Search Results

Search found 6735 results on 270 pages for 'pre commit'.

Page 53/270 | < Previous Page | 49 50 51 52 53 54 55 56 57 58 59 60  | Next Page >

  • Can I use Eclipse JDT to create new 'working copies' of source files in memory only?

    - by RYates
    I'm using Eclipse JDT to build a Java refactoring platform, for exploring different refactorings in memory before choosing one and saving it. I can create collections of working copies of the source files, edit them in memory, and commit the changes to disk using the JDT framework. However, I also want to generate new 'working copy' source files in memory as part of refactorings, and only create the corresponding real source file if I commit the working copy. I have seen various hints that this is possible, e.g. http://www.jarvana.com/jarvana/view/org/eclipse/jdt/doc/isv/3.3.0-v20070613/isv-3.3.0-v20070613.jar!/guide/jdt%5Fapi%5Fmanip.htm says "Note that the compilation unit does not need to exist in the Java model in order for a working copy to be created". So far I have only been able to create a new real file, i.e. ICompilationUnit newICompilationUnit = myPackage.createCompilationUnit(newName, "package piffle; public class Baz{private int i=0;}", false, null); This is not what I want. Does anyone know how to create a new 'working copy' source file, that does not appear in my file system until I commit it? Or any other mechanism to achieve the same thing?

    Read the article

  • Why cant Git merge file changes with a modified parent/master.

    - by Andy
    I have a file with one line in it. I create a branch and add a second line to the same file. Save and commit to the branch. I switch back to the master. And add a different, second line to the file. Save and commit to the master. So there's now 3 unique lines in total. If I now try and merge the branch back to the master, it suffers a merge conflict. Why cant Git simple merge each line, one after the other? My attempt at merge behaves something like this: PS D:\dev\testing\test1> git merge newbranch Auto-merging hello.txt CONFLICT (content): Merge conflict in hello.txt Automatic merge failed; fix conflicts and then commit the result. PS D:\dev\testing\test1> git diff diff --cc hello.txt index 726eeaf,e48d31a..0000000 --- a/hello.txt +++ b/hello.txt @@@ -1,2 -1,2 +1,6 @@@ This is the first line. - New line added by master. -Added a line in newbranch. ++<<<<<<< HEAD ++New line added by master. ++======= ++Added a line in newbranch. ++>>>>>>> newbranch Is there a way to make it slot lines in automatically, one after the other?

    Read the article

  • Get back the changes after accidental checkout?

    - by Millisami
    The following was the status of my repo. [~/rails_apps/jekyll_apps/nepalonrails (design)?] ? gst # On branch design # Changed but not updated: # (use "git add/rm <file>..." to update what will be committed) # (use "git checkout -- <file>..." to discard changes in working directory) # # modified: _layouts/default.html # deleted: _site/blog/2010/04/07/welcome-to-niraj-blog/index.html # deleted: _site/blog/2010/04/08/the-code-syntax-highlight/index.html # deleted: _site/blog/2010/05/01/showing-demo-to-kalyan/index.html # deleted: _site/config.ru # deleted: _site/index.html # deleted: _site/static/css/style.css # deleted: _site/static/css/syntax.css # modified: static/css/style.css # no changes added to commit (use "git add" and/or "git commit -a") Accedently, I did git checkout -f and now the changes are gone which I wasnt supposed to do. [~/rails_apps/jekyll_apps/nepalonrails (design)?] ? git co -f [~/rails_apps/jekyll_apps/nepalonrails (design)] ? gst # On branch design nothing to commit (working directory clean) [~/rails_apps/jekyll_apps/nepalonrails (design)] ? Can I get back the changes back?

    Read the article

  • Commited memory goes to physical RAM or reserves space in the paging file?

    - by Sil
    When I do VirtualAlloc with MEM_COMMIT this "Allocates physical storage in memory or in the paging file on disk for the specified reserved memory pages" (quote from MSDN article http://msdn.microsoft.com/en-us/library/aa366887%28VS.85%29.aspx). All is fine up until now BUT: the description of Commited Bytes Counter says that "Committed memory is the physical memory which has space reserved on the disk paging file(s)." I also read "Windows via C/C++ 5th edition" and this book says that commiting memory means reserving space in the page file.... The last two cases don't make sense to me... If you commit memory, doesn't that mean that you commit to physical storage (RAM)? The page file being there for swaping out currently unused pages of memory in case memory gets low. The book says that when you commit memory you actually reserve space in the paging file. If this were true than that would mean that for a committed page there is space reserved in the paging file and a page frame in physical in memory... So twice as much space is needed ?! Isn't the page file's purpose to make the total physical memory larger than it actually is? If I have a 1G of RAM with a 1G page file = 2G of usable "physical memory"(the book also states this but right after that it says what I discribed at point 2). What am I missing? Thanks.

    Read the article

  • Help renaming svn repository

    - by rascher
    Here is the deal: I created an SVN repository, say, foo. It is at http://www.example.com/foo. Then I did an svn checkout. I made some updates and changes to my local copy of the code over the week. I haven't committed yet. I realized that I wanted to rename the repository. So I did this: svn copy http://example.com/foo http://example.com/bar svn delete http://example.com/foo I finish my changes (and local svn still thinks I'm working under "foo".) svn commit fails because the repo has been renamed. I try to use svn switch --relocate but it yells at me because svn is awful. I try using the script here to replace "foo" with "bar" in my billion .svn/ folders. This replace is taking a long time. I wonder if something hung? Or maybe sshfs failed? I kill it. Ctrl-C. I look and see that half my files have "foo" and the others have "bar" in the URLs in the sundry .svn/ folders. All I want to do is commit my files with the new name. I could re-checkout the branch, but then I have no way to remember which files I changed, which is why I was using version control in the first place, and svn is so godawful at moving and renaming things. What do I need to do to: Have a "clean" copy of my "bar" svn branch? and, most importantly: Commit the changes I made?

    Read the article

  • Is this a situation where I should "hg push -f"?

    - by user144182
    I have two machines, A and B that both access an external hg repository. I did some development on A, wasn't ready to push changesets to the external, and needed to switch machines, so I pushed the changesets to B using hg serve. Changesets continued on B, were committed and then pushed to external repo. I then pulled on A and updated to default/tip. This left the local changesets that had previously been pushed to B as a branch, but because of how I pushed things around, the changes in the local changesets are already in default/tip. I've now continued to make changes and commit locally on A, but when I try to push hg asks me to merge or do push -f instead. I know push -f is almost never recommended. This situation is close to one where I should use rebase, however the changesets that would be "rebased" I don't really need locally or in the external repository since they are already effectively in default/tip via the push to B. Now, I know I could merge with the latest local changeset and just discard the changes, but then I would still have to commit the merge which gets me back into rebase territory. Is this a case where I could do hg push -f? Also, why would pushing from A create remote heads if I've updated to default/tip before I continued to commit changesets?

    Read the article

  • Tips for using Subversion and XCode in a team project

    - by FelipeUY
    Hi to all. I've been working on an Xcode (iPhone) project with three different persons. We have the project on a Subversion repository, but we still don't completely understand some aspects of the Subversion + Xcode methodology: 1) Each time someone does a commit on a single file, it may appear or not in the project of the other developers. Even though the same person that creates the new files, it adds those files to the Repository and then it commits on those files. Why does that happens? Any suggestions? 2) Each person that is involved on the project can't do a "Commit entire project" without causing a considerable headache to the rest of the developers... any idea how this should be done?. The working methodology that we are trying to implement is that only one developer (generally the leader of the project) can Commit the entire project but he must inform the rest of the team, so everybody can be prepared to receive a message asking him to discard his changes and read the new files from the repository. I need suggestions or advice on how to handle a project with multiple developers using subversion. We have read the Subversion handbook, and many other messages on StackOverflow but I still can't find any useful advice. Thanks for any tip!

    Read the article

  • Best workflow with Git & Github

    - by Tom Schlick
    Hey guys, im looking for some advice on how to properly structure the workflow for my team with git & github. we are recent svn converts and its kind of confusing on how we should best setup our day-to-day workflow. Here is a little background, im comfortable with command line and my team is pretty new to it but can follow use commands. We all are working on the same project with 3 environments (development, staging, and production). We are a mix of developers & designers so some use the Git GUI and some command line. Our setup in svn went something like this. We had a branch for development, staging and production. When people were confident with code they would commit and then merge it into the staging. The server would update itself and on a release day (weekly) we would do a diff and push the changes to the production server. Now i setup those branches and got the process with the server running but its the actual workflow that is confusing the hell out of me. It seems like overkill that every time someone makes a change on a file they would create a new branch, commit, merge, and delete that branch... from what i have read they would be able to do it on a specific commit (using the hash), do i have that right? is this an acceptable way to go about things with git? any advice would be greatly appreciated.

    Read the article

  • Do Distributed Version Control Systems promote poor backup habits?

    - by John
    In a DVCS, each developer has an entire repository on their workstation, to which they can commit all their changes. Then they can merge their repo with someone else's, or clone it, or whatever (as I understand it, I'm not a DVCS user). To me that flags a side-effect, of being more vulnerable to forgetting to backup. In a traditional centralised system, both you as a developer and the people in charge know that if you commit something, it's held on a central server which can have decent backup solutions in place. But using a DVCS, it seems you only have to push your work to a server when you feel like sharing it. It's all very well you have the repo locally so you can work on your feature branch for a month without bothering anyone, but it means (I think) that checking in your code to the repo is not enough, you have to remember to do regular pushes to a backed-up server. It also means, doesn't it, that a team lead can't see all those nice SVN commit emails to keep a rough idea what's going on in the code-base? Is any of this a real issue?

    Read the article

  • SVN Error 403 Forbidden

    - by Chris
    I can't figure this out. I try to import a new project into a svn repository from Netbeans and get 403 Forbidden. I just setup svn on my serverbox today. I can get to it through a browser just fine, though its empty as I haven't imported my project yet. Apache's path for html files is /var/www I setup the svn repo in /var/svn This is the structure of /var/svn [root@localhost svn]# ls -lR /var/svn /var/svn: total 4 drwxrwxrwx 7 apache apache 4096 2010-03-26 10:18 repo /var/svn/repo: total 36 drwxrwxrwx 2 apache apache 4096 2010-03-26 09:47 conf drwxrwxrwx 3 apache apache 4096 2010-03-26 10:18 dav drwxrwsrwx 6 apache apache 4096 2010-03-26 11:19 db -rwxrwxrwx 1 apache apache 2 2010-03-26 09:47 format drwxrwxrwx 2 apache apache 4096 2010-03-26 09:47 hooks drwxrwxrwx 2 apache apache 4096 2010-03-26 09:47 locks -rwxrwxrwx 1 apache apache 229 2010-03-26 09:47 README.txt -rwxrwxrwx 1 apache apache 15 2010-03-26 09:47 svnauth -rwxrwxrwx 1 apache apache 43 2010-03-26 09:48 svnpass /var/svn/repo/conf: total 12 -rwxrwxrwx 1 apache apache 1080 2010-03-26 09:47 authz -rwxrwxrwx 1 apache apache 309 2010-03-26 09:47 passwd -rwxrwxrwx 1 apache apache 2279 2010-03-26 09:47 svnserve.conf /var/svn/repo/dav: total 4 drwxrwxrwx 2 apache apache 4096 2010-03-26 11:19 activities.d /var/svn/repo/dav/activities.d: total 0 /var/svn/repo/db: total 48 -rwxrwxrwx 1 apache apache 2 2010-03-26 09:47 current -rwxrwxrwx 1 apache apache 22 2010-03-26 09:47 format -rwxrwxrwx 1 apache apache 1920 2010-03-26 09:47 fsfs.conf -rwxrwxrwx 1 apache apache 5 2010-03-26 09:47 fs-type -rwxrwxrwx 1 apache apache 2 2010-03-26 09:47 min-unpacked-rev -rwxrwxrwx 1 apache apache 4096 2010-03-26 09:47 rep-cache.db drwxrwsrwx 3 apache apache 4096 2010-03-26 09:47 revprops drwxrwsrwx 3 apache apache 4096 2010-03-26 09:47 revs drwxrwsrwx 2 apache apache 4096 2010-03-26 11:19 transactions -rwxrwxrwx 1 apache apache 2 2010-03-26 11:19 txn-current -rwxrwxrwx 1 apache apache 0 2010-03-26 09:47 txn-current-lock drwxrwsrwx 2 apache apache 4096 2010-03-26 11:19 txn-protorevs -rwxrwxrwx 1 apache apache 37 2010-03-26 09:47 uuid -rwxrwxrwx 1 apache apache 0 2010-03-26 09:47 write-lock /var/svn/repo/db/revprops: total 4 drwxrwsrwx 2 apache apache 4096 2010-03-26 09:47 0 /var/svn/repo/db/revprops/0: total 4 -rwxrwxrwx 1 apache apache 50 2010-03-26 09:47 0 /var/svn/repo/db/revs: total 4 drwxrwsrwx 2 apache apache 4096 2010-03-26 09:47 0 /var/svn/repo/db/revs/0: total 4 -rwxrwxrwx 1 apache apache 115 2010-03-26 09:47 0 /var/svn/repo/db/transactions: total 0 /var/svn/repo/db/txn-protorevs: total 0 /var/svn/repo/hooks: total 36 -rwxrwxrwx 1 apache apache 1955 2010-03-26 09:47 post-commit.tmpl -rwxrwxrwx 1 apache apache 1638 2010-03-26 09:47 post-lock.tmpl -rwxrwxrwx 1 apache apache 2267 2010-03-26 09:47 post-revprop-change.tmpl -rwxrwxrwx 1 apache apache 1567 2010-03-26 09:47 post-unlock.tmpl -rwxrwxrwx 1 apache apache 3404 2010-03-26 09:47 pre-commit.tmpl -rwxrwxrwx 1 apache apache 2410 2010-03-26 09:47 pre-lock.tmpl -rwxrwxrwx 1 apache apache 2764 2010-03-26 09:47 pre-revprop-change.tmpl -rwxrwxrwx 1 apache apache 2100 2010-03-26 09:47 pre-unlock.tmpl -rwxrwxrwx 1 apache apache 2758 2010-03-26 09:47 start-commit.tmpl /var/svn/repo/locks: total 8 -rwxrwxrwx 1 apache apache 139 2010-03-26 09:47 db.lock -rwxrwxrwx 1 apache apache 139 2010-03-26 09:47 db-logs.lock I've got httpd.conf loading svn.conf which contains: <Location /svn> DAV on DAV svn #SVNParentPath /var/svn SVNPath /var/svn/repo Authtype Basic AuthName "Subversion" AuthUserFile /var/svn/repo/svnpass Require valid-user AuthzSVNAccessFile /var/svn/repo/svnauth </Location> Full error message is: org.tigris.subversion.javahl.ClientException: RA layer request failed Server sent unexpected return value (403 Forbidden) in response to CHECKOUT request for '/svn/!svn/bln/0' Sorry for the incredibly long post, but I thought more info would be better than less. I've been fidgeting with this problem for a long time now.

    Read the article

  • Paypal NVP API - Keep getting error 81002

    - by Andree
    Hi there, I am new to PayPal API, and I'm having trouble calling SetExpressCheckout using CURL in PHP. I have set everything correctly, as far as I'm concerned, but I kept getting an 81002 error "Method Specified is not Supported". The code snippet is below. I got the CA Root certificates file from here. <?php $paypal_data = array( 'USER' => urlencode('andree_1272823561_biz_api1.gmail.com'), 'PWD' => urlencode('1272823576'), 'SIGNATURE' => urlencode('Am1t0wiu2tv7VwZ5ebdeY9zv1GF6Ad0PFz-qTGFFf7vbWU6ee4bxy8KL'), 'VERSION' => urlencode('52.0'), 'PAYMENTACTION' => urlencode('Sale'), 'METHOD' => urlencode('SetExpressCheckout'), 'AMT' => urlencode('52.00'), 'RETURNURL' => urlencode('get_express_checkout_details.php'), 'CANCELURL' => urlencode('index.php') ); $url = 'https://api-3t.sandbox.paypal.com/nvp?' . http_build_query($paypal_data); $curl = curl_init(); curl_setopt($curl, CURLOPT_URL, $url); curl_setopt($curl, CURLOPT_RETURNTRANSFER, 1); curl_setopt($curl, CURLOPT_CAINFO, dirname(__FILE__) . '/cacert.pem'); $result = curl_exec($curl); curl_close($curl); parse_str($result, $result); ?> <pre>Data sent: <?php print_r($paypal_data); ?></pre> <pre>Result: <?php print_r($result); ?></pre> When I run the code, the output is the following: Data sent: Array ( [USER] => andree_1272823561_biz_api1.gmail.com [PWD] => 1272823576 [SIGNATURE] => Am1t0wiu2tv7VwZ5ebdeY9zv1GF6Ad0PFz-qTGFFf7vbWU6ee4bxy8KL [VERSION] => 52.0 [PAYMENTACTION] => Sale [METHOD] => SetExpressCheckout [AMT] => 52.00 [RETURNURL] => get_express_checkout_details.php [CANCELURL] => index.php ) Result: Array ( [ACK] => Failure [L_ERRORCODE0] => 81002 [L_SHORTMESSAGE0] => Unspecified Method [L_LONGMESSAGE0] => Method Specified is not Supported [L_SEVERITYCODE0] => Error ) Anyone knows what could be the problem? Regards, Andree.

    Read the article

  • Installing Rails 3 - /usr/local/bin/rails: No such file or directory

    - by viatropos
    I just ran these two commands: sudo gem install rails --pre sudo gem install railties --pre Now when I run rails myapp, I get this: -bash: /usr/local/bin/rails: No such file or directory Here's some system info: $ ruby -v ruby 1.8.7 (2009-06-12 patchlevel 174) [i686-darwin9.7.0] $ sudo gem update --system Updating RubyGems Nothing to update I tried copy/pasting the bin/rails file into /usr/local/bin/rails, and changing permissions to sudo chmod 755 /usr/local/bin/rails, but that doesn't work. Any ideas how to get up and running?

    Read the article

  • aspNetCompatibility WCF and WinForm

    - by user190084
    I would like to use Windows Forms with a WCF service and leverage the pre-built authentication of asp.net by using aspNetCompatibilityEnabled = true in the WCF service. Is there any module or pre-built assemblies that can add ASP.NET functionality to a Windows Forms application? As far as I understand, this functionality isn't built into Windows Forms and can't be leveraged.

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • problems with chili source code highlighter (mysql)

    - by jason
    I am using Chili source code highlighter it works fine with php source using php as the class. But when i change it to mysql it doesnt highlight any SQL code i also tried sql as the classname, i double checked the recipes' and there is a mysql recipes in there. ... What could i be doing wrong? <pre><code id="code" class="php"></code></pre>

    Read the article

  • how to generate PMK?

    - by sebby_zml
    Hi everyone, I would like to know how can I generate a random pre-master key PMK in java? (related in key exchange and authentication) Is it similar with other randam key generating? What particularly is a pre master key? Thanks, Sebby.

    Read the article

  • Visual C++ preprocessor definitions

    - by alemjerus
    Is there a way to transfer C++ preprocessor definitions into a custom pre-link step procedure call as a command-line parameter or export them into a file any other way? Example: Let's say, I have a c++ project, and in it's Debug configuration I put a preprocessor definition like MAKUMBA_OBA=0x13 Then I add custom pre-link step which executes some javascript like sarahjessicaparker.js /to tomsrhinoplasty $(MAKUMBA_OBA) It would be great, if it just worked, but I never get a third parameter in my js. So the question is: how to pass a preprocessor definition to s script?

    Read the article

  • iPhone HTTP Live Streaming not working on models below 3GS

    - by dreamer
    We are using http live streaming for on demand video from within our iPhone app and on the 3GS models the videos play as they are meant to. However, on the models pre 3GS it gives an error saying this movie format is not supported. I have seen other threads on this however no solutions or insights. Does anyone know if this really is a hardware limitation of the pre 3GS phones or does it have something to do with our code?

    Read the article

  • shell_exec() Doesn't Show The Output

    - by Nathan Campos
    I'm doing a PHP site that uses a shell_exec() function like this: $file = "upload/" . $_FILES["file"]["name"]; $output = shell_exec("leaf $file"); echo "<pre>$output</pre>"; Where leaf is a program that is located in the same directory of my script, but when I tried to run this script on the server, I just got nothing. What is wrong?

    Read the article

  • Difference in DocumentBuilder.parse when using JRE 1.5 and JDK 1.6

    - by dhiller
    Recently at last we have switched our projects to Java 1.6. When executing the tests I found out that using 1.6 a SAXParseException is not thrown which has been thrown using 1.5. Below is my test code to demonstrate the problem. import java.io.StringReader; import javax.xml.parsers.DocumentBuilder; import javax.xml.parsers.DocumentBuilderFactory; import javax.xml.transform.stream.StreamSource; import javax.xml.validation.SchemaFactory; import org.junit.Test; import org.xml.sax.InputSource; import org.xml.sax.SAXParseException; /** * Test class to demonstrate the difference between JDK 1.5 to JDK 1.6. * * Seen on Linux: * * <pre> * #java version "1.6.0_18" * Java(TM) SE Runtime Environment (build 1.6.0_18-b07) * Java HotSpot(TM) Server VM (build 16.0-b13, mixed mode) * </pre> * * Seen on OSX: * * <pre> * java version "1.6.0_17" * Java(TM) SE Runtime Environment (build 1.6.0_17-b04-248-10M3025) * Java HotSpot(TM) 64-Bit Server VM (build 14.3-b01-101, mixed mode) * </pre> * * @author dhiller (creator) * @author $Author$ (last editor) * @version $Revision$ * @since 12.03.2010 11:32:31 */ public class TestXMLValidation { /** * Tests the schema validation of an XML against a simple schema. * * @throws Exception * Falls ein Fehler auftritt * @throws junit.framework.AssertionFailedError * Falls eine Unit-Test-Pruefung fehlschlaegt */ @Test(expected = SAXParseException.class) public void testValidate() throws Exception { final StreamSource schema = new StreamSource( new StringReader( "<?xml version=\"1.0\" encoding=\"UTF-8\"?>" + "<xs:schema xmlns:xs=\"http://www.w3.org/2001/XMLSchema\" " + "elementFormDefault=\"qualified\" xmlns:xsd=\"undefined\">" + "<xs:element name=\"Test\"/>" + "</xs:schema>" ) ); final String xml = "<Test42/>"; final DocumentBuilderFactory newFactory = DocumentBuilderFactory.newInstance(); newFactory.setSchema( SchemaFactory.newInstance( "http://www.w3.org/2001/XMLSchema" ).newSchema( schema ) ); final DocumentBuilder documentBuilder = newFactory.newDocumentBuilder(); documentBuilder.parse( new InputSource( new StringReader( xml ) ) ); } } When using a JVM 1.5 the test passes, on 1.6 it fails with "Expected exception SAXParseException". The Javadoc of the DocumentBuilderFactory.setSchema(Schema) Method says: When errors are found by the validator, the parser is responsible to report them to the user-specified ErrorHandler (or if the error handler is not set, ignore them or throw them), just like any other errors found by the parser itself. In other words, if the user-specified ErrorHandler is set, it must receive those errors, and if not, they must be treated according to the implementation specific default error handling rules. The Javadoc of the DocumentBuilder.parse(InputSource) method says: BTW: I tried setting an error handler via setErrorHandler, but there still is no exception. Now my question: What has changed to 1.6 that prevents the schema validation to throw a SAXParseException? Is it related to the schema or to the xml that I tried to parse?

    Read the article

  • How to avoid my this facebook app api login page?

    - by user1035140
    I got a problem regrading with my apps which is once I go to my apps, it sure will show me a login page instead of allow page? it always display the login page 1st then only display allow page, I had tried other apps, if I am 1st time user, It sure will appear the allow page only, it did not show me the login page. my question is how to I avoid my login page direct go to allow page? here is my login page picture here is my apps link https://apps.facebook.com/christmas_testing/ here is my facebook php jdk api coding <?php $fbconfig['appid' ] = "XXXXXXXXXXXXX"; $fbconfig['secret'] = "XXXXXXXXXXXXX"; $fbconfig['baseUrl'] = "myserverlink"; $fbconfig['appBaseUrl'] = "http://apps.facebook.com/christmas_testing/"; if (isset($_GET['code'])){ header("Location: " . $fbconfig['appBaseUrl']); exit; } if (isset($_GET['request_ids'])){ //user comes from invitation //track them if you need header("Location: " . $fbconfig['appBaseUrl']); } $user = null; //facebook user uid try{ include_once "facebook.php"; } catch(Exception $o){ echo '<pre>'; print_r($o); echo '</pre>'; } // Create our Application instance. $facebook = new Facebook(array( 'appId' => $fbconfig['appid'], 'secret' => $fbconfig['secret'], 'cookie' => true, )); //Facebook Authentication part $user = $facebook->getUser(); $loginUrl = $facebook->getLoginUrl( array( 'scope' => 'email,publish_stream,user_birthday,user_location,user_work_history,user_about_me,user_hometown' ) ); if ($user) { try { // Proceed knowing you have a logged in user who's authenticated. $user_profile = $facebook->api('/me'); } catch (FacebookApiException $e) { //you should use error_log($e); instead of printing the info on browser d($e); // d is a debug function defined at the end of this file $user = null; } } if (!$user) { echo "<script type='text/javascript'>top.location.href = '$loginUrl';</script>"; exit; } //get user basic description $userInfo = $facebook->api("/$user"); function d($d){ echo '<pre>'; print_r($d); echo '</pre>'; } ?

    Read the article

  • Is an editable select box the right way?

    - by Neil Middleton
    I have a scenario where a user is emailing another user in an HTML based web app. For the To: field, the user may select one of a pre-defined list of emails OR enter their own ignoring the pre-defined options. What would be the best way of doing this from a UI point of view? I've looked at editable select boxes using jQuery but none seem to let you enter your own option. Is there some other UI mechanism that would work here?

    Read the article

  • jQuery datepicker calendar - call to function updates database

    - by erbaker
    So I'm using the datepicker plugin to make an availability calendar. Here is my javascript: http://pastebin.com/H7D9PcAg When dpSetSelected() is called it is also calling dateSelected() which triggers the AJAX call to my PHP script. I need a way to only update the database if the date is clicked on and not pre-loaded. When I pre-load the dates they are sent to the PHP page and subsequently removed.

    Read the article

  • Algorithm to suggest a list of tags to users

    - by Itay Moav
    Given a free text, I need to analyse this this text and suggest a list of tags from a pre existing list. What algorithms are out there in the market? Can they handle a case where, for example, the text have a word like high cholesterol and I would like it so suggest heart disease although "high cholesterol" might not exists (initially) in the pre defined list.

    Read the article

  • What's the fastest lookup algorithm for a key, pair data structure (i.e, a map)?

    - by truncheon
    In the following example a std::map structure is filled with 26 values from A - Z (for key) and 0 – 26 for value. The time taken (on my system) to lookup the last entry (10000000 times) is roughly 250 ms for the vector, and 125 ms for the map. (I compiled using release mode, with O3 option turned on for g++ 4.4) But if for some odd reason I wanted better performance than the std::map, what data structures and functions would I need to consider using? I apologize if the answer seems obvious to you, but I haven't had much experience in the performance critical aspects of C++ programming. #include <ctime> #include <map> #include <vector> #include <iostream> struct mystruct { char key; int value; mystruct(char k = 0, int v = 0) : key(k), value(v) { } }; int find(const std::vector<mystruct>& ref, char key) { for (std::vector<mystruct>::const_iterator i = ref.begin(); i != ref.end(); ++i) if (i->key == key) return i->value; return -1; } int main() { std::map<char, int> mymap; std::vector<mystruct> myvec; for (int i = 'a'; i < 'a' + 26; ++i) { mymap[i] = i - 'a'; myvec.push_back(mystruct(i, i - 'a')); } int pre = clock(); for (int i = 0; i < 10000000; ++i) { find(myvec, 'z'); } std::cout << "linear scan: milli " << clock() - pre << "\n"; pre = clock(); for (int i = 0; i < 10000000; ++i) { mymap['z']; } std::cout << "map scan: milli " << clock() - pre << "\n"; return 0; }

    Read the article

< Previous Page | 49 50 51 52 53 54 55 56 57 58 59 60  | Next Page >