Search Results

Search found 35200 results on 1408 pages for 't string'.

Page 540/1408 | < Previous Page | 536 537 538 539 540 541 542 543 544 545 546 547  | Next Page >

  • Error while creating tests in Visual Studio

    - by Benjol
    When I try to generate a unit test for the following method (in a public static class) private static string[] GetFields(string line, char sep) { char[] totrim = { '"', ' ' }; return line.Split(sep).Select(col => col.Trim(totrim)).ToArray(); } The Tests output says: While trying to generate your tests, the following errors occurred: This method or property cannot be called within an event handler. It works if I make the function public - I've tried running Publicize.exe manually, it doesn't complain, but doesn't make any difference either.

    Read the article

  • Find items is SSRS by Id

    - by chief7
    How do you find items in SSRS by ID? I tried to use the id returned by another find result, a new guid to string and small random string all of which return the same error: The ID field has a value that is not valid. --- Microsoft.ReportingServices.Diagnostics.Utilities.InvalidElementException: The ID field has a value that is not valid. Here is the code: var request = new FindItemsRequest { Conditions = new[] { new SearchCondition { Name = "ID", Value = "test"} }, Folder = "/" }; return _ssrsService .FindItems(request) .Items I'm using SSRS 2005.

    Read the article

  • Get the type name

    - by Neir0
    How i can get full right name of generic type? For example: This code typeof(List<string>).Name return List`1 instead of List<string> How to get a right name?

    Read the article

  • Html code clearner

    - by Blanca
    Hi! Is there any library or method to input a String with html code, and which has a return value another String whitout this htmlo code, just the information??? I am watching libraries such JTidy, or HtmlParser, but I don't know how to use it! Something easier??? Thank you!

    Read the article

  • Endian check in C

    - by webgenius
    Got this code snippet from some website: int num = 1; if(*(char *)&num == 1) { printf("\nLittle-Endian\n"); } else { printf("Big-Endian\n"); } Can anyone explain this step-by-step? &num - Adress of a (char *)&num - Type-cast address of a into a string *(char *)&num - Points to the first character of the string Am I missing anything here?

    Read the article

  • Regex - find only replace occurences not touching some of them

    - by vittore
    Not very good at regex though and maybe that's a stupid question, I'm given string like "bla @a bla @a1 bla " I'm also pairs like {"a", "a2"} , {"a1", "a13"}, and am to replace @a to @a2 for first pair, and @a1 to @a13 for second one. The problem is when i use string.replace and look for @a , it also replaces @a1 but it should not. Help me with regex replace, please. Cheers

    Read the article

  • regex question: independent position of words

    - by Fuxi
    hi all, is it possible to define a regex pattern which checks eg. for 3 terms independent to their position in the main string? eg. my string is something like "click here to unsubscribe: http://www.url.com" the pattern should also work with "http:// unsubscribe click" thx

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • regex split problem

    - by sunil-mand99
    I have javascript string variable with var sttr="We prefer questions that can be answered --------------------- not just discussed --------------------- Provide details ---------------------------- Write clearly and simply --------------------------answer all the question" please suggest how to split the string into array of sentences on the basis of dashes(-----) using regex result should be array[0]=We prefer questions that can be answered array[1]=not just discussed array[2]=Provide details array[3]=rite clearly and simply array[4]=answer all the question Note: dash(-----) range after each sentence is between 10 to 50

    Read the article

  • ASP.NET MVC BaseController to dynamically set MasterPage file

    - by rockinthesixstring
    I've built a Base Controller that all of my Controllers inherit from, and I've got it setup so that it checks the browser type and returns the appropriate MasterPageFile on the fly. I'm wondering if this is an efficient way to do this or if I should optimize it another way. Public Class BaseController : Inherits System.Web.Mvc.Controller Protected Overrides Function View(ByVal viewName As String, ByVal masterName As String, ByVal model As Object) As System.Web.Mvc.ViewResult If Request.Browser.IsMobileDevice Then Return MyBase.View(viewName, "Mobile", model) Else Return MyBase.View(viewName, "Site", model) End If End Function End Class

    Read the article

  • please help turn a simple Python2 code to PHP

    - by user296516
    Hi guys, Sorry to bother again, but I really need help transforming this Python2 code into PHP. net, cid, lac = 25002, 9164, 4000 import urllib a = '000E00000000000000000000000000001B0000000000000000000000030000' b = hex(cid)[2:].zfill(8) + hex(lac)[2:].zfill(8) c = hex(divmod(net,100)[1])[2:].zfill(8) + hex(divmod(net,100)[0])[2:].zfill(8) string = (a + b + c + 'FFFFFFFF00000000').decode('hex') data = urllib.urlopen('http://www.google.com/glm/mmap',string) r = data.read().encode('hex') print float(int(r[14:22],16))/1000000, float(int(r[22:30],16))/1000000 Would be great if someone could help, thanks in advance!

    Read the article

  • Regular expression to extract text between either square or curly brackets

    - by ObiWanKenobi
    Related to my previous question, I have a string on the following format: this {is} a [sample] string with [some] {special} words. [another one] What is the regular expression to extract the words within either square or curly brackets, ie. {is} [sample] [some] {special} [another one] Note: In my use case, brackets cannot be nested. I would also like to keep the enclosing characters, so that I can tell the difference between them when processing the results.

    Read the article

  • How to make a parameter optional in WSDL?

    - by user305069
    I have a WebService API which needs 2 of its parameters to be optional in the WSDL public wsProxy[] Insert(wsProxy[] proxies, string loginname, string password, bool returnNewData) { //code here } I need to a way to show loginname and password as optional in the WSDL. Is there any way to do this in C#. Can I maybe add an tag in front of the parameters like this [optional]loginname? I have been looking around but haven't been able to find anything so far.

    Read the article

  • How to create a 2D map in Java?

    - by Roman
    I would like to have a mapping which maps two string into one string. For example: map["MainServer","Status"] return "active". What is the best way to do it in Java. Should I use HashMap which include another HashMap as its elements?

    Read the article

  • Help with storing/accessing user access roles C# Winforms

    - by user222453
    Hello, firstly I would like to thank you in advance for any assistance provided. I am new to software development and have designed several Client/Server applications over the last 12 months or so, I am currently working on a project that involves a user logging in to gain access to the application and I am looking at the most efficient and "simple" method of storing the users permissions once logged in to the application which can be used throughout restricting access to certain tabs on the main form. I have created a static class called "User" detailed below: static class User { public static int _userID; public static string _moduleName; public static string _userName; public static object[] UserData(object[] _dataRow) { _userID = (int)_dataRow[0]; _userName = (string)_dataRow[1]; _moduleName = (string)_dataRow[2]; return _moduleName; } } When the user logs in and they have been authenticated, I wish to store the _moduleName objects in memory so I can control which tabs on the main form tab control they can access, for example; if the user has been assigned the following roles in the database: "Sales Ledger", "Purchase Ledger" they can only see the relevant tabs on the form, by way of using a Switch - Case block once the login form is hidden and the main form is instantiated. I can store the userID and userName variables in the main form once it loads by means of say for example: Here we process the login data from the user: DataAccess _dal = new DataAccess(); switch (_dal.ValidateLogin(txtUserName.Text, txtPassword.Text)) { case DataAccess.ValidationCode.ConnectionFailed: MessageBox.Show("Database Server Connection Failed!"); break; case DataAccess.ValidationCode .LoginFailed: MessageBox.Show("Login Failed!"); _dal.RecordLogin(out errMsg, txtUserName.Text, workstationID, false); break; case DataAccess.ValidationCode .LoginSucceeded: frmMain frmMain = new frmMain(); _dal.GetUserPrivList(out errMsg,2); //< here I access my DB and get the user permissions based on the current login. frmMain.Show(); this.Hide(); break; default: break; } private void frmMain_Load(object sender, EventArgs e) { int UserID = User._userID; } That works fine, however the _modules object contains mutiple permissions/roles depending on what has been set in the database, how can I store the multiple values and access them via a Switch-Case block? Thank you again in advance.

    Read the article

  • How can we define more than one table,define columns and write data in xml file ?

    - by Harikrishna
    I am writing my xml file manually. And I am writing that for storing data and retrieving data from that. I have written file like for the table PersonalInfo. <?xml version="1.0" standalone="yes"?> <PersonalInfo> <xs:schema id="PersonalInfo" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="PersonalInfo" msdata:IsDataSet="true" msdata:UseCurrentLocale="true"> <xs:complexType> <xs:choice minOccurs="0" maxOccurs="unbounded"> <xs:element name="PesonalInfo."> <xs:complexType> <xs:sequence> <!--Define Column Here....--> <xs:element name="name" type="xs:string" /> <xs:element name="address" type="xs:string" /> </xs:sequence> </xs:complexType> </xs:element> </xs:choice> </xs:complexType> </xs:element> </xs:schema> <!--First Row--> <PersonalInfo.> <name>Harikrishna</name> <address>India</address> </PersonalInfo.> <!--Second Row--> <PersonalInfo.> <name>Jatin</name> <address>India</address> </PersonalInfo.> </PersonalInfo> Please suggest any mistake with writing file here. And now I want define more than table in this file. And here I have to write data for the table like <PersonalInfo.> <name>Harikrishna</name> <address>India</address> </PersonalInfo.> <PersonalInfo.> <name>Jatin</name> <address>India</address> </PersonalInfo.> Is not possible some thing writing data when defining columns EDIT : <xs:element name="name" type="xs:string",Harikrishna,Jatin.... /> <xs:element name="address" type="xs:string",India,India.... /> And how to define more than one table in a single xml file ?

    Read the article

  • Display html text in uitextview

    - by milanjansari
    Hello, How to display html text in textview for example string <h1>Krupal testing <span style="font-weight: bold;">Customer WYWO</span></h1> Suppose text is bold so it display in textview as bold string but i want display normal text.is this possible in iphone sdk. Thanks you,

    Read the article

  • user creating/saving

    - by Xaver
    i want to write 2 program: 1) programm saves all local users to the file. 2) loads file find that users not found on local machine and create user. for searching all users which create on local machine i use next code: foreach (ManagementObject user in userSearcher.Get()) { if ((bool)user["LocalAccount"]) { string UserName = (string)user["FullName"]; } } How can i save the settings of user by name and create user?

    Read the article

  • Need help for a complex linq query

    - by Jipy
    Ok so I've got a DataTable here's the schema DataTable dt = new DataTable(); dt.Columns.Add("word", typeof(string)); dt.Columns.Add("pronunciation", typeof(string)); The table is filled already and I'm trying to make a linq query so that i can output to the console or anywhere something like : Pronunciation : akses9~R => (list of words) I want to output the pronunciations the most common and all the words that use it.

    Read the article

  • Date arithmetic using integer values

    - by Dave Jarvis
    Problem String concatenation is slowing down a query: date(extract(YEAR FROM m.taken)||'-1-1') d1, date(extract(YEAR FROM m.taken)||'-1-31') d2 This is realized in code as part of a string, which follows (where the p_ variables are integers): date(extract(YEAR FROM m.taken)||''-'||p_month1||'-'||p_day1||''') d1, date(extract(YEAR FROM m.taken)||''-'||p_month2||'-'||p_day2||''') d2 This part of the query runs in 3.2 seconds with the dates, and 1.5 seconds without, leading me to believe there is ample room for improvement. Question What is a better way to create the date (presumably without concatenation)? Many thanks!

    Read the article

  • Error creating bean with name 'sessionFactory'

    - by Sunny Mate
    hi i am getting the following exception while running my application and my applicationContext.xml is <?xml version="1.0" encoding="UTF-8"?> <beans xmlns="http://www.springframework.org/schema/beans" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:p="http://www.springframework.org/schema/p" xsi:schemaLocation="http://www.springframework.org/schema/beans http://www.springframework.org/schema/beans/spring-beans-2.5.xsd"> <bean id="dataSource" class="org.apache.commons.dbcp.BasicDataSource"> <property name="driverClassName" value="com.mysql.jdbc.Driver"> </property> <property name="url" value="jdbc:mysql://localhost/SureshDB"></property> <property name="username" value="root"></property> <property name="password" value="root"></property> </bean> <bean id="sessionFactory" class="org.springframework.orm.hibernate3.LocalSessionFactoryBean"> <property name="dataSource"> <ref bean="dataSource" /> </property> <property name="hibernateProperties"> <props> <prop key="hibernate.dialect"> org.hibernate.dialect.MySQLDialect </prop> </props> </property> <property name="mappingResources"> <list> <value>com/jsfcompref/register/UserTa.hbm.xml</value></list> </property></bean> <bean id="UserTaDAO" class="com.jsfcompref.register.UserTaDAO"> <property name="sessionFactory"> <ref bean="sessionFactory" /> </property> </bean> <bean id="UserTaService" class="com.jsfcompref.register.UserTaServiceImpl"> <property name="userTaDao"> <ref bean="UserTaDAO"/> </property> </bean> </beans> Error creating bean with name 'sessionFactory' defined in class path resource [applicationContext.xml]: Invocation of init method failed; nested exception is java.lang.NoSuchMethodError: org.objectweb.asm.ClassVisitor.visit(IILjava/lang/String;Ljava/lang/String;[Ljava/lang/String;Ljava/lang/String;)V any suggestion would be heplful

    Read the article

  • Visual Studio Add in.

    - by Eric Brown - Cal
    I was looking to write/get a visual studio add in. I want to be able to write descriptive log calls at the top and bottom of a function. like this log.debug("TheClass.TheMethod(string TheStringParam ="+TheStringParam+") - in"); log.debug("TheClass.TheMethod(string TheStringParam ="+TheStringParam+") - out"); Is there an adin that does this? Is there source anywhere for an add in like Ghost Doc that does reflection(or whatever) to parse the parameters and such? Thanks, Eric-

    Read the article

  • Is it possible to route a Webmethod?

    - by Philip
    I have a .aspx page with some Webmethods that I use for jQuery ajax calls. [WebMethod] public static string HelloWorld(string s) { return "Hello"+ s; } And call this with Url: /ajax/Test.aspx/HelloWorld I wonder if it is possible to route this method to another url like /ajax/helloworld/?

    Read the article

< Previous Page | 536 537 538 539 540 541 542 543 544 545 546 547  | Next Page >