post a comment.</p> <?php else : ?> <form action="<?php echo get_option('siteurl'); ?>/wp-comments-post.php" method="post" id="commentform"> <?php if ( $user_ID ) : ?> <p class="loggedIn">Logged in as <a href="<?php echo get_option('siteurl'); ?>/wp-admin/profile.php"><?php echo $user_identity; ?></a>. <a href="<?php echo wp_logout_url(get_permalink()); ?>" title="Log out of this account">Log out &raquo;</a></p> <?php else : ?> <table width="675" cellpadding="0" cellspacing="0" border="0"> <tr><td style="padding-right: 20px;"><label for="author">Name <?php if ($req) echo "(required)"; ?></label></td> <td style="padding-right: 20px;"><label for="email">Email <?php if ($req) echo "(required)"; ?></label> <small>(will not be published)</small></td> <td><label for="url">Website <?php if ($req) echo "(required)"; ?></label></td> </tr> <tr><td style="padding-right: 20px;"><input type="text" name="author" id="author" value="<?php echo $comment_author; ?>" class="text" tabindex="1" <?php if ($req) echo "aria-required='true'"; ?> /></td> <td style="padding-right: 20px;"><input type="text" name="email" id="email" value="<?php echo $comment_author_email; ?>" class="text" tabindex="2" <?php if ($req) echo "aria-required='true'"; ?> /></td> <td><input type="text" name="url" id="url" value="<?php echo $comment_author_url; ?>" class="text" tabindex="3" /></td> </tr> </table> <?php endif; ?> <label for="comment">Comment <?php if ($req) echo "(required)"; ?></label><br /> <textarea name="comment" id="comment" rows="10" tabindex="4" class="text"></textarea> <input name="submit" type="image" src="<?php bloginfo('template_directory'); ?>/images/submit_button.png" width="130" height="24" alt="Submit" id="submit" tabindex="5" /> <?php comment_id_fields(); ?> <?php do_action('comment_form', $post->ID); ?> </form> <div class="clear"></div> <?php endif; // If registration required and not logged in ?> </div> <?php endif; // if you delete this the sky will fall on your head ?> And the mytheme_comments function in functions.php function mytheme_comment($comment, $args, $depth) { $GLOBALS['comment'] = $comment; ?> <li <?php comment_class(); ?> id="li-comment-<?php comment_ID() ?>"> <div id="comment-<?php comment_ID(); ?>"> <span class="comment-author vcard"> <?php printf(__('<cite class="fn">%s</cite> <span class="says">says at</span>'), get_comment_author_link()) ?> </span> <?php if ($comment->comment_approved == '0') : ?> <em><?php _e('Your comment is awaiting moderation.') ?></em> <br /> <?php endif; ?> <span class="comment-meta commentmetadata"><a href="<?php echo htmlspecialchars( get_comment_link( $comment->comment_ID ) ) ?>"> <?php printf(__('%2$s, %1$s'), get_comment_date(), get_comment_time()) ?></a><?php edit_comment_link(__('(Edit)'),' ','') ?></span> <?php comment_text() ?> <div class="reply"> <?php comment_reply_link(array_merge( $args, array('depth' => $depth, 'max_depth' => $args['max_depth']))) ?> </div> </div> <?php } ?>

    Read the article

< Previous Page | 518 519 520 521 522 523 524 525 526 527 528 529  | Next Page >