Search Results

Search found 17194 results on 688 pages for 'document databases'.

Page 542/688 | < Previous Page | 538 539 540 541 542 543 544 545 546 547 548 549  | Next Page >

  • Remote search system for samba shares

    - by fostandy
    I have several shares residing on a samba server in a small business environment that I would like to provide search facilities for. Ideally this would be something like google desktop with some extra features (see below), but lacking this the idea is to take what I can get, or at least get an idea for what is out there. Using google desktop search as a reference model, the principle additional requirement is that it is usable from clients over the network. In addition there are some other notes (note that none of these are hard requirements) The content is always files, residing on a single server, accessible from samba shares. Standard ms office document fare Also a lot of rars and zips which it is necessary to search inside. Permissions support, allowing for user-based control to reflect current permission access in samba shares. The userbase will remain fairly static, so manual management of users is fine. majority of users will be Windows based I know there are plenty of search indexers out there: beagle and tracker seem to be the most popular. Most do not seem to offer access control and web-based/remote search does not seem to be high priority. I've also seen a recent post on the samba mailing list asking for pretty much the exact same thing. (They mention a product called IBM OmniFind Yahoo! Edition and while their initial reception seems positive, I am pretty skeptical. RHEL 4? Firefox 2? Updated much?) What else is out there? Are you in a similar situation? What do you use?

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • IIS 7.5 / Windows 7: Error 500.19, error code 0x800700b7

    - by nikhiljoshi
    I have been trying to resolve this issue. I am using Windows 7 and VS2008 +iis7.5. My project is stuck because of this error. The error says: Error Summary HTTP Error 500.19 - Internal Server Error The requested page cannot be accessed because the related configuration data for the page is invalid. `Detailed Error Information Module IIS Web Core Notification BeginRequest Handler Not yet determined Error Code 0x800700b7 Config Error There is a duplicate 'system.web.extensions/scripting/scriptResourceHandler' section defined Config File \\?\C:\inetpub\wwwroot\test23\web.config Requested URL http://localhost:80/test23 Physical Path C:\inetpub\wwwroot\test23 Logon Method Not yet determined Logon User Not yet determined Config Source 15: <sectionGroup name="scripting" type="System.Web.Configuration.ScriptingSectionGroup, System.Web.Extensions, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35"> 16: <section name="scriptResourceHandler" type="System.Web.Configuration.ScriptingScriptResourceHandlerSection, System.Web.Extensions, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35" requirePermission="false" allowDefinition="MachineToApplication"/> 17: <sectionGroup name="webServices" type="System.Web.Configuration.ScriptingWebServicesSectionGroup, System.Web.Extensions, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35"> ` I followed the instructions in this Microsoft solution document, but it didn't help. http://support.microsoft.com/kb/942055

    Read the article

  • Change the Default Date setting in Word 2010

    - by Chris
    I am using Word 2010 and Windows 7. You know how when you start typing a date in Word it will automatically suggest what it thinks you want? Like if I start typing “6/29”, a little grey bubble will display “6/29/13 (Press ENTER to Insert)”. How do I get it so the bubble will display the year in a 4 digit format, such as "6/29/2013 (Press Enter to Insert)"? The below picture is how it looks when typing a date into Word. I have already gone to the Date & Time option under the Insert menu and the date format that I want is already selected. I think this is only for using quickparts anyway, so the date automatically updates when you open a document. The Region and Language settings under the Control Panel are correct as well. I thought at one point I found it somewhere under options, but I am sure I looked through everything many times and I can’t find it. I posted this exact question at the Microsoft website and someone replied: Go to the Windows Control Panel and click on Clock, Language and Region and then on Change the date, time, or number format and then modify the Short date format so that it is what you want to be used. So please don't suggest this again, because in my question I did say that I already tried this and it doesn't work, at least not for Word, in this situation. Thanks.

    Read the article

  • Software for handling camera RAW-files

    - by Eikern
    I use a digital SLR as most other photographers do today and have quickly realised that capturing images using camera-RAW files is the way to go. Personally I use Adobe Lightroom to handle my photo library, but I know there are other software available like Apple Aperture. These applications are quite hard to use for a novice, and are quite expensive too. I've often recommended other photographers to switch to camera-raw, but they won't do it because Windows can't handle it natively. Are there any free or cheaper applications out there that can do simple file handling and adjustments? Preferably so simple that my mom can do it. I know Nikon offers a codec that allows you to view NEF-files natively inside Windows, but still limits the uses of the file and slows the system down if the file is big. Does anybody know of a drag-and-drop application that converts camera-raw to JPG on-the-fly? In case I or someone would need to upload an image to the web or use it inside a word-document. Thanks.

    Read the article

  • Pasting formatted Excel range into Outlook message

    - by Steph
    Hi everyone, I am using Office 2007 and I would like to use VBA to paste a range of formatted Excel cells into an Outlook message and then mail the message. In the following code (that I lifted from various sources), it runs without error and then sends an empty message... the paste does not work. Can anyone see the problem and better yet, help with a solution? Thanks, -Steph Sub SendMessage(SubjectText As String, Importance As OlImportance) Dim objOutlook As Outlook.Application Dim objOutlookMsg As Outlook.MailItem Dim objOutlookRecip As Outlook.Recipient Dim objOutlookAttach As Outlook.Attachment Dim iAddr As Integer, Col As Integer, SendLink As Boolean 'Dim Doc As Word.Document, wdRn As Word.Range Dim Doc As Object, wdRn As Object ' Create the Outlook session. Set objOutlook = CreateObject("Outlook.Application") ' Create the message. Set objOutlookMsg = objOutlook.CreateItem(olMailItem) Set Doc = objOutlookMsg.GetInspector.WordEditor 'Set Doc = objOutlookMsg.ActiveInspector.WordEditor Set wdRn = Doc.Range wdRn.Paste Set objOutlookRecip = objOutlookMsg.Recipients.Add("[email protected]") objOutlookRecip.Type = 1 objOutlookMsg.Subject = SubjectText objOutlookMsg.Importance = Importance With objOutlookMsg For Each objOutlookRecip In .Recipients objOutlookRecip.Resolve ' Set the Subject, Body, and Importance of the message. '.Subject = "Coverage Requests" 'objDrafts.GetFromClipboard Next .Send End With Set objOutlookMsg = Nothing Set objOutlook = Nothing End Sub

    Read the article

  • What would keep a Microsoft Word AutoNew() macro from running?

    - by Chris Nelson
    I'm using Microsoft Office 2003 and creating a bunch of template documents to standardize some tasks. I know it's standard practice to put the templates in an certain place Office expects to find them but that won't work for me. What I want is to have "My Template Foo.dot" and "My Template Bar.dot", etc. in the "My Foo Bar Stuff" on a shared drive and users will double click on the template to create a new Foo or Bar. What's I'd really like is for the user to double click on the Foo template and be prompted for a couple of items related to their task (e.g., a project number) and have a script in the template change the name that Save will default to something like "Foo for Project 1234.doc". I asked on Google Groups and got an answer that worked....for a while. Then my AutoNew macro stopped kicking in when I created a new document by double clicking on the template. I have no idea why or how to debug it. I'm a software engineering with 25+ years of experience but a complete Office automation noob. Specific solutions and pointers to "this is how to automate Word" FAQs are welcome. Thanks.

    Read the article

  • Workstations cannot see new MS Server 2008 domain, but can access DHCP.

    - by Radix
    The XP Pro workstations do not see the new replacement domain upon boot; they only see their cached entry for the old (server 2003) domain controller. The old_server is not connected to the network. I have DHCP working with the same scope as the old_server. In my "before-asking" search for a solution I came across the following two articles, and I recall doing things as suggested by the articles. http://www.windowsreference.com/windows-server-2008/how-to-setup-dhcp-server-in-windows-server-2008-step-by-step-guide/ http://www.windowsreference.com/windows-server-2008/step-by-step-guide-for-windows-server-2008-domain-controller-and-dns-server-setup/ The only possible issue is: I was under the impression that the domain netbios needed to match the DC's netbios. The DC netbios is city01 while the domain's FQDN is city.domain.org (I think this is mistaken and should have been just domain.org) But, the second link led me to a post which I believe answers my question. I did as they instructed by opening Local Area Connection Properties, then selecting TCP/IPv4 and setting the sole preferred DNS server to the local hosts static IP (10.10.1.1). Search for "Your problems should clear up" for the post I'm referencing: http://forums.techarena.in/active-directory/1032797.htm Have I misunderstood their instructions? I am hoping to reach the point where I can define users and user groups. Also, does TechNet have a single theoretical overview document I could read. I really don't like treating comps as magic. I will be watching this closely and will quickly answer any questions. If I've left anything out it is because I did not know it was needed. PS: I am loath to ask obviously basic questions, but I am tired and wish to fix this before tomorrow. Also, this is my first server installation, thank you for your help.

    Read the article

  • Apple Service Diagnostic application on USB key?

    - by Matt 'Trouble' Esse
    I found the following in a text file, and I would like to use the Apple Service Diagnostic Application from a bootable USB key but I cannot find where to download it or set it up? Also is this free software or does it require a separate licence? It sounds like it would be a useful tool for diagnosing Mac problems. The Apple Service Diagnostic application is designed to run both EFI and Mac OS X tests from an external USB hard drive. Apple Service Diagnostic (EFI) runs low-level tests of the hardware directly and does not require Mac OS X, while Apple Service Diagnostic (OS) uses Mac OS X to run tests. Booting and Using the Apple Service Diagnostic Application - Before using Apple Service Diagnostic, disconnect any Ethernet network, USB, and audio cables. - With the USB hard drive containing ASD 3S123 plugged into a USB port, restart the computer and hold down the option key as the computer boots up into the Startup Manager. To run ASD (EFI) select the "ASD EFI 3S123" drive icon and press return or select it with a mouse click. To run ASD (OS) select the "ASD OS 3S123" drive icon and press return or select it with a mouse click. ASD (EFI) will load in 20-30 seconds; ASD (OS) will load in 2-3 minutes. - After running ASD (OS) or ASD (EFI), press the Restart button to restart the computer back into the normal startup volume, or hold down the option key to get back to the Startup Manager. ASD is no longer delivered as an image to be restored onto a DVD. ASD 3S117 and newer versions requires installation onto an external USB hard drive. For more information, please refer to the document "Installing ASD on a USB hard drive".

    Read the article

  • Apache2 with lighttpd as proxy

    - by andrzejp
    Hi, I am using apache2 as web server. I would like to help him lighttpd as a proxy for static content. Unfortunately I can not well set up lighttpd and apache2. (OS: Debian) Important things from lighttpd.config: server.modules = ( "mod_access", "mod_alias", "mod_accesslog", "mod_proxy", "mod_status", ) server.document-root = "/www/" server.port = 82 server.bind = "localhost" $HTTP["remoteip"] =~ "127.0.0.1" { alias.url += ( "/doc/" => "/usr/share/doc/", "/images/" => "/usr/share/images/" ) $HTTP["url"] =~ "^/doc/|^/images/" { dir-listing.activate = "enable" } } I would like to use lighttpd in only one site operating as a virtual directory on apache2. Configuration of this virtual directory: ProxyRequests Off ProxyPreserveHost On ProxyPass /images http://0.0.0.0:82/ ProxyPass /imagehosting http://0.0.0.0:82/ ProxyPass /pictures http://0.0.0.0:82/ ProxyPassReverse / http://0.0.0.0:82/ ServerName MY_VALUES ServerAlias www.MY_VALUES UseCanonicalName Off DocumentRoot /www/MYAPP/forum <Directory "/www/MYAPP/forum"> DirectoryIndex index.htm index.php AllowOverride None ... As you can see (or not;)) my service is physically located at the path: / www / myapp / forum and I would like to support lighttpd dealt with folders: / www / myapp / forum / images / www / myapp / forum / imagehosting / www / myapp / forum / pictures and left the rest (PHP scripts) for apache After running lighttpd and apache2 working party, but did not show up any images of these locations. What is wrong?

    Read the article

  • How this could happen to my ftp server?

    - by srisar
    hi, again me, i just dont get why i m getting this message, when i try to connect my ftp server thorugh my wan address (112.135.26.115) its saying me, 530 user access denied but when i give the same data to http://ftptest.net the result is as follows... Status: Resolving address of 112.135.26.115 Status: Connecting to 112.135.26.115 Status: Connected, waiting for welcome message Reply: 220-FileZilla Server version 0.9.34 beta Reply: 220-written by Tim Kosse ([email protected]) Reply: 220 Please visit http://sourceforge.net/projects/filezilla/ Status: CLNT http://ftptest.net on behalf of 112.135.26.115 Reply: 200 Don't care Status: USER saravana Reply: 331 Password required for saravana Status: PASS ********* Reply: 230 Logged on Status: SYST Reply: 215 UNIX emulated by FileZilla Status: FEAT Reply: 211-Features: Reply: MDTM Reply: REST STREAM Reply: SIZE Reply: MLST type*;size*;modify*; Reply: MLSD Reply: AUTH SSL Reply: AUTH TLS Reply: UTF8 Reply: CLNT Reply: MFMT Reply: 211 End Status: PWD Reply: 257 "/" is current directory. Status: Current path is / Status: TYPE I Reply: 200 Type set to I Status: PASV Reply: 227 Entering Passive Mode (112,135,26,115,43,9) Status: MLSD Reply: 150 Connection accepted Listing: type=dir;modify=20100322113235; it_is_working!_Andrejs_Cainikovs_from_serverfault.com Listing: type=file;modify=20100322110559;size=5; New Text Document.txt Reply: 226 Transfer OK Status: Success can anyone say why this happens to me? please im trying the whole day!!

    Read the article

  • How do I get a subdomain on Xampp Apache @ localhost?

    - by jasondavis
    **UPDATE- I got it working now, I just had to change to The port number is important here. I just modified my windows HOST file @ C:\Windows\System32\drivers\etc and added this to the end of it 127.0.0.1 images.localhost 127.0.0.1 w-w-w.friendproject-.com 127.0.0.1 friendproject.-com Then I modified my httpd-vhosts.conf file on Apache under Xampp @ C:\webserver\apache\conf\extra Under the part where it shows examples for adding virtualhost I added this code below: NameVirtualHost *:80 <VirtualHost *:80> DocumentRoot /htdocs/images/ ServerName images.localhost </VirtualHost> <VirtualHost *:80> DocumentRoot /htdocs/ ServerName friendproject.com/ </VirtualHost> <VirtualHost *:80> DocumentRoot /htdocs/ ServerName w-ww-.friendproject.c-om/ </VirtualHost> Now the problem is when I go to any of the newly added domains in the browser I get this error below and even worse news is I now get this error even when going to http://localhost/ which worked fine before doing this I realize I can change everything back but I really need to at least get htt-p://im-ages.localhost to work. What do I do? Access forbidden! You don't have permission to access the requested directory. There is either no index document or the directory is read-protected. If you think this is a server error, please contact the webmaster . Error 403 localhost 07/25/09 21:20:14 Apache/2.2.11 (Win32) DAV/2 mod_ssl/2.2.11 OpenSSL/0.9.8i PHP/5.2.9

    Read the article

  • When to use Truecrypt, and when not to?

    - by tm77
    I have about 30 (this number will most likely grow over the next few years to 50 or more) unencrypted laptops that I have been tasked to encrypt (entire drive). These machines will be used off site regularly by my users. These machines are running Windows 7 and XP (about 50/50), but more Windows 7 every month. I have experience with Truecrypt, and have had no issues. It appears to be THE solution for a free solution. My concern with Truecrypt is that my users will have 2 passswords needed to login to their machines. Also, I need to choose to either have 1 password for my organization, or carefully document each machine's password (management nightmare). In my mind, choosing between a managed and a free encryption solution is primarily based on the NUMBER of machines that will be encrypted and supported. Two questions: From a management standpoint, what is the tipping point of users where a managed solution would pay for itself over Truecrypt? What are some good third party solutions? (I will consider Bitlocker, but the price to upgrade Windows 7 licenses is a turn-off) I would love to hear from some admins with experience in supporting encrypted machines in a corporate environment. Many thanks in advance!

    Read the article

  • Can not copy files from NTFS partition

    - by Ali
    I am experiencing a weird problem. I was running Xubuntu on my laptop until yesterday that I had to delete Xubuntu and install Windows. I had a NTFS partition on my Xubuntu that I kept some files on it. Today after installing windows I wanted to move all the files from that partition to an external HDD. I selected all files and folders and clicked on Copy, then I went to the HDD and clicked on paste but nothing happened. I can not do that. I do not know why. I copy the files, and wherever I click paste, nothing happens. If I try to copy the files and folders one by one, I can copy some of them, but some of them do not move. The other problem I have is that I can not open some files, in particular pdf files. When I click on pdf files I get this error: There was an error opening this document. This file cannot be found. Also, I cannot play some mp4 files. I can not open some jpg and txt files. I get this error The directory name is invalid. So in summary, after removing Xubuntu and installing windows 7 I have the following problems with one of the NTFS partitions on my internal drive: Can not copy or cut all folders and files from that partition to any other partition - I also do not get any errors. Can copy some folders and files Can not access some pdf, jpeg, txt and mp4 files and get the above errors. I should also mention I did not change anything for this partition during the installation or formatting the other partitions.

    Read the article

  • Dynamic virtual host configuration in Apache

    - by Kostas Andrianopoulos
    I want to make a virtual host in Apache with dynamic configuration for my websites. For example something like this would be perfect. <VirtualHost *:80> AssignUserId $domain webspaces ServerName $subdomain.$domain.$tld ServerAdmin admin@$domain.$tld DocumentRoot "/home/webspaces/$domain.$tld/subdomains/$subdomain" <Directory "/home/webspaces/$domain.$tld/subdomains/$subdomain"> .... </Directory> php_admin_value open_basedir "/tmp/:/usr/share/pear/:/home/webspaces/$domain.$tld/subdomains/$subdomain" </VirtualHost> $subdomain, $domain, $tld would be extracted from the HTTP_HOST variable using regex at request time. No more loads of configuration, no more apache reloading every x minutes, no more stupid logic. Notice that I use mpm-itk (AssignUserId directive) so each virtual host runs as a different user. I do not intend to change this part. Since now I have tried: - mod_vhost_alias but this allows dynamic configuration of only the document root. - mod_macro but this still requires the arguments of the vhost to be declared explicitly for each vhost. - I have read about mod_vhs and other modules which store configuration in a SQL or LDAP server which is not acceptable as there is no need for configuration! Those 3 necessary arguments can be generated at runtime. - I have seen some Perl suggestions like this, but as the author states $s->add_config would add a directive after every request, thus leading to a memory leak, and $r->add_config seems not to be a feasible solution.

    Read the article

  • Mystery Print Separator Page

    - by Jesse Bradlee
    Good morning! After a recent site upgrade to WebSphere 7.0 from 6.1 on an AIX server, our users reported a print separator page appearing on a certain type of report, and only on one printer. Trouble is, no one (devs, sysadmins, users) knows where it came from or where to turn it off. Based on the info, the first step was to check the app, but we don't have print separators in our code. The report they're using also lacks even an option to separate. Then I asked the WebSphere gurus but they shook their heads. Ditto the network/print server team. If anyone can identify the source of this separator, I can take that back to the relevant team and have it switched off. They look like this (some whitespace removed for brevity): *################################################## *################################################## *################################################## *************************************************** TITLE: [document name] TIME PRINTED: Fri Sep 20 08:21:45 2013 TIME QUEUED: Fri Sep 20 08:21:45 2013 PRINTED AT: hp@hp41 (generic) @ [app name] SUBMITTED BY: root DELIVER TO: =====> root <===== *************************************************** FLAG VALUES: a-0, b=0, d=a, f=, g=1, h=, i=0, j=+, l=00, p=10, t=0, v=6, w=3--, x=2, A=1, B=gn, C=!, H=, J=+, L=+, N=1, P=[printer name]:hp@hp41, X=ISO8859-1, Z=+, 0=ibm.850 *************************************************** Thank you!

    Read the article

  • Which linux distributions offer seamless support for UEFI and an LVM root out of the box?

    - by Jannik Jochem
    My new ultrabook (an Asus UX32VD) requires UEFI in order to boot from the internal harddisk. I use an LVM partition which contains my root fs and dual-boot Windows 8. I somehow managed to get this working on Sabayon Linux, however the overall process was pretty painful, and system upgrades keep breaking my configuration because everything depends on a hand-configured kernel and a hand-crafted GRUB2 configuration. This causes a lot of hassle and distractions for me, so I am considering to switch to a different distribution. However, I cannot find any concrete resources that precisely document the state of UEFI support in the popular distributions. As an example, the length of the Ubuntu wiki page on UEFI suggests that installing on UEFI systems is a non-trivial process, and this AskUbuntu thread on encrypted LVM on UEFI systems suggests that LVM might also be a problem. I know that this question seems somewhat open-ended, so I'll formulate concrete questions: Are there any Linux distributions with an installer that supports installing to an LVM root in a UEFI boot setting where Windows 8 is dual-booted? Which distributions support UEFI without having to jump through hoops in order to bootstrap into a UEFI-booted system or requiring manual configuration of the boot manager?

    Read the article

  • Apache wont start after attempting to install SSL

    - by yummm
    Below is what my VirtualHosts look like in httpd.conf <VirtualHost *:80> # Admin email, Server Name (domain name) and any aliases ServerAdmin [email protected] ServerName mydomain.com ServerAlias www.mydomain.com # Index file and Document Root (where the public files are located) DirectoryIndex index.php DocumentRoot /home/mydomain/public_html/mydomain.com/public # Custom log file locations LogLevel warn ErrorLog /home/mydomain/public_html/mydomain.com/log/error.log CustomLog /home/mydomain/public_html/mydomain.com/log/access.log combined </VirtualHost> <VirtualHost *:443> SSLEngine on SSLCertificateFile /etc/httpd/conf/ssl.crt/mydomain.com.crt SSLCertificateKeyFile /etc/httpd/conf/ssl.key/mydomain.com.key ServerName mydomain.com DirectoryIndex index.php DocumentRoot /home/mydomain/public_html/mydomain.com/public </VirtualHost> I'm using the latest version of Apache on CentOS and there isn't any error being generated. Apache just will not start. Any ideas what I'm doing wrong? UPDATE - Found these messages in the error log: [Tue Mar 16 02:07:57 2010] [error] Init: Private key not found [Tue Mar 16 02:07:57 2010] [error] SSL Library Error: 218710120 error:0D094068:asn1 encoding routines:d2i_ASN1_SET:bad tag [Tue Mar 16 02:07:57 2010] [error] SSL Library Error: 218529960 error:0D0680A8:asn1 encoding routines:ASN1_CHECK_TLEN:wrong tag [Tue Mar 16 02:07:57 2010] [error] SSL Library Error: 218595386 error:0D07803A:asn1 encoding routines:ASN1_ITEM_EX_D2I:nested asn1 error [Tue Mar 16 02:07:57 2010] [error] SSL Library Error: 218734605 error:0D09A00D:asn1 encoding routines:d2i_PrivateKey:ASN1 lib

    Read the article

  • ServerName not working in Apache2 and Ubuntu

    - by CreativeNotice
    Setting up a dev LAMP server and I wish to allow dynamic subdomains, aka ted.servername.com, bob.servername.com. Here's my sites-active file <VirtualHost *:80> # Admin Email, Server Name, Aliases ServerAdmin [email protected] ServerName happyslice.net ServerAlias *.happyslice.net # Index file and Document Root DirectoryIndex index.html DocumentRoot /home/sysadmin/public_html/happyslice.net/public # Custom Log file locations LogLevel warn ErrorLog /home/sysadmin/public_html/happyslice.net/log/error.log CustomLog /home/sysadmin/public_html/happyslice.net/log/access.log combined And here's the output from sudo apache2ctl -S VirtualHost configuration: wildcard NameVirtualHosts and default servers: *:80 is a NameVirtualHost default server happyslice.net (/etc/apache2/sites-enabled/000-default:1) port 80 namevhost happyslice.net (/etc/apache2/sites-enabled/000-default:1) port 80 namevhost happyslice.net (/etc/apache2/sites-enabled/happyslice.net:5) Syntax OK The server hostname is srv.happyslice.net. As you can see from apache2ctl when I use happyslice.net I get the default virtual host, when I use a subdomain, I get the happyslice.net host. So the later is working how I want, but the main url does not. I've tried all kinds of variations here, but it appears that ServerName just isn't being tied to the correct location. Thoughts? I'm stumped. FYI, I'm running Apache2.1 and Ubuntu 10.04 LTS

    Read the article

  • Re-configure Office 2007 installation unattended: Advertised components --> Local

    - by abstrask
    On our Citrix farm, I just found out that some sub-components are "Installed on 1st Use" (Advertised), which does play well on terminal servers. Not only that, but you also get a rather non-descriptive error message, when a document tried to use a component, which is "Installed on 1st Use" (described on Plan to deploy Office 2010 in a Remote Desktop Services environment): Microsoft Office cannot run this add-in. An error occurred and this feature is no longer functioning correctly. Please contact your system administrator. I have ~50 Citrix servers where I need to change the installation state of all Advertised components to Local, so I created an XML file like this: <?xml version="1.0" encoding="utf-8"?> <Configuration Product="ProPlus"> <Display Level="none" CompletionNotice="no" SuppressModal="yes" AcceptEula="yes" /> <Logging Type="standard" Path="C:\InstallLogs" Template="MS Office 2007 Install on 1st Use(*).log" /> <Option Id="AccessWizards" State="Local" /> <Option Id="DeveloperWizards" State="Local" /> <Setting Id="Reboot" Value="NEVER" /> </Configuration> I run it with a command like this (using the appropriate paths): "[..]\setup.exe" /config ProPlus /config "[..]\Install1stUse-to-Forced.xml" According to the log file, the syntax appears to be accepted and the config file parsed: Parsing command line. Config XML file specified: [..]\Install1stUse-to-Forced.xml Modify requested for product: PROPLUS Parsing config.xml at: [..]\Install1stUse-to-Forced.xml Preferred product specified in config.xml to be: PROPLUS But the "Final Option Tree" still reads: Final Option Tree: AlwaysInstalled:local Gimme_OnDemandData:local ProductFiles:local VSCommonPIAHidden:local dummy_MSCOMCTL_PIA:local dummy_Office_PIA:local ACCESSFiles:local ... AccessWizards:advertised DeveloperWizards:advertised ... And the components remain "Advertised". Just to see if the installation state is overridden in another XML file, I ran: findstr /l /s /i "AccessWizards" *.xml Against both my installation source and "%ProgramFiles%\Common Files\Microsoft Shared\OFFICE12\Office Setup Controller", but just found DefaultState to be "Local". What am I doing wrong? Thanks!

    Read the article

  • Basic multicast network performance problems

    - by davedavedave
    I've been using mpong from 29west's mtools package to get some basic idea of multicast latency across various Cisco switches: 1Gb 2960G, 10Gb 4900M and 10Gb Nexus N5548P. The 1Gb is just for comparison. I have the following results for ~400 runs of mpong on each switch (sending 65536 "ping"-like messages to a receiver which then sends back -- all over multicast). Numbers are latencies measured in microseconds. Switch Average StdDev Min Max 2960 (1Gb) 109.68463 0.092816 109.4328 109.9464 4900M (10Gb) 705.52359 1.607976 703.7693 722.1514 NX 5548(10Gb) 58.563774 0.328242 57.77603 59.32207 The result for 4900M is very surprising. I've tried unicast ping and I see the 4900 has ~10us higher latency than the N5548P (average 73us vs 64us). Iperf (with no attempt to tune it) shows both 10Gb switches give me 9.4Gbps line speed. The two machines are connected to the same switch and we're not doing any multicast routing. OS is RHEL 6. 10Gb NICs are HP 10GbE PCI-E G2 Dual-port NICs (I believe they are rebranded Mellanox cards). The 4900 switch is used in a project with tight access control so I'm waiting for approval before I can access it and check the config. The other two I have full access to configure. I've looked at the Cisco document[2] detailing differences between NX-OS and IOS w.r.t multicast so I've got some ideas to try out but this isn't an area where I have much expertise. Does anyone have any idea what I should be looking at once I get access to the switch? [1] http://docwiki.cisco.com/wiki/Cisco_NX-OS/IOS_Multicast_Comparison

    Read the article

  • IIS 7 - 403 Access Denied error on wwwroot trying to redirect to /owa

    - by cparker4486
    I'm trying to setup a redirect from http://mail.mydomain.com to https://mail.mydomain.com/owa. I've been unsuccessful in doing this by using IIS's HTTP Redirect so I looked to other options. The one I settled on is to create a default document in the wwwroot folder to handle the redirect. I created a file called index.aspx (and added index.aspx to the list of default documents) and put the following code in it: <script runat="server"> private void Page_Load(object sender, System.EventArgs e) { Response.Status = "301 Moved Permanently"; Response.AddHeader("Location","https://mail.mydomain.com/owa"); } </script> Instead of getting a redirect I get: 403 - Forbidden: Access is denied. You do not have permission to view this directory or page using the credentials that you supplied. I've been trying to find an answer to this but have been unsuccessful so far. One thing I did try was to add the Everyone group to wwwroot with read access. No change. The AppPool for Default Web Site is DefaultAppPool and the Identity is ApplicationPoolIdentity. (I don't know what these things are but maybe knowing this will help you.) Thanks!

    Read the article

  • Remote desktop connection to network printer

    - by andand
    I'm trying to print a document from a remote WinXP machine to a network printer I use on a local Win7 machine using Remote Desktop. The network printer does not appear in the list of those available on the WinXP box. In more detail, the local machine runs Windows 7 (no admin rights) and connects to a network printer managed by a print server (i.e. not using a local TCP/IP Port). I have access to a Windows XP host on a separate network which I access using Remote Desktop. I would like to have print requests from the remote XP box forwarded to the network printer I use on the Windows 7 machine. The XP machine cannot access the print server I use on the Win7 machine nor can it create a TCP/IP port to connect directly to the printer (network configuration issues). After having consulting the KB312135 I confirmed the "Printers" option was selected in the Remote Desktop Client, Local Resources Tab, yet the network printer does not appear on the list of available printers on the XP box. Is this a lost cause or is there something else I haven't managed to locate yet?

    Read the article

  • Graphic Design in Outlook HTML Emails

    - by PhilPursglove
    At the moment we are creating artwork in Word and saving it as an HTML file. Opening up a new email, clicking insert on menuclicking ‘File’Selecting HTML file and choosing insert as text. The word document is then embedded into the email and we can create HTML links from there. The problem with this method is we are limited to what we can create visually in Word. The artwork just does not look professional enough and we find that sometimes the headers or footers do not appear or do not stay in their correct position. What I would like to do is to be able to start in Adobe InDesign (the graphics package we use). So far I have been able to create artwork in InDesign and create buttons and hyperlinks in InDesignExport it as a pdf, maintaining the hyperlinksSave as HTML documentOpen new emailInsert HTML file choosing insert as text. The problem with this method is that the images move about, the text is all different sizes, but on the plus side, the hyperlinks have been retained. So I am almost there, but not quite. Can anyone suggest what I need to do to get the design to display 'correctly' in Outlook.

    Read the article

  • How can I enable PHP5 for a site? Having problems with every single method.

    - by John Stephens
    I'm working on a client site that is hosted on someone's DIY Debian Linux server [Apache/1.3.33 (Debian GNU/Linux)], and I'm trying to install a script that requires PHP5. By default, the server parses .php files with PHP 4.3.10-22, which is configured at /etc/php4/apache/php.ini, according to phpinfo(). On the server I can see a config directory for PHP5 adjacent to the PHP4 directory: /etc/php5.0/apache2/php.ini. I have tried multiple methods to enable PHP5 for the document root where the site's files are hosted, including all available methods mentioned here. By far, the most common suggestion I've found is to add one or both of the following lines to the site's .htaccess file: AddHandler application/x-httpd-php5 .php AddType application/x-httpd-php5 .php Trouble is, when either or both of those lines are present, the site forces my browser to download any .php files requested, without parsing the PHP at all. All of the other methods mentioned in the above article cause a 500 Internal Server Error. There is no hosting control panel I can access in a browser to enable PHP5 for the site, but I do have shell access. When I asked the server administrator about this issue, he encouraged me to search for the answer on Google. Where could I begin to troubleshoot this issue? Are there ways to test or verify the server's specific PHP5 installation and configuration, using the command line or some other method? Do you have other suggestions to enable PHP5?

    Read the article

< Previous Page | 538 539 540 541 542 543 544 545 546 547 548 549  | Next Page >