Search Results

Search found 35200 results on 1408 pages for 't string'.

Page 539/1408 | < Previous Page | 535 536 537 538 539 540 541 542 543 544 545 546  | Next Page >

  • Ultimate Get/Post with Android Thread for Dummies

    - by Jayomat
    Hi, I'm writing an app to check for the bus timetable's. Therefor I need to post some data to a html page, submit it, and parse the resulting page with htmlparser. Though it may be asked a lot, can some one help me identify if 1) this page does support post/get (I think it does) 2) which fields I need to use? 3) How to make the actual request? this is my code so far: String url = "http://busspur02.aseag.de/bs.exe?Cmd=RV&Karten=true&DatumT=30&DatumM=4&DatumJ=2010&ZeitH=&ZeitM=&Suchen=%28S%29uchen&GT0=&HT0=&GT1=&HT1="; String charset = "CP1252"; System.out.println("startFrom: "+start_from); System.out.println("goTo: "+destination); //String tag.v List<NameValuePair> params = new ArrayList<NameValuePair>(); params.add(new BasicNameValuePair("HTO", start_from)); params.add(new BasicNameValuePair("HT1", destination)); params.add(new BasicNameValuePair("GTO", "Aachen")); params.add(new BasicNameValuePair("GT1", "Aachen")); params.add(new BasicNameValuePair("DatumT", day)); params.add(new BasicNameValuePair("DatumM", month)); params.add(new BasicNameValuePair("DatumJ", year)); params.add(new BasicNameValuePair("ZeitH", hour)); params.add(new BasicNameValuePair("ZeitM", min)); UrlEncodedFormEntity query = new UrlEncodedFormEntity(params, charset); HttpPost post = new HttpPost(url); post.setEntity(query); InputStream response = new DefaultHttpClient().execute(post).getEntity().getContent(); // Now do your thing with the facebook response. String source = readText(response,"CP1252"); Log.d(TAG_AVV,response.toString()); System.out.println("STREAM "+source); One person also gave me a hint to use firebug to read what's going on at the page, but I don't really understand what to look for, or more precisely, how to use the provided information. I also find it confusing, for example, that when I enter the data by hand, the url says, for example, "....HTO=Kaiserplatz&...", but in Firebug, the same Kaiserplatz is connected to a different field, in this case: \<\td class="Start3" Kaiserplatz <\/td (I inserted \ to make it visible) The last line in my code prints the html page, but without having send a request.. it's printed as if there was no input at all... My app is almost done, I hope someone can help me out to finish it! thanks in advance

    Read the article

  • Getting the relative path

    - by Brigadier Jigar
    I have to fetch all the files from a folder and i am using the function GetFiles() like string[] dirImages = Directory.GetFiles(strPathYearImages + intYear , "*.png"); where strPathYearImages="Images\Holiday\2010\" but when i write the whole path like string[] dirImages = Directory.GetFiles(@"E:\IWP\Images\Holiday\"+ intYear , "*.png"); i get the required result. How to solve this problem? I dont want to use the whole path. Help me out. Regards, Jigar <3

    Read the article

  • Generic Property in C#

    - by ml123
    Hi, I'm not quite sure how to do that, but what I would like to do is to create a special type of property that will perform specific tasks at the get and set, and will be defined on generic type. For example, when writing this: MyProp<String name; a pre-defined get and set will be performed on the string value. How can that be done? Thanks!

    Read the article

  • List input and output audio devices in Applet

    - by Jhonny Everson
    I am running a signed applet that needs to provide the ability for the user to select the input and output audio devices ( similar to what skype provides). I borrowed the following code from other thread: import javax.sound.sampled.*; public class SoundAudit { public static void main(String[] args) { try { System.out.println("OS: "+System.getProperty("os.name")+" "+ System.getProperty("os.version")+"/"+ System.getProperty("os.arch")+"\nJava: "+ System.getProperty("java.version")+" ("+ System.getProperty("java.vendor")+")\n"); for (Mixer.Info thisMixerInfo : AudioSystem.getMixerInfo()) { System.out.println("Mixer: "+thisMixerInfo.getDescription()+ " ["+thisMixerInfo.getName()+"]"); Mixer thisMixer = AudioSystem.getMixer(thisMixerInfo); for (Line.Info thisLineInfo:thisMixer.getSourceLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Source Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}} for (Line.Info thisLineInfo:thisMixer.getTargetLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Target Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}}} } catch (Exception e) {e.printStackTrace();}} public static String AnalyzeControl(Control thisControl) { String type = thisControl.getType().toString(); if (thisControl instanceof BooleanControl) { return " Control: "+type+" (boolean)"; } if (thisControl instanceof CompoundControl) { System.out.println(" Control: "+type+ " (compound - values below)"); String toReturn = ""; for (Control children: ((CompoundControl)thisControl).getMemberControls()) { toReturn+=" "+AnalyzeControl(children)+"\n";} return toReturn.substring(0, toReturn.length()-1);} if (thisControl instanceof EnumControl) { return " Control:"+type+" (enum: "+thisControl.toString()+")";} if (thisControl instanceof FloatControl) { return " Control: "+type+" (float: from "+ ((FloatControl) thisControl).getMinimum()+" to "+ ((FloatControl) thisControl).getMaximum()+")";} return " Control: unknown type";} } But what I get: Mixer: Software mixer and synthesizer [Java Sound Audio Engine] Mixer: No details available [Microphone (Pink Front)] I was expecting the get the real list of my devices (My preferences panels shows 3 output devices and 1 Microphone). I am running on Mac OS X 10.6.7. Is there other way to get that info from Java?

    Read the article

  • Flex/Flash 4 datagrid literally displays XML

    - by Setori
    Problem: Flex/Flash4 client (built with FlashBuilder4) displays the xml sent from the server exactly as is - the datagrid keeps the format of the xml. I need the datagrid to parse the input and place the data in the correct rows and columns of the datagrid. flow: click on a date in the tree and it makes a server request for batch information in xml form. Using a CallResponder I then update the datagrid's dataProvider. [code] <fx:Script> <![CDATA[ import mx.controls.Alert; [Bindable]public var selectedTreeNode:XML; public function taskTreeChanged(event:Event):void { selectedTreeNode=Tree(event.target).selectedItem as XML; var searchHubId:String = selectedTreeNode.@hub; var searchDate:String = selectedTreeNode.@lbl; if((searchHubId == "") || (searchDate == "")){ return; } findShipmentBatches(searchDate,searchHubId); } protected function findShipmentBatches(searchDate:String, searchHubId:String):void{ findShipmentBatchesResult.token = actWs.findShipmentBatches(searchDate, searchHubId); } protected function updateBatchDataGridDP():void{ task_list_dg.dataProvider = findShipmentBatchesResult.lastResult; } ]]> </fx:Script> <fx:Declarations> <actws:ActWs id="actWs" fault="Alert.show(event.fault.faultString + '\n' + event.fault.faultDetail)" showBusyCursor="true"/> <s:CallResponder id="findShipmentBatchesResult" result="updateBatchDataGridDP()"/> </fx:Declarations> <mx:AdvancedDataGrid id="task_list_dg" width="100%" height="95%" paddingLeft="0" paddingTop="0" paddingBottom="0"> <mx:columns> <mx:AdvancedDataGridColumn headerText="Receiving date" dataField="rd"/> <mx:AdvancedDataGridColumn headerText="Msg type" dataField="mt"/> <mx:AdvancedDataGridColumn headerText="SSD" dataField="ssd"/> <mx:AdvancedDataGridColumn headerText="Shipping site" dataField="sss"/> <mx:AdvancedDataGridColumn headerText="File name" dataField="fn"/> <mx:AdvancedDataGridColumn headerText="Batch number" dataField="bn"/> </mx:columns> </mx:AdvancedDataGrid> [/code] I cannot upload a pic, but this is the xml: [code] 2010-04-23 16:35:51.0 PRESHIP 2010-02-15 00:00:00.0 100000009 DF-Ocean-PRESHIPSUM-Quanta-PACT-EMEA-Scheduled Ship Date 20100215.csv 10053 [/code] and the xml is pretty much displayed exactly as is in the datagrid columns... I would appreciate your assistance.

    Read the article

  • Question regarding factory pattern

    - by eriks
    I have a factory class to build objects of base class B. The object (D) that uses this factory received a list of strings representing the actual types. What is the correct implementation: the factory receives an Enum (and uses switch inside the Create function) and D is responsible to convert the string to Enum. the factory receives a string and checks for a match to a set of valid strings (using ifs') other implementation i didn't think of.

    Read the article

  • Simplejson dumps char \

    - by Monty
    Hi! Im programming with django and i need to serialize an object to a string, but i need to get the string \/ serialized. An example: simplejson.dumps({'id' : 'root\/leaf'}) I need an output like this: '{"id": "root\/leaf"}' but i get this: '{"id": "root\\\\leaf"}' Thank you!! PD: Sorry for my english :-P

    Read the article

  • Sinatra / Rack fails with non-ascii characters in url

    - by Piotr Zolnierek
    I am getting Encoding::UndefinedConversionError at /find/Wroclaw "\xC5" from ASCII-8BIT to UTF-8 For some mysterious reason sinatra is passing the string as ASCII instead of UTF-8 as it should. I have found some kind of ugly workaround... I don't know why Rack assumes the encoding is ASCII-8BIT ... anyway, a way is to use string.force_encoding("UTF-8")... but doing this for all params is tedious

    Read the article

  • How to get Alfresco login ticket without user password, but with impersonating user with user principal name (UPN)

    - by dok
    I'm writing a DLL that has function for getting Alfresco login ticket without using user password, using only a user principal name (UPN). I’m calling alfresco REST API service /wcservice. I use NTLM in Alfresco. I’m impersonating users using WindowsIdentity constructor as explained here http://msdn.microsoft.com/en-us/library/ms998351.aspx#paght000023_impersonatingbyusingwindowsidentity. I checked and user is properly impersonated (I checked WindowsIdentity.GetCurrent().Name property). After impersonating a user, I try to make HttpWebRequest and set its credentials with CredentialsCache.DefaultNetworkCredentials. I get the error: The remote server returned an error: (401) Unauthorized. at System.Net.HttpWebRequest.GetResponse() When I use new NetworkCredential("username", "P@ssw0rd") to set request credentials, I get Alfresco login ticket (HttpStatusCode.OK, 200). Is there any way that I can get Alfresco login ticket without user password? Here is the code that I'm using: private string GetTicket(string UPN) { WindowsIdentity identity = new WindowsIdentity(UPN); WindowsImpersonationContext context = null; try { context = identity.Impersonate(); MakeWebRequest(); } catch (Exception e) { return e.Message + Environment.NewLine + e.StackTrace; } finally { if (context != null) { context.Undo(); } } } private string MakeWebRequest() { string URI = "http://alfrescoserver/alfresco/wcservice/mg/util/login"; HttpWebRequest request = WebRequest.Create(URI) as HttpWebRequest; request.CookieContainer = new CookieContainer(1); //request.Credentials = new NetworkCredential("username", "p@ssw0rd"); // It works with this request.Credentials = CredentialCache.DefaultNetworkCredentials; // It doesn’t work with this //request.Credentials = CredentialCache.DefaultCredentials; // It doesn’t work with this either try { using (HttpWebResponse response = request.GetResponse() as HttpWebResponse) { StreamReader sr = new StreamReader(response.GetResponseStream()); return sr.ReadToEnd(); } } catch (Exception e) { return (e.Message + Environment.NewLine + e.StackTrace); } } Here are records from Alfresco stdout.log (if it helps in any way): 17:18:04,550 DEBUG [app.servlet.NTLMAuthenticationFilter] Processing request: /alfresco/wcservice/mg/util/login SID:7453F7BD4FD2E6A61AD40A31A37733A5 17:18:04,550 DEBUG [web.scripts.DeclarativeRegistry] Web Script index lookup for uri /mg/util/login took 0.526239ms 17:18:04,550 DEBUG [app.servlet.NTLMAuthenticationFilter] New NTLM auth request from 10.**.**.** (10.**.**.**:1229) 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Processing request: /alfresco/wcservice/mg/util/login SID:7453F7BD4FD2E6A61AD40A31A37733A5 17:18:04,566 DEBUG [web.scripts.DeclarativeRegistry] Web Script index lookup for uri /mg/util/login took 0.400909ms 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Received type1 [Type1:0xe20882b7,Domain:<NotSet>,Wks:<NotSet>] 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Client domain null 17:18:04,675 DEBUG [app.servlet.NTLMAuthenticationFilter] Sending NTLM type2 to client - [Type2:0x80000283,Target:AlfrescoServerA,Ch:197e2631cc3f9e0a]

    Read the article

  • Regex to match 0 - 999 but not blank

    - by James Cadd
    I'm working on a regex to match valid integer numbers such as the following: 0 1 99 999 However it should not allow matching an empty string. The closest I can get is: (0)|\\d{1,3} Which to me says a matching string will have either a zero or a series of digits between 1 and 3 characters long. However, empty strings still appear to match this pattern. What's the proper way to exclude empty strings from this regex?

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • Fractional to Decimal Form.

    - by ThePower
    Hi, there probably isn't an answer to this apart from "Create it yourself", but you never know, there might be some string representation for this. Basically, I would like to display number values as fractional instead of decimal when displaying the values as a string. Instead of a value displaying as: 1.1428571428571428571428571428571 I would prefer it to display as 8/7 Is there any way of doing this without writing the functionality myself? Regards Lloyd

    Read the article

  • usage of try catch

    - by Muhammed Rauf K
    Which is best: Code Snippet 1 or Code Snippet 2 ? And Why? /* Code Snippet 1 * * Write try-catch in function definition */ void Main(string[] args) { AddMe(); } void AddMe() { try { // Do operations... } catch(Exception e) { } } /* Code Snippet 2 * * Write try-catch where we call the function. */ void Main(string[] args) { try { AddMe(); } catch (Exception e) { } } void AddMe() { // Do operations... }

    Read the article

  • How to code a keyboard button to switch between 2 modes?

    - by le.shep20
    Hi! i'm doing a project, i'm not going to details but i will simplify my idea, i'm using Morse Code ( dot and dash) and i have 2 methods: convert_MorseToChar() and Convert_MorseTonum() in the convert_MorseToChar() method there is swich to compare the input from a user which will be Morse codes and mapping it to characters: private String convert_MorseToChar(ref string Ch) { switch (Ch) { Case ".-": MorsetoChar = "a" break; Case "-...": MorsetoChar = "b" break; Case "-.-.": MorsetoChar = "c" break; Case "-..": MorsetoChar = "d" break; Case ".": MorsetoChar = "e" break; } } and the other method Convert_MorseToNum(), ues the SAME combinations of Morse codes but mapping them to numbers: private String Convert_MorseToNum(ref string Ch) { switch (Ch) { Case ".-": MorsetoChar = "1" break; Case "-...": MorsetoChar = "2" break; Case "-.-.": MorsetoChar = "3" break; Case "-..": MorsetoChar = "4" break; Case ".": MorsetoChar = "5" break; } } now the senario is: there are 2 Textbox, one the user will write Morse codes in it and the other is for the output. The user will write dot "." and dash "-" from the keyboard and press Enter then the program will go to ONE of the 2 methods to convert the Morse codes. Now what tells the program where to go to convert?? my question is: I want to create mode key to swich between 2 modes: MorseTochar and MorseToNum. i want the down arrow key to act like a mode, when a user press the down arrow then it the program will be in MorseToChar mode, when ever the user input the program directly use the method convert_MorseToChar to convert to characters. and when the user press the down arrow agian, the prohram will swich to MorseToNum mode here when ever the user input as morsecode, the program will directly use the method Convert_MorseToNum() to convert to numbers. HOW I CAN DO THAT Pleaaaas!!! help me! Please excuse my English, English is not my native language :)

    Read the article

  • How to change default conjunction with Lucene MultiFieldQueryParser

    - by Luke H
    I have some code using Lucene that leaves the default conjunction operator as OR, and I want to change it to AND. Some of the code just uses a plain QueryParser, and that's fine - I can just call setDefaultOperator on those instances. Unfortunately, in one place the code uses a MultiFieldQueryParser, and calls the static "parse" method (taking String, String[], BooleanClause.Occur[], Analyzer), so it seems that setDefaultOperator can't help, because it's an instance method. Is there a way to keep using the same parser but have the default conjunction changed?

    Read the article

  • How do I require that an element has either one set of attributes or another in an XSD schema?

    - by Eli Courtwright
    I'm working with an XML document where a tag must either have one set of attributes or another. For example, it needs to either look like <tag foo="hello" bar="kitty" /> or <tag spam="goodbye" eggs="world" /> e.g. <root> <tag foo="hello" bar="kitty" /> <tag spam="goodbye" eggs="world" /> </root> So I have an XSD schema where I use the xs:choice element to choose between two different attribute groups: <xsi:schema xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema" attributeFormDefault="unqualified" elementFormDefault="qualified"> <xs:element name="root"> <xs:complexType> <xs:sequence> <xs:element maxOccurs="unbounded" name="tag"> <xs:choice> <xs:complexType> <xs:attribute name="foo" type="xs:string" use="required" /> <xs:attribute name="bar" type="xs:string" use="required" /> </xs:complexType> <xs:complexType> <xs:attribute name="spam" type="xs:string" use="required" /> <xs:attribute name="eggs" type="xs:string" use="required" /> </xs:complexType> </xs:choice> </xs:element> </xs:sequence> </xs:complexType> </xs:element> </xsi:schema> However, when using lxml to attempt to load this schema, I get the following error: >>> from lxml import etree >>> etree.XMLSchema( etree.parse("schema_choice.xsd") ) Traceback (most recent call last): File "<stdin>", line 1, in <module> File "xmlschema.pxi", line 85, in lxml.etree.XMLSchema.__init__ (src/lxml/lxml.etree.c:118685) lxml.etree.XMLSchemaParseError: Element '{http://www.w3.org/2001/XMLSchema}element': The content is not valid. Expected is (annotation?, ((simpleType | complexType)?, (unique | key | keyref)*))., line 7 Since the error is with the placement of my xs:choice element, I've tried putting it in different places, but no matter what I try, I can't seem to use it to define a tag to have either one set of attributes (foo and bar) or another (spam and eggs). Is this even possible? And if so, then what is the correct syntax?

    Read the article

  • Regex - find only replace occurences not touching some of them

    - by vittore
    Not very good at regex though and maybe that's a stupid question, I'm given string like "bla @a bla @a1 bla " I'm also pairs like {"a", "a2"} , {"a1", "a13"}, and am to replace @a to @a2 for first pair, and @a1 to @a13 for second one. The problem is when i use string.replace and look for @a , it also replaces @a1 but it should not. Help me with regex replace, please. Cheers

    Read the article

  • Error while creating tests in Visual Studio

    - by Benjol
    When I try to generate a unit test for the following method (in a public static class) private static string[] GetFields(string line, char sep) { char[] totrim = { '"', ' ' }; return line.Split(sep).Select(col => col.Trim(totrim)).ToArray(); } The Tests output says: While trying to generate your tests, the following errors occurred: This method or property cannot be called within an event handler. It works if I make the function public - I've tried running Publicize.exe manually, it doesn't complain, but doesn't make any difference either.

    Read the article

  • MD5 hash with salt for keeping password in DB in C#

    - by abatishchev
    Could you please advise me some easy algorithm for hashing user password by MD5, but with salt for increasing reliability. Now I have this one: private static string GenerateHash(string value) { var data = System.Text.Encoding.ASCII.GetBytes(value); data = System.Security.Cryptography.MD5.Create().ComputeHash(data); return Convert.ToBase64String(data); }

    Read the article

  • JSON is used only for JavaScript?

    - by Bob Smith
    I am storing a JSON string in the database that represents a set of properties. In the code behind, I export it and use it for some custom logic. Essentially, I am using it only as a storage mechanism. I understand XML is better suited for this but I read that JSON is faster and preferred. Is it a good practice to use JSON if the intention is not to use the string on the client side?

    Read the article

  • Endian check in C

    - by webgenius
    Got this code snippet from some website: int num = 1; if(*(char *)&num == 1) { printf("\nLittle-Endian\n"); } else { printf("Big-Endian\n"); } Can anyone explain this step-by-step? &num - Adress of a (char *)&num - Type-cast address of a into a string *(char *)&num - Points to the first character of the string Am I missing anything here?

    Read the article

  • Help with storing/accessing user access roles C# Winforms

    - by user222453
    Hello, firstly I would like to thank you in advance for any assistance provided. I am new to software development and have designed several Client/Server applications over the last 12 months or so, I am currently working on a project that involves a user logging in to gain access to the application and I am looking at the most efficient and "simple" method of storing the users permissions once logged in to the application which can be used throughout restricting access to certain tabs on the main form. I have created a static class called "User" detailed below: static class User { public static int _userID; public static string _moduleName; public static string _userName; public static object[] UserData(object[] _dataRow) { _userID = (int)_dataRow[0]; _userName = (string)_dataRow[1]; _moduleName = (string)_dataRow[2]; return _moduleName; } } When the user logs in and they have been authenticated, I wish to store the _moduleName objects in memory so I can control which tabs on the main form tab control they can access, for example; if the user has been assigned the following roles in the database: "Sales Ledger", "Purchase Ledger" they can only see the relevant tabs on the form, by way of using a Switch - Case block once the login form is hidden and the main form is instantiated. I can store the userID and userName variables in the main form once it loads by means of say for example: Here we process the login data from the user: DataAccess _dal = new DataAccess(); switch (_dal.ValidateLogin(txtUserName.Text, txtPassword.Text)) { case DataAccess.ValidationCode.ConnectionFailed: MessageBox.Show("Database Server Connection Failed!"); break; case DataAccess.ValidationCode .LoginFailed: MessageBox.Show("Login Failed!"); _dal.RecordLogin(out errMsg, txtUserName.Text, workstationID, false); break; case DataAccess.ValidationCode .LoginSucceeded: frmMain frmMain = new frmMain(); _dal.GetUserPrivList(out errMsg,2); //< here I access my DB and get the user permissions based on the current login. frmMain.Show(); this.Hide(); break; default: break; } private void frmMain_Load(object sender, EventArgs e) { int UserID = User._userID; } That works fine, however the _modules object contains mutiple permissions/roles depending on what has been set in the database, how can I store the multiple values and access them via a Switch-Case block? Thank you again in advance.

    Read the article

< Previous Page | 535 536 537 538 539 540 541 542 543 544 545 546  | Next Page >