Search Results

Search found 13867 results on 555 pages for 'avoid learning'.

Page 523/555 | < Previous Page | 519 520 521 522 523 524 525 526 527 528 529 530  | Next Page >

  • Howto access thread data outside a thread

    - by Quandary
    Question: I start the MS Text-to-speech engine in a thread, in order to avoid a crash on DLL_attach. It starts fine, and the text to speech engine gets initialized, but I can't access ISpVoice outside the thread. How can I access ISpVoice outside the thread ? It's a global variable after all... #include <windows.h> #include <sapi.h> #include "XPThreads.h" ISpVoice * pVoice = NULL; unsigned long init_engine_thread(void* param) { Sleep(5000); printf("lolthread\n"); //HRESULT hr = CoInitializeEx(NULL, COINIT_MULTITHREADED); HRESULT hr = CoInitialize(NULL); if(FAILED(hr) ) { MessageBox(NULL, TEXT("Failed To Initialize"), TEXT("Error"), 0); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoInitialize_dll.txt" , "w" ); fwrite (buffer , 1 , strlen(buffer) , pFile ); fclose (pFile); } else { printf("trying to create instance.\n"); //HRESULT hr = CoCreateInstance(CLSID_SpVoice, NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); //hr = CoCreateInstance(CLSID_SpVoice, NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); //HRESULT hr = CoCreateInstance(__uuidof(ISpVoice), NULL, CLSCTX_INPROC_SERVER, IID_ISpVoice, (void **) &pVoice); HRESULT hr = CoCreateInstance(__uuidof(SpVoice), NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); if( SUCCEEDED( hr ) ) { printf("Succeeded\n"); hr = pVoice->Speak(L"The text to speech engine has been successfully initialized.", 0, NULL); } else { printf("failed\n"); MessageBox(NULL, TEXT("Failed To Create COM instance"), TEXT("Error"), 0); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoCreateInstance_dll.txt" , "w" ); fwrite (buffer , 1 , strlen(buffer) , pFile ); fclose (pFile); } } if(pVoice != NULL) { pVoice->Release(); pVoice = NULL; } CoUninitialize(); return NULL; } XPThreads* ptrThread = new XPThreads(init_engine_thread); BOOL APIENTRY DllMain( HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { switch (ul_reason_for_call) { case DLL_PROCESS_ATTACH: //init_engine(); LoadLibrary(TEXT("ole32.dll")); ptrThread->Run(); break; case DLL_THREAD_ATTACH: break; case DLL_THREAD_DETACH: break; case DLL_PROCESS_DETACH: break; } return TRUE; }

    Read the article

  • Best way to test for a variable's existence in PHP; isset() is clearly broken

    - by chazomaticus
    From the isset() docs: isset() will return FALSE if testing a variable that has been set to NULL. Basically, isset() doesn't check for whether the variable is set at all, but whether it's set to anything but NULL. Given that, what's the best way to actually check for the existence of a variable? I tried something like: if(isset($v) || @is_null($v)) (the @ is necessary to avoid the warning when $v is not set) but is_null() has a similar problem to isset(): it returns TRUE on unset variables! It also appears that: @($v === NULL) works exactly like @is_null($v), so that's out, too. How are we supposed to reliably check for the existence of a variable in PHP? Edit: there is clearly a difference in PHP between variables that are not set, and variables that are set to NULL: <?php $a = array('b' => NULL); var_dump($a); PHP shows that $a['b'] exists, and has a NULL value. If you add: var_dump(isset($a['b'])); var_dump(isset($a['c'])); you can see the ambiguity I'm talking about with the isset() function. Here's the output of all three of these var_dump()s: array(1) { ["b"]=> NULL } bool(false) bool(false) Further edit: two things. One, a use case. An array being turned into the data of an SQL UPDATE statement, where the array's keys are the table's columns, and the array's values are the values to be applied to each column. Any of the table's columns can hold a NULL value, signified by passing a NULL value in the array. You need a way to differentiate between an array key not existing, and an array's value being set to NULL; that's the difference between not updating the column's value and updating the column's value to NULL. Second, Zoredache's answer, array_key_exists() works correctly, for my above use case and for any global variables: <?php $a = NULL; var_dump(array_key_exists('a', $GLOBALS)); var_dump(array_key_exists('b', $GLOBALS)); outputs: bool(true) bool(false) Since that properly handles just about everywhere I can see there being any ambiguity between variables that don't exist and variables that are set to NULL, I'm calling array_key_exists() the official easiest way in PHP to truly check for the existence of a variable. (Only other case I can think of is for class properties, for which there's property_exists(), which, according to its docs, works similarly to array_key_exists() in that it properly distinguishes between not being set and being set to NULL.)

    Read the article

  • How to use Facebook graph API to retrieve fan photos uploaded to wall of fan page?

    - by Joe
    I am creating an external photo gallery using PHP and the Facebook graph API. It pulls thumbnails as well as the large image from albums on our Facebook Fan Page. Everything works perfect, except I'm only able to retrieve photos that an ADMIN posts to our page. (graph.facebook.com/myalbumid/photos) Is there a way to use graph api to load publicy uploaded photos from fans? I want to retrieve the pictures from the "Photos from" album, but trying to get the ID for the graph query is not like other albums... it looks like this: http://www.facebook.com/media/set/?set=o.116860675007039 Another note: The only way i've come close to retreiving this data is by using the "feed" option.. ie: graph.facebook.com/pageid/feed EDIT: This is about as far as I could get- it works, but has certain issues stated below. Maybe someone could expand on this, or provide a better solution. (Using FB PHP SDK) <?php require_once ('config.php'); // get all photos for album $photos = $facebook->api("/YourID/tagged"); $maxitem =10; $count = 0; foreach($photos['data'] as $photo) { if ($photo['type'] == "photo"): echo "<img src='{$photo['picture']}' />", "<br />"; endif; $count+= 1; if ($count >= "$maxitem") break; } ?> Issues with this: 1) The fact that I don't know a method for graph querying specific "types" of Tags, I had to run a conditional statement to display photos. 2) You cannot effectively use the "?limit=#" with this, because as I said the "tagged" query contains all types (photo, video, and status). So if you are going for a photo gallery and wish to avoid running an entire query by using ?limit, you will lose images. 3) The only content that shows up in the "tagged" query is from people that are not Admins of the page. This isn't the end of the world, but I don't understand why Facebook wouldn't allow yourself to be shown in this data as long as you posted it "as yourself" and not as the page.

    Read the article

  • jQuery AJAX POST gives undefined index

    - by Sebastian
    My eventinfo.php is giving the following output: <br /> <b>Notice</b>: Undefined index: club in <b>/homepages/19/d361310357/htdocs/guestvibe/wp-content/themes/yasmin/guestvibe/eventinfo.php</b> on line <b>11</b><br /> [] HTML (index.php): <select name="club" class="dropdown" id="club"> <?php getClubs(); ?> </select> jQuery (index.php): <script type="text/javascript"> $(document).ready(function() { $.ajax({ type: "POST", url: "http://www.guestvibe.com/wp-content/themes/yasmin/guestvibe/eventinfo.php", data: $('#club').serialize(), success: function(data) { $('#rightbox_inside').html('<h2>' + $('#club').val() + '<span style="font-size: 14px"> (' + data[0].day + ')</h2><hr><p><b>Entry:</b> ' + data[0].entry + '</p><p><b>Queue jump:</b> ' + data[0].queuejump + '</p><br><p><i>Guestlist closes at ' + data[0].closing + '</i></p>'); }, dataType: "json" }); }); $('#club').change(function(event) { $.ajax({ type: "POST", url: "http://www.guestvibe.com/wp-content/themes/yasmin/guestvibe/eventinfo.php", data: $(this).serialize(), success: function(data) { $('#rightbox_inside').hide().html('<h2>' + $('#club').val() + '<span style="font-size: 14px"> (' + data[0].day + ')</h2><hr><p><b>Entry:</b> ' + data[0].entry + '</p><p><b>Queue jump:</b> ' + data[0].queuejump + '</p><br><p><i>Guestlist closes at ' + data[0].closing + '</i></p>').fadeIn('500'); }, dataType: "json" }); }); </script> I can run alerts from the jQuery, so it is active. I've copied this as is from an old version of the website, but I've changed the file structure (through to move to WordPress) so I suspect the variables might not even be reaching eventinfo.php in the first place... index.php is in wp-content/themes/cambridge and eventinfo.php is in wp-content/themes/yasmin/guestvibe but I've tried to avoid structuring issues by referencing the URL in full. Any ideas?

    Read the article

  • Helping linqtosql datacontext use implicit conversion between varchar column in the database and tab

    - by user213256
    I am creating an mssql database table, "Orders", that will contain a varchar(50) field, "Value" containing a string that represents a slightly complex data type, "OrderValue". I am using a linqtosql datacontext class, which automatically types the "Value" column as a string. I gave the "OrderValue" class implicit conversion operators to and from a string, so I can easily use implicit conversion with the linqtosql classes like this: // get an order from the orders table MyDataContext db = new MyDataContext(); Order order = db.Orders(o => o.id == 1); // use implicit converstion to turn the string representation of the order // value into the complex data type. OrderValue value = order.Value; // adjust one of the fields in the complex data type value.Shipping += 10; // use implicit conversion to store the string representation of the complex // data type back in the linqtosql order object order.Value = value; // save changes db.SubmitChanges(); However, I would really like to be able to tell the linqtosql class to type this field as "OrderValue" rather than as "string". Then I would be able to avoid complex code and re-write the above as: // get an order from the orders table MyDataContext db = new MyDataContext(); Order order = db.Orders(o => o.id == 1); // The Value field is already typed as the "OrderValue" type rather than as string. // When a string value was read from the database table, it was implicity converted // to "OrderValue" type. order.Value.Shipping += 10; // save changes db.SubmitChanges(); In order to achieve this desired goal, I looked at the datacontext designer and selected the "Value" field of the "Order" table. Then, in properties, I changed "Type" to "global::MyApplication.OrderValue". The "Server Data Type" property was left as "VarChar(50) NOT NULL" The project built without errors. However, when reading from the database table, I was presented with the following error message: Could not convert from type 'System.String' to type 'MyApplication.OrderValue'. at System.Data.Linq.DBConvert.ChangeType(Object value, Type type) at Read_Order(ObjectMaterializer1 ) at System.Data.Linq.SqlClient.ObjectReaderCompiler.ObjectReader2.MoveNext() at System.Linq.Buffer1..ctor(IEnumerable1 source) at System.Linq.Enumerable.ToArray[TSource](IEnumerable`1 source) at Example.OrdersProvider.GetOrders() at ... etc From the stack trace, I believe this error is happening while reading the data from the table. When presented with converting a string to my custom data type, even though the implicit conversion operators are present, the DBConvert class gets confused and throws an error. Is there anything I can do to help it not get confused and do the implicit conversion? Thanks in advance, and apologies if I have posted in the wrong forum. cheers / Ben

    Read the article

  • C# LINQ filtering with nested if statements

    - by Tim Sumrall
    I have a learning project where a data grid is filtered by 3 controls (a checkbox and 2 dropdowns) I'm about to wrap up and move on to another project as it works well but I don't like the complexity of nesting IF statements to capture all the possible combinations of the 3 filters and was wondering if there is a better way. For example: Something that would allow for more filters to be added easily rather than walking through all the nests and adding another level of madness. private void BuildQuery() { EntityQuery<MASTER_DOCKS> query = QDocksContext.GetMASTER_DOCKSQuery(); if (Tonnage.IsChecked.HasValue && Tonnage.IsChecked.Value) { if (null != FilterWaterWay.SelectedValue) { string WaterwaytoFilterBy = FilterWaterWay.SelectedValue.ToString(); if (!string.IsNullOrWhiteSpace(WaterwaytoFilterBy) && WaterwaytoFilterBy != "[Select WaterWay]") { if (null != FilterState.SelectedValue) { string StateToFilterBy = FilterState.SelectedValue.ToString(); if (null != FilterState.SelectedValue && !string.IsNullOrWhiteSpace(StateToFilterBy) && StateToFilterBy != "[Select State]") { if (!string.IsNullOrWhiteSpace(StateToFilterBy) && StateToFilterBy != "[Select State]") { query = query.Where(s => s.WTWY_NAME == WaterwaytoFilterBy && s.STATE == StateToFilterBy && (s.Tons != "0" && s.Tons != "")).OrderBy(s => s.WTWY_NAME); MyQuery.Text = "Tonnage, WW and State"; } } if (StateToFilterBy == "[Select State]") //waterway but no state { query = query.Where(s => s.WTWY_NAME == WaterwaytoFilterBy && (s.Tons != "0" && s.Tons != "")).OrderBy(s => s.WTWY_NAME); MyQuery.Text = "Tonnage, WW No State"; } } } else { if (null != FilterState.SelectedValue) { string StateToFilterBy = FilterState.SelectedValue.ToString(); if (null != FilterState.SelectedValue && !string.IsNullOrWhiteSpace(StateToFilterBy) && StateToFilterBy != "[Select State]") { if (!string.IsNullOrWhiteSpace(StateToFilterBy) && StateToFilterBy != "[Select State]") { query = query.Where(s => s.STATE == StateToFilterBy && (s.Tons != "0" && s.Tons != "")).OrderBy(s => s.WTWY_NAME); MyQuery.Text = "Tonnage State No WW"; } } else { query = query.Where(s => (s.Tons != "0" && s.Tons != "")); MyQuery.Text = "Tonnage No State No WW"; } } } } } else //no tonnage { if (null != FilterWaterWay.SelectedValue) { string WaterwaytoFilterBy = FilterWaterWay.SelectedValue.ToString(); if (!string.IsNullOrWhiteSpace(WaterwaytoFilterBy) && WaterwaytoFilterBy != "[Select WaterWay]") { if (null != FilterState.SelectedValue) { string StateToFilterBy = FilterState.SelectedValue.ToString(); if (null != FilterState.SelectedValue && !string.IsNullOrWhiteSpace(StateToFilterBy) && StateToFilterBy != "[Select State]") { if (!string.IsNullOrWhiteSpace(StateToFilterBy) && StateToFilterBy != "[Select State]") { query = query.Where(s => s.WTWY_NAME == WaterwaytoFilterBy && s.STATE == StateToFilterBy).OrderBy(s => s.WTWY_NAME); MyQuery.Text = "No Tonnage, WW and State"; } } if (StateToFilterBy == "[Select State]") //waterway but no state { query = query.Where(s => s.WTWY_NAME == WaterwaytoFilterBy).OrderBy(s => s.WTWY_NAME); MyQuery.Text = "No Tonnage, WW No State"; } } } else { if (null != FilterState.SelectedValue) { string StateToFilterBy = FilterState.SelectedValue.ToString(); if (null != FilterState.SelectedValue && !string.IsNullOrWhiteSpace(StateToFilterBy) && StateToFilterBy != "[Select State]") { if (!string.IsNullOrWhiteSpace(StateToFilterBy) && StateToFilterBy != "[Select State]") { query = query.Where(s => s.STATE == StateToFilterBy).OrderBy(s => s.WTWY_NAME); MyQuery.Text = "No Tonnage State No WW"; } } else { LoadAllData(); MyQuery.Text = "No Tonnage No State No WW"; } } } } } LoadOperation<MASTER_DOCKS> loadOp = this.QDocksContext.Load(query); DocksGrid.ItemsSource = loadOp.Entities; }

    Read the article

  • Implementing coroutines in Java

    - by JUST MY correct OPINION
    This question is related to my question on existing coroutine implementations in Java. If, as I suspect, it turns out that there is no full implementation of coroutines currently available in Java, what would be required to implement them? As I said in that question, I know about the following: You can implement "coroutines" as threads/thread pools behind the scenes. You can do tricksy things with JVM bytecode behind the scenes to make coroutines possible. The so-called "Da Vinci Machine" JVM implementation has primitives that make coroutines doable without bytecode manipulation. There are various JNI-based approaches to coroutines also possible. I'll address each one's deficiencies in turn. Thread-based coroutines This "solution" is pathological. The whole point of coroutines is to avoid the overhead of threading, locking, kernel scheduling, etc. Coroutines are supposed to be light and fast and to execute only in user space. Implementing them in terms of full-tilt threads with tight restrictions gets rid of all the advantages. JVM bytecode manipulation This solution is more practical, albeit a bit difficult to pull off. This is roughly the same as jumping down into assembly language for coroutine libraries in C (which is how many of them work) with the advantage that you have only one architecture to worry about and get right. It also ties you down to only running your code on fully-compliant JVM stacks (which means, for example, no Android) unless you can find a way to do the same thing on the non-compliant stack. If you do find a way to do this, however, you have now doubled your system complexity and testing needs. The Da Vinci Machine The Da Vinci Machine is cool for experimentation, but since it is not a standard JVM its features aren't going to be available everywhere. Indeed I suspect most production environments would specifically forbid the use of the Da Vinci Machine. Thus I could use this to make cool experiments but not for any code I expect to release to the real world. This also has the added problem similar to the JVM bytecode manipulation solution above: won't work on alternative stacks (like Android's). JNI implementation This solution renders the point of doing this in Java at all moot. Each combination of CPU and operating system requires independent testing and each is a point of potentially frustrating subtle failure. Alternatively, of course, I could tie myself down to one platform entirely but this, too, makes the point of doing things in Java entirely moot. So... Is there any way to implement coroutines in Java without using one of these four techniques? Or will I be forced to use the one of those four that smells the least (JVM manipulation) instead?

    Read the article

  • how to develop a program to minimize errors in human transcription of hand written surveys

    - by Alex. S.
    I need to develop custom software to do surveys. Questions may be of multiple choice, or free text in a very few cases. I was asked to design a subsystem to check if there is any error in the manual data entry for the multiple choices part. We're trying to speed up the user data entry process and to minimize human input differences between digital forms and the original questionnaires. The surveys are filled with handwritten marks and text by human interviewers, so it's possible to find hard to read marks, or also the user could accidentally select a different value in some question, and we would like to avoid that. The software must include some automatic control to detect possible typing differences. Each answer of the multiple choice questions has the same probability of being selected. This question has two parts: The GUI. The most simple thing I have in mind is to implement the most usable design of the questions display: use of large and readable fonts and space generously the choices. Is there something else? For faster input, I would like to use drop down lists (favoring keyboard over mouse). Given the questions are grouped in sections, I would like to show the answers selected for the questions of that section, but this could slow down the process. Any other ideas? The error checking subsystem. What else can I do to minimize or to check human typos in the multiple choice questions? Is this a solvable problem? is there some statistical methodology to check values that were entered by the users are the same from the hand filled forms? For example, let's suppose the survey has 5 questions, and each has 4 options. Let's say I have n survey forms filled in paper by interviewers, and they're ready to be entered in the software, then how to minimize the accidental differences that can have the manual transcription of the n surveys, without having to double check everything in the 5 questions of the n surveys? My first suggestion is that at the end of the processing of all the hand filled forms, the software could choose some forms randomly to make a double check of the responses in a few instances, but on what criteria can I make this selection? This validation would be enough to cover everything in a significant way? The actual survey is nation level and it has 56 pages with over 200 questions in total, so it will be a lot of hand written pages by many people, and the intention is to reduce the likelihood of errors and to optimize speed in the data entry process. The surveys must filled in paper first, given the complications of taking laptops or handhelds with the interviewers.

    Read the article

  • Difficulty creating classes and arrays of those classes C#

    - by Lucifer Fayte
    I'm trying to implement a Discrete Fourier Transformation algorithm for a project I'm doing in school. But creating a class is seeming to be difficult(which it shouldn't be). I'm using Visual Studio 2012. Basically I need a class called Complex to store the two values I get from a DFT; The real portion and the imaginary portion. This is what I have so far for that: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Threading.Tasks; namespace SoundEditor_V3 { public class Complex { public double real; public double im; public Complex() { real = 0; im = 0; } } } The problem is that it doesn't recognize the constructor as a constructor, now I'm just learning C#, but I looked it up online and this is how it's supposed to look apparently. It recognizes my constructor as a method. Why is that? Am I creating the class wrong? It's doing the same thing for my Fourier class as well. So each time I try to create a Fourier object and then use it's method...there is no such thing. example, I do this: Fourier fou = new Fourier(); fou.DFT(s, N, amp, 0); and it tells me fou is a 'field' but is used like a 'type' why is it saying that? Here is the code for my Fourier class as well: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Threading.Tasks; namespace SoundEditor_V3 { public class Fourier { //FOURIER //N = number of samples //s is the array of samples(data) //amp is the array where the complex result will be written to //start is the where in the array to start public void DFT(byte[] s, int N, ref Complex[] amp, int start) { Complex tem = new Complex(); int f; int t; for (f = 0; f < N; f++) { tem.real = 0; tem.im = 0; for (t = 0; t < N; t++) { tem.real += s[t + start] * Math.Cos(2 * Math.PI * t * f / N); tem.im -= s[t + start] * Math.Sin(2 * Math.PI * t * f / N); } amp[f].real = tem.real; amp[f].im = tem.im; } } //INVERSE FOURIER public void IDFT(Complex[] A, ref int[] s) { int N = A.Length; int t, f; double result; for (t = 0; t < N; t++) { result = 0; for (f = 0; f < N; f++) { result += A[f].real * Math.Cos(2 * Math.PI * t * f / N) - A[f].im * Math.Sin(2 * Math.PI * t * f / N); } s[t] = (int)Math.Round(result); } } } } I'm very much stuck at the moment, any and all help would be appreciated. Thank you.

    Read the article

  • How do you combine "Revision Control" with "WorkFlow" for R?

    - by Tal Galili
    Hello all, I remember coming across R users writing that they use "Revision control" (e.g: "Source control"), and I am curious to know: How do you combine "Revision control" with your statistical analysis WorkFlow? Two (very) interesting discussions talk about how to deal with the WorkFlow. But neither of them refer to the revision control element: http://stackoverflow.com/questions/1266279/how-to-organize-large-r-programs http://stackoverflow.com/questions/1429907/workflow-for-statistical-analysis-and-report-writing A Long Update To The Question: Following some of the people's answers, and Dirk's question in the comment, I would like to direct my question a bit more. After reading the Wiki article about "revision control" (which I was previously not familiar with), it was clear to me that when using revision control, what one does is to build a development structure of his code. This structure either leads to a "final product" or to several branches. When building something like, let's say, a website. There is usually one end product you work towards (the website), with some prototypes along the way. But when doing a statistical analysis, the work (to my view) is different. Sometimes you know where you want to get to. But more often, you explore. Explore cleaning the dataset. Explore different methods for statistical analysis, and ask various questions of your data (and I am writing this, knowing how Frank Harrell, and other experience statisticians feels about Data dredging). That is way the WorkFlow question with statistical programming is (in my view) a serious and deep question, raising many issues, The simpler ones are technical: Which revision control software do you use (and why) ? Which IDE do you use(and why) ? The more interesting question are about work process: How do you structure your files? What do you keep as a separate file and what as a revision? or asking in a different way - What should be a "branch" and what should be a "sub project" in your code? For example: When starting to explore your data, should a plot be creating and then erased because it didn't lead any where (but kept as a revision) or should there be a backup file of that path? How you solve this tension was my initial curiosity. The second question is "what might I be missing?". What rules (of thumb) should one follow so to avoid common pitfalls doing statistical programming with version control? In my intuition, I feel that statistical programming is inherently different then software development (I am writing this without being a real expert in statistical programming, and even less so in software development). That's way I am unsure which of the lessons I have read here about version control would be applicable. Thanks a lot, Tal

    Read the article

  • X264 encoding using Opencv

    - by user573193
    I am working with a high resolution camera: 4008x2672. I a writing a simple program which grabs frame from the camera and sends the frame to a avi file. For working with such a high resolution, I found only x264 codec that could do the trick (Suggestions welcome). I am using opencv for most of the image handling stuff. As mentioned in this post http://doom10.org/index.php?topic=1019.0 , I modified the AVCodecContext members as per ffmpeg presets for libx264 (Had to do this to avoid broken ffmpeg defaults settings error). This is output I am getting when I try to run the program [libx264 @ 0x992d040]non-strictly-monotonic PTS 1294846981.526675 1 0 //Timestamp camera_no frame_no 1294846981.621101 1 1 1294846981.715521 1 2 1294846981.809939 1 3 1294846981.904360 1 4 1294846981.998782 1 5 1294846982.093203 1 6 Last message repeated 7 times [avi @ 0x992beb0]st:0 error, non monotone timestamps -614891469123651720 = -614891469123651720 OpenCV Error: Unspecified error (Error while writing video frame) in icv_av_write_frame_FFMPEG, file /home/ajoshi/ext/OpenCV-2.2.0/modules/highgui/src/cap_ffmpeg.cpp, line 1034 terminate called after throwing an instance of 'cv::Exception' what(): /home/ajoshi/ext/OpenCV-2.2.0/modules/highgui/src/cap_ffmpeg.cpp:1034: error: (-2) Error while writing video frame in function icv_av_write_frame_FFMPEG Aborted Modifications to the AVCodecContext are: if(codec_id == CODEC_ID_H264) { //fprintf(stderr, "Trying to parse a preset file for libx264\n"); //Setting Values manually from medium preset c-me_method = 7; c-qcompress=0.6; c-qmin = 10; c-qmax = 51; c-max_qdiff = 4; c-i_quant_factor=0.71; c-max_b_frames=3; c-b_frame_strategy = 1; c-me_range = 16; c-me_subpel_quality=7; c-coder_type = 1; c-scenechange_threshold=40; c-partitions = X264_PART_I8X8 | X264_PART_I4X4 | X264_PART_P8X8 | X264_PART_B8X8; c-flags = CODEC_FLAG_LOOP_FILTER; c-flags2 = CODEC_FLAG2_BPYRAMID | CODEC_FLAG2_MIXED_REFS | CODEC_FLAG2_WPRED | CODEC_FLAG2_8X8DCT | CODEC_FLAG2_FASTPSKIP; c-keyint_min = 25; c-refs = 3; c-trellis=1; c-directpred = 1; c-weighted_p_pred=2; } I am probably not setting the dts and pts values which I believed ffmpeg should be setting it for me. Any sugggestions welcome. Thanks in advance

    Read the article

  • Javascript self contained sandbox events and client side stack

    - by amnon
    I'm in the process of moving a JSF heavy web application to a REST and mainly JS module application . I've watched "scalable javascript application architecture" by Nicholas Zakas on yui theater (excellent video) and implemented much of the talk with good success but i have some questions : I found the lecture a little confusing in regards to the relationship between modules and sandboxes , on one had to my understanding modules should not be effected by something happening outside of their sandbox and this is why they publish events via the sandbox (and not via the core as they do access the core for hiding base libary) but each module in the application gets a new sandbox ? , shouldn't the sandbox limit events to the modoules using it ? or should events be published cross page ? e.g. : if i have two editable tables but i want to contain each one in a different sandbox and it's events effect only the modules inside that sandbox something like messabe box per table which is a different module/widget how can i do that with sandbox per module , ofcourse i can prefix the events with the moduleid but that creates coupling that i want to avoid ... and i don't want to package modules toghter as one module per combination as i already have 6-7 modules ? while i can hide the base library for small things like id selector etc.. i would still like to use the base library for module dependencies and resource loading and use something like yui loader or dojo.require so in fact i'm hiding the base library but the modules themself are defined and loaded by the base library ... seems a little strange to me libraries don't return simple js objects but usualy wrap them e.g. : u can do something like $$('.classname').each(.. which cleans the code alot , it makes no sense to wrap the base and then in the module create a dependency for the base library by executing .each but not using those features makes a lot of code written which can be left out ... and implemnting that functionality is very bug prone does anyonen have any experience with building a front side stack of this order ? how easy is it to change a base library and/or have modules from different libraries , using yui datatable but doing form validation with dojo ... ? some what of a combination of 2+4 if u choose to do something like i said and load dojo form validation widgets for inputs via yui loader would that mean dojocore is a module and the form module is dependant on it ? Thanks .

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • screnshot in android

    - by ujjawal
    The following is the code I am using to take a screen shot using GLSurfaceView. But I dont know why the onDraw() method in the GLSurfaceView.Renderer Class is not being called. Please if some one can look at the code below and point out what am I doing wrong.`public class MainActivity extends Activity { private GLSurfaceView mGLView; int x,y,w,h; Display disp; /** Called when the activity is first created. */ @Override public void onCreate(Bundle icicle) { super.onCreate(icicle); // ToDo add your GUI initialization code here setContentView(R.layout.main); x=0; y=0; disp = getWindowManager().getDefaultDisplay(); w = disp.getWidth(); h = disp.getHeight(); mGLView = new ClearGLSurfaceView(this); } class ClearGLSurfaceView extends GLSurfaceView { public ClearGLSurfaceView(Context context) { super(context); setDebugFlags(DEBUG_CHECK_GL_ERROR | DEBUG_LOG_GL_CALLS); mRenderer = new ClearRenderer(); setRenderer(mRenderer); } ClearRenderer mRenderer; } class ClearRenderer implements GLSurfaceView.Renderer { public void onSurfaceCreated(GL10 gl, EGLConfig config) { // Do nothing special. } public void onSurfaceChanged(GL10 gl, int w, int h) { //gl.glViewport(0, 0, w, h); } public void onDrawFrame(GL10 gl) { //gl.glClear(GL10.GL_COLOR_BUFFER_BIT | GL10.GL_DEPTH_BUFFER_BIT); int b[]=new int[w*(y+h)]; int bt[]=new int[w*h]; IntBuffer ib=IntBuffer.wrap(b); ib.position(0); gl.glReadPixels(x, 0, w, y+h, GL10.GL_RGBA, GL10.GL_UNSIGNED_BYTE, ib); for(int i=0, k=0; i<h; i++, k++) {//remember, that OpenGL bitmap is incompatible with Android bitmap //and so, some correction need. for(int j=0; j<w; j++) { int pix=b[i*w+j]; int pb=(pix>>16)&0xff; int pr=(pix<<16)&0x00ff0000; int pix1=(pix&0xff00ff00) | pr | pb; bt[(h-k-1)*w+j]=pix1; } } Bitmap bmp = Bitmap.createBitmap(bt, w, h,Bitmap.Config.ARGB_8888); try { File f = new File("/sdcard/testpicture.png"); f.createNewFile(); FileOutputStream fos=new FileOutputStream(f); bmp.compress(CompressFormat.PNG, 100, fos); try { fos.flush(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } try { fos.close(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } } catch (FileNotFoundException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch(IOException e) { e.printStackTrace(); } } } } ` Please someone help me out. I have just started learning to work on android.

    Read the article

  • Account confirmation email sent as SPAM :( PHP

    - by praveen
    Hi, I'm using PHPMailer to send a confirmation email for newly registered users in my social network. But i found out most of them have ended up in user's spam list. (hotmail and yahoo). How to avoid this? This is my script $mail=new PHPMailer(); $mail->IsSMTP(); $mail->SMTPAuth = mSMTPAuth(); $mail->SMTPSecure = mSMTPSecure(); $mail->Host = mHost(); $mail->Port = mPort(); $mail->Username = mUsername(); $mail->Password = mPassword(); $mail->From = mFrom(); $mail->FromName = "SiteName"; $mail->Subject = "SiteName New Account Activation"; $mail->IsHTML(true); $mail->WordWrap = 50; $mail->Body = "<h2>Welcome to " .$sitename. " " .$username. "! </h2><br><br>"; $mail->Body .= "Please click on the link below to verify your email address:<br><br>"; $mail->Body .= "<a href='".$base. "verify.php?a=" .$gen_key."'>".$base. "verify.php?a=" .$gen_key."</a>"; $mail->Body .= "<br><br>Regards<br>"; $mail->AltBody = "Welcome to " .$sitename. " " .$username. "!\n\nTo verify your email address, please click on the link below:\n\n".$base. "verify.php?a=" .$gen_key; $mail->AddAddress($email); $mail->Send(); $mail->ClearAddresses(); Please help. This is really confusing. Thanks in advance

    Read the article

  • PHP - Code Sample - Polymorphism Implementation - How to allow for expansion?

    - by darga33
    I've read numerous SO posts about Polymorphism, and also the other really good one at http://net.tutsplus.com/tutorials/php/understanding-and-applying-polymorphism-in-php/ Good stuff!!! I'm trying to figure out how a seasoned PHP developer that follows all the best practices would accomplish the following. Please be as specific and detailed as possible. I'm sure your answer is going to help a lot of people!!! :-) While learning Polymorphism, I came across a little stumbling block. Inside of the PDFFormatter class, I had to use (instanceof) in order to figure out if some code should be included in the returned data. I am trying to be able to pass in two different kinds of profiles to the formatter. (needs to be able to handle multiple kinds of formatters but display the data specific to the Profile class that is being passed to it). It doesn't look bad now, but imagine 10 more kinds of Profiles!! How would you do this? The best answer would also include the changes you would make. Thanks sooooooo much in advance!!!!! Please PHP only! Thx!!! File 1. FormatterInterface.php interface FormatterInterface { public function format(Profile $Profile); } File 2. PDFFormatter.php class PDFFormatter implements FormatterInterface { public function format(Profile $Profile) { $format = "PDF Format<br /><br />"; $format .= "This is a profile formatted as a PDF.<br />"; $format .= 'Name: ' . $Profile->name . '<br />'; if ($Profile instanceof StudentProfile) { $format .= "Graduation Date: " . $Profile->graduationDate . "<br />"; } $format .= "<br />End of PDF file"; return $format; } } File 3. Profile.php class Profile { public $name; public function __construct($name) { $this->name = $name; } public function format(FormatterInterface $Formatter) { return $Formatter->format($this); } } File 4. StudentProfile.php class StudentProfile extends Profile { public $graduationDate; public function __construct($name, $graduationDate) { $this->name = $name; $this->graduationDate = $graduationDate; } } File 5. index.php //Assuming all files are included...... $StudentProfile = new StudentProfile('Michael Conner', 55, 'Unknown, FL', 'Graduate', '1975', 'Business Management'); $Profile = new Profile('Brandy Smith', 44, 'Houston, TX'); $PDFFormatter = new PDFFormatter(); echo '<hr />'; echo $StudentProfile->format($PDFFormatter); echo '<hr />'; echo $Profile->format($PDFFormatter);

    Read the article

  • Parsing string logic issue c#

    - by N0xus
    This is a follow on from this question My program is taking in a string that is comprised of two parts: a distance value and an id number respectively. I've split these up and stored them in local variables inside my program. All of the id numbers are stored in a dictionary and are used check the incoming distance value. Though I should note that each string that gets sent into my program from the device is passed along on a single string. The next time my program receives that a signal from a device, it overrides the previous data that was there before. Should the id key coming into my program match one inside my dictionary, then a variable held next to my dictionaries key, should be updated. However, when I run my program, I don't get 6 different values, I only get the same value and they all update at the same time. This is all the code I have written trying to do this: Dictionary<string, string> myDictonary = new Dictionary<string, string>(); string Value1 = ""; string Value2 = ""; string Value3 = ""; string Value4 = ""; string Value5 = ""; string Value6 = ""; void Start() { myDictonary.Add("11111111", Value1); myDictonary.Add("22222222", Value2); myDictonary.Add("33333333", Value3); myDictonary.Add("44444444", Value4); myDictonary.Add("55555555", Value5); myDictonary.Add("66666666", Value6); } private void AppendString(string message) { testMessage = message; string[] messages = message.Split(','); foreach(string w in messages) { if(!message.StartsWith(" ")) outputContent.text += w + "\n"; } messageCount = "RSSI number " + messages[0]; uuidString = "UUID number " + messages[1]; if(myDictonary.ContainsKey(messages[1])) { Value1 = messageCount; Value2 = messageCount; Value3 = messageCount; Value4 = messageCount; Value5 = messageCount; Value6 = messageCount; } } How can I get it so that when programs recives the first key, for example 1111111, it only updates Value1? The information that comes through can be dynamic, so I'd like to avoid harding as much information as I possibly can.

    Read the article

  • Embedded "Smart" character LCD driver. Is this a good idea?

    - by chris12892
    I have an embedded project that I am working on, and I am currently coding the character LCD driver. At the moment, the LCD driver only supports "dumb" writing. For example, let's say line 1 has some text on it, and I make a call to the function that writes to the line. The function will simply seek to the beginning of the line and write the text (plus enough whitespace to erase whatever was last written). This is well and good, but I get the feeling it is horribly inefficient sometimes, since some lines are simply: "Some-reading: some-Value" Rather than "brute force" replacing the entire line, I wanted to develop some code that would figure out the best way to update the information on the LCD. (just as background, it takes 2 bytes to seek to any char position. I can then begin writing the string) My idea was to first have a loop. This loop would compare the input to the last write, and in doing so, it would cover two things: A: Collect all the differences between the last write and the input. For every contiguous segment (be it same or different) add two bytes to the byte count. This is referenced in B to determine if we are wasting serial bandwidth. B: The loop would determine if this is really a smart thing to do. If we end up using more bytes to update the line than to "brute force" the line, then we should just return and let the brute force method take over. We should exit the smart write function as soon as this condition is met to avoid wasting time. The next part of the function would take all the differences, seek to the required char on the LCD, and write them. Thus, if we have a string like this already on the LCD: "Current Temp: 80F" and we want to update it to "Current Temp: 79F" The function will go through and see that it would take less bandwidth to simply seek to the "8" and write "79". The "7" will cover the "8" and the "9" will cover the "0". That way, we don't waste time writing out the entire string. Does this seem like a practical idea?

    Read the article

  • Template function as a template argument

    - by Kos
    I've just got confused how to implement something in a generic way in C++. It's a bit convoluted, so let me explain step by step. Consider such code: void a(int) { // do something } void b(int) { // something else } void function1() { a(123); a(456); } void function2() { b(123); b(456); } void test() { function1(); function2(); } It's easily noticable that function1 and function2 do the same, with the only different part being the internal function. Therefore, I want to make function generic to avoid code redundancy. I can do it using function pointers or templates. Let me choose the latter for now. My thinking is that it's better since the compiler will surely be able to inline the functions - am I correct? Can compilers still inline the calls if they are made via function pointers? This is a side-question. OK, back to the original point... A solution with templates: void a(int) { // do something } void b(int) { // something else } template<void (*param)(int) > void function() { param(123); param(456); } void test() { function<a>(); function<b>(); } All OK. But I'm running into a problem: Can I still do that if a and b are generics themselves? template<typename T> void a(T t) { // do something } template<typename T> void b(T t) { // something else } template< ...param... > // ??? void function() { param<SomeType>(someobj); param<AnotherType>(someotherobj); } void test() { function<a>(); function<b>(); } I know that a template parameter can be one of: a type, a template type, a value of a type. None of those seems to cover my situation. My main question is hence: How do I solve that, i.e. define function() in the last example? (Yes, function pointers seem to be a workaround in this exact case - provided they can also be inlined - but I'm looking for a general solution for this class of problems).

    Read the article

  • How do I 'globally' catch exceptions thrown in object instances.

    - by SleepyBobos
    I am currently writing a winforms application (C#). I am making use of the Enterprise Library Exception Handling Block, following a fairly standard approach from what I can see. IE : In the Main method of Program.cs I have wired up event handler to Application.ThreadException event etc. This approach works well and handles the applications exceptional circumstances. In one of my business objects I throw various exceptions in the Set accessor of one of the objects properties set { if (value > MaximumTrim) throw new CustomExceptions.InvalidTrimValue("The value of the minimum trim..."); if (!availableSubMasterWidthSatisfiesAllPatterns(value)) throw new CustomExceptions.InvalidTrimValue("Another message..."); _minimumTrim = value; } My logic for this approach (without turning this into a 'when to throw exceptions' discussion) is simply that the business objects are responsible for checking business rule constraints and throwing an exception that can bubble up and be caught as required. It should be noted that in the UI of my application I do explictly check the values that the public property is being set to (and take action there displaying friendly dialog etc) but with throwing the exception I am also covering the situation where my business object may not be used by a UI eg : the Property is being set by another business object for example. Anyway I think you all get the idea. My issue is that these exceptions are not being caught by the handler wired up to Application.ThreadException and I don't understand why. From other reading I have done the Application.ThreadException event and it handler "... catches any exception that occurs on the main GUI thread". Are the exceptions being raised in my business object not in this thread? I have not created any new threads. I can get the approach to work if I update the code as follows, explicity calling the event handler that is wired to Application.ThreadException. This is the approach outlined in Enterprise Library samples. However this approach requires me to wrap any exceptions thrown in a try catch, something I was trying to avoid by using a 'global' handler to start with. try { if (value > MaximumTrim) throw new CustomExceptions.InvalidTrimValue("The value of the minimum..."); if (!availableSubMasterWidthSatisfiesAllPatterns(value)) throw new CustomExceptions.InvalidTrimValue("Another message"); _minimumTrim = value; } catch (Exception ex) { Program.ThreadExceptionHandler.ProcessUnhandledException(ex); } I have also investigated using wiring a handler up to AppDomain.UnhandledException event but this does not catch the exceptions either. I would be good if someone could explain to me why my exceptions are not being caught by my global exception handler in the first code sample. Is there another approach I am missing or am I stuck with wrapping code in try catch, shown above, as required?

    Read the article

  • Project Euler #18 - how to brute force all possible paths in tree-like structure using Python?

    - by euler user
    Am trying to learn Python the Atlantic way and am stuck on Project Euler #18. All of the stuff I can find on the web (and there's a LOT more googling that happened beyond that) is some variation on 'well you COULD brute force it, but here's a more elegant solution'... I get it, I totally do. There are really neat solutions out there, and I look forward to the day where the phrase 'acyclic graph' conjures up something more than a hazy, 1 megapixel resolution in my head. But I need to walk before I run here, see the state, and toy around with the brute force answer. So, question: how do I generate (enumerate?) all valid paths for the triangle in Project Euler #18 and store them in an appropriate python data structure? (A list of lists is my initial inclination?). I don't want the answer - I want to know how to brute force all the paths and store them into a data structure. Here's what I've got. I'm definitely looping over the data set wrong. The desired behavior would be to go 'depth first(?)' rather than just looping over each row ineffectually.. I read ch. 3 of Norvig's book but couldn't translate the psuedo-code. Tried reading over the AIMA python library for ch. 3 but it makes too many leaps. triangle = [ [75], [95, 64], [17, 47, 82], [18, 35, 87, 10], [20, 4, 82, 47, 65], [19, 1, 23, 75, 3, 34], [88, 2, 77, 73, 7, 63, 67], [99, 65, 4, 28, 6, 16, 70, 92], [41, 41, 26, 56, 83, 40, 80, 70, 33], [41, 48, 72, 33, 47, 32, 37, 16, 94, 29], [53, 71, 44, 65, 25, 43, 91, 52, 97, 51, 14], [70, 11, 33, 28, 77, 73, 17, 78, 39, 68, 17, 57], [91, 71, 52, 38, 17, 14, 91, 43, 58, 50, 27, 29, 48], [63, 66, 4, 68, 89, 53, 67, 30, 73, 16, 69, 87, 40, 31], [04, 62, 98, 27, 23, 9, 70, 98, 73, 93, 38, 53, 60, 4, 23], ] def expand_node(r, c): return [[r+1,c+0],[r+1,c+1]] all_paths = [] my_path = [] for i in xrange(0, len(triangle)): for j in xrange(0, len(triangle[i])): print 'row ', i, ' and col ', j, ' value is ', triangle[i][j] ??my_path = somehow chain these together??? if my_path not in all_paths all_paths.append(my_path) Answers that avoid external libraries (like itertools) preferred.

    Read the article

  • Generic Type constraint in .net

    - by Jose
    Okay I'm looking for some input, I'm pretty sure this is not currently supported in .NET 3.5 but here goes. I want to require a generic type passed into my class to have a constructor like this: new(IDictionary<string,object>) so the class would look like this public MyClass<T> where T : new(IDictionary<string,object>) { T CreateObject(IDictionary<string,object> values) { return new T(values); } } But the compiler doesn't support this, it doesn't really know what I'm asking. Some of you might ask, why do you want to do this? Well I'm working on a pet project of an ORM so I get values from the DB and then create the object and load the values. I thought it would be cleaner to allow the object just create itself with the values I give it. As far as I can tell I have two options: 1) Use reflection(which I'm trying to avoid) to grab the PropertyInfo[] array and then use that to load the values. 2) require T to support an interface like so: public interface ILoadValues { void LoadValues(IDictionary values); } and then do this public MyClass<T> where T:new(),ILoadValues { T CreateObject(IDictionary<string,object> values) { T obj = new T(); obj.LoadValues(values); return obj; } } The problem I have with the interface I guess is philosophical, I don't really want to expose a public method for people to load the values. Using the constructor the idea was that if I had an object like this namespace DataSource.Data { public class User { protected internal User(IDictionary<string,object> values) { //Initialize } } } As long as the MyClass<T> was in the same assembly the constructor would be available. I personally think that the Type constraint in my opinion should ask (Do I have access to this constructor? I do, great!) Anyways any input is welcome.

    Read the article

  • .NET Free memory usage (how to prevent overallocation / release memory to the OS)

    - by Ronan Thibaudau
    I'm currently working on a website that makes large use of cached data to avoid roundtrips. At startup we get a "large" graph (hundreds of thouthands of different kinds of objects). Those objects are retrieved over WCF and deserialized (we use protocol buffers for serialization) I'm using redgate's memory profiler to debug memory issues (the memory didn't seem to fit with how much memory we should need "after" we're done initializing and end up with this report Now what we can gather from this report is that: 1) Most of the memory .NET allocated is free (it may have been rightfully allocated during deserialisation, but now that it's free, i'd like for it to return to the OS) 2) Memory is fragmented (which is bad, as everytime i refresh the cash i need to redo the memory hungry deserialisation process and this, in turn creates large object that may throw an OutOfMemoryException due to fragmentation) 3) I have no clue why the space is fragmented, because when i look at the large object heap, there are only 30 instances, 15 object[] are directly attached to the GC and totally unrelated to me, 1 is a char array also attached directly to the GC Heap, the remaining 15 are mine but are not the cause of this as i get the same report if i comment them out in code. So my question is, what can i do to go further with this? I'm not really sure what to look for in debugging / tools as it seems my memory is fragmented, but not by me, and huge amounts of free spaces are allocated by .net , which i can't release. Also please make sure you understand the question well before answering, i'm not looking for a way to free memory within .net (GC.Collect), but to free memory that is already free in .net , to the system as well as to defragment said memory. Note that a slow solution is fine, if it's possible to manually defragment the large heap i'd be all for it as i can call it at the end of RefreshCache and it's ok if it takes 1 or 2 second to run. Thanks for your help! A few notes i forgot: 1) The project is a .net 2.0 website, i get the same results running it in a .net 4 pool, idem if i run it in a .net 4 pool and convert it to .net 4 and recompile. 2) These are results of a release build, so debug build can not be the issue. 3) And this is probably quite important, i do not get these issues at all in the webdev server, only in IIS, in the webdev i get memory consumption rather close to my actual consumption (well more, but not 5-10X more!)

    Read the article

  • How to make a jQuery plugin (the right way)?

    - by macek
    I know there are jQuery cookie plugins out there, but I wanted to write one for the sake of better learning the jQuery plugin pattern. I like the separation of "work" in small, manageable functions, but I feel like I'm passing name, value, and options arguments around too much. Is there a way this can be refactored? I'm looking for snippets of code to help illustrate examples provided with in answers. Any help is appreciated. Thanks :) example usage $.cookie('foo', 'bar', {expires:7}); $.cookie('foo'); //=> bar $.cookie('foo', null); $.cookie('foo'); //=> undefined Edit: I did a little bit of work on this. You can view the revision history to see where this has come from. It still feels like more refactoring can be done to optimize the flow a bit. Any ideas? the plugin (function($){ $.cookie = function(name, value, options) { if (typeof value == 'undefined') { return get(name); } else { options = $.extend({}, $.cookie.defaults, options || {}); return (value != null) ? set(name, value, options) : unset(name, options); } }; $.cookie.defaults = { expires: null, path: '/', domain: null, secure: false }; var set = function(name, value, options){ console.log(options); return document.cookie = options_string(name, value, options); }; var get = function(name){ var cookies = {}; $.map(document.cookie.split(';'), function(pair){ var c = $.trim(pair).split('='); cookies[c[0]] = c[1]; }); return decodeURIComponent(cookies[name]); }; var unset = function(name, options){ value = ''; options.expires = -1; set(name, value, options); }; var options_string = function(name, value, options){ var pairs = [param.name(name, value)]; $.each(options, function(k,v){ pairs.push(param[k](v)); }); return $.map(pairs, function(p){ return p === null ? null : p; }).join(';'); }; var param = { name: function(name, value){ return name + "=" + encodeURIComponent(value); }, expires: function(value){ // no expiry if(value === null){ return null; } // number of days else if(typeof value == "number"){ d = new Date(); d.setTime(d.getTime() + (value * 24 * 60 * 60 * 1000)); } // date object else if(typeof value == "object" && value instanceof "Date") { d = value; } return "expires=" + d.toUTCString(); }, path: function(value){ return "path="+value; }, domain: function(value){ return value === null ? null : "domain=" + value; }, secure: function(bool){ return bool ? "secure" : null; } }; })(jQuery);

    Read the article

< Previous Page | 519 520 521 522 523 524 525 526 527 528 529 530  | Next Page >