Search Results

Search found 35302 results on 1413 pages for 'string literals'.

Page 543/1413 | < Previous Page | 539 540 541 542 543 544 545 546 547 548 549 550  | Next Page >

  • Generic Property in C#

    - by ml123
    Hi, I'm not quite sure how to do that, but what I would like to do is to create a special type of property that will perform specific tasks at the get and set, and will be defined on generic type. For example, when writing this: MyProp<String name; a pre-defined get and set will be performed on the string value. How can that be done? Thanks!

    Read the article

  • How efficient is Python substring extraction?

    - by Cameron
    I've got the entire contents of a text file (at least a few KB) in string myStr. Will the following code create a copy of the string (less the first character) in memory? myStr = myStr[1:] I'm hoping it just refers to a different location in the same internal buffer. If not, is there a more efficient way to do this? Thanks! Note: I'm using Python 2.5.

    Read the article

  • Simplejson dumps char \

    - by Monty
    Hi! Im programming with django and i need to serialize an object to a string, but i need to get the string \/ serialized. An example: simplejson.dumps({'id' : 'root\/leaf'}) I need an output like this: '{"id": "root\/leaf"}' but i get this: '{"id": "root\\\\leaf"}' Thank you!! PD: Sorry for my english :-P

    Read the article

  • Weird Javascript Regex Replace Backreference Behavior

    - by arshaw
    why does the following js expression: "test1 foo bar test2".replace(/foo.bar/, "$'") result in the following string? "test1 test2 test2" is the $' in the replace string some sort of control code for including everything after the match??? this behavior was screwing with me most of the day. can anyone explain this? thanks a lot ps- this is the case in all browsers i've tested

    Read the article

  • Fractional to Decimal Form.

    - by ThePower
    Hi, there probably isn't an answer to this apart from "Create it yourself", but you never know, there might be some string representation for this. Basically, I would like to display number values as fractional instead of decimal when displaying the values as a string. Instead of a value displaying as: 1.1428571428571428571428571428571 I would prefer it to display as 8/7 Is there any way of doing this without writing the functionality myself? Regards Lloyd

    Read the article

  • Getting the relative path

    - by Brigadier Jigar
    I have to fetch all the files from a folder and i am using the function GetFiles() like string[] dirImages = Directory.GetFiles(strPathYearImages + intYear , "*.png"); where strPathYearImages="Images\Holiday\2010\" but when i write the whole path like string[] dirImages = Directory.GetFiles(@"E:\IWP\Images\Holiday\"+ intYear , "*.png"); i get the required result. How to solve this problem? I dont want to use the whole path. Help me out. Regards, Jigar <3

    Read the article

  • Get Attribute value in ViewEngine ASP.NET MVC 3

    - by Kushan Fernando
    I'm writting my own view engine. public class MyViewEngine : RazorViewEngine { public override ViewEngineResult FindView(ControllerContext controllerContext, string viewName, string masterName, bool useCache) { // Here, how do I get attributes defined on top of the Action ? } } ASP.NET MVC Custom Attributes within Custom View Engine Above SO Question has how to get attributes defined on top of the Controller. But I need to get attributes defined on Action.

    Read the article

  • Flex/Flash 4 datagrid literally displays XML

    - by Setori
    Problem: Flex/Flash4 client (built with FlashBuilder4) displays the xml sent from the server exactly as is - the datagrid keeps the format of the xml. I need the datagrid to parse the input and place the data in the correct rows and columns of the datagrid. flow: click on a date in the tree and it makes a server request for batch information in xml form. Using a CallResponder I then update the datagrid's dataProvider. [code] <fx:Script> <![CDATA[ import mx.controls.Alert; [Bindable]public var selectedTreeNode:XML; public function taskTreeChanged(event:Event):void { selectedTreeNode=Tree(event.target).selectedItem as XML; var searchHubId:String = selectedTreeNode.@hub; var searchDate:String = selectedTreeNode.@lbl; if((searchHubId == "") || (searchDate == "")){ return; } findShipmentBatches(searchDate,searchHubId); } protected function findShipmentBatches(searchDate:String, searchHubId:String):void{ findShipmentBatchesResult.token = actWs.findShipmentBatches(searchDate, searchHubId); } protected function updateBatchDataGridDP():void{ task_list_dg.dataProvider = findShipmentBatchesResult.lastResult; } ]]> </fx:Script> <fx:Declarations> <actws:ActWs id="actWs" fault="Alert.show(event.fault.faultString + '\n' + event.fault.faultDetail)" showBusyCursor="true"/> <s:CallResponder id="findShipmentBatchesResult" result="updateBatchDataGridDP()"/> </fx:Declarations> <mx:AdvancedDataGrid id="task_list_dg" width="100%" height="95%" paddingLeft="0" paddingTop="0" paddingBottom="0"> <mx:columns> <mx:AdvancedDataGridColumn headerText="Receiving date" dataField="rd"/> <mx:AdvancedDataGridColumn headerText="Msg type" dataField="mt"/> <mx:AdvancedDataGridColumn headerText="SSD" dataField="ssd"/> <mx:AdvancedDataGridColumn headerText="Shipping site" dataField="sss"/> <mx:AdvancedDataGridColumn headerText="File name" dataField="fn"/> <mx:AdvancedDataGridColumn headerText="Batch number" dataField="bn"/> </mx:columns> </mx:AdvancedDataGrid> [/code] I cannot upload a pic, but this is the xml: [code] 2010-04-23 16:35:51.0 PRESHIP 2010-02-15 00:00:00.0 100000009 DF-Ocean-PRESHIPSUM-Quanta-PACT-EMEA-Scheduled Ship Date 20100215.csv 10053 [/code] and the xml is pretty much displayed exactly as is in the datagrid columns... I would appreciate your assistance.

    Read the article

  • How to get Alfresco login ticket without user password, but with impersonating user with user principal name (UPN)

    - by dok
    I'm writing a DLL that has function for getting Alfresco login ticket without using user password, using only a user principal name (UPN). I’m calling alfresco REST API service /wcservice. I use NTLM in Alfresco. I’m impersonating users using WindowsIdentity constructor as explained here http://msdn.microsoft.com/en-us/library/ms998351.aspx#paght000023_impersonatingbyusingwindowsidentity. I checked and user is properly impersonated (I checked WindowsIdentity.GetCurrent().Name property). After impersonating a user, I try to make HttpWebRequest and set its credentials with CredentialsCache.DefaultNetworkCredentials. I get the error: The remote server returned an error: (401) Unauthorized. at System.Net.HttpWebRequest.GetResponse() When I use new NetworkCredential("username", "P@ssw0rd") to set request credentials, I get Alfresco login ticket (HttpStatusCode.OK, 200). Is there any way that I can get Alfresco login ticket without user password? Here is the code that I'm using: private string GetTicket(string UPN) { WindowsIdentity identity = new WindowsIdentity(UPN); WindowsImpersonationContext context = null; try { context = identity.Impersonate(); MakeWebRequest(); } catch (Exception e) { return e.Message + Environment.NewLine + e.StackTrace; } finally { if (context != null) { context.Undo(); } } } private string MakeWebRequest() { string URI = "http://alfrescoserver/alfresco/wcservice/mg/util/login"; HttpWebRequest request = WebRequest.Create(URI) as HttpWebRequest; request.CookieContainer = new CookieContainer(1); //request.Credentials = new NetworkCredential("username", "p@ssw0rd"); // It works with this request.Credentials = CredentialCache.DefaultNetworkCredentials; // It doesn’t work with this //request.Credentials = CredentialCache.DefaultCredentials; // It doesn’t work with this either try { using (HttpWebResponse response = request.GetResponse() as HttpWebResponse) { StreamReader sr = new StreamReader(response.GetResponseStream()); return sr.ReadToEnd(); } } catch (Exception e) { return (e.Message + Environment.NewLine + e.StackTrace); } } Here are records from Alfresco stdout.log (if it helps in any way): 17:18:04,550 DEBUG [app.servlet.NTLMAuthenticationFilter] Processing request: /alfresco/wcservice/mg/util/login SID:7453F7BD4FD2E6A61AD40A31A37733A5 17:18:04,550 DEBUG [web.scripts.DeclarativeRegistry] Web Script index lookup for uri /mg/util/login took 0.526239ms 17:18:04,550 DEBUG [app.servlet.NTLMAuthenticationFilter] New NTLM auth request from 10.**.**.** (10.**.**.**:1229) 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Processing request: /alfresco/wcservice/mg/util/login SID:7453F7BD4FD2E6A61AD40A31A37733A5 17:18:04,566 DEBUG [web.scripts.DeclarativeRegistry] Web Script index lookup for uri /mg/util/login took 0.400909ms 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Received type1 [Type1:0xe20882b7,Domain:<NotSet>,Wks:<NotSet>] 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Client domain null 17:18:04,675 DEBUG [app.servlet.NTLMAuthenticationFilter] Sending NTLM type2 to client - [Type2:0x80000283,Target:AlfrescoServerA,Ch:197e2631cc3f9e0a]

    Read the article

  • Question regarding factory pattern

    - by eriks
    I have a factory class to build objects of base class B. The object (D) that uses this factory received a list of strings representing the actual types. What is the correct implementation: the factory receives an Enum (and uses switch inside the Create function) and D is responsible to convert the string to Enum. the factory receives a string and checks for a match to a set of valid strings (using ifs') other implementation i didn't think of.

    Read the article

  • How to change default conjunction with Lucene MultiFieldQueryParser

    - by Luke H
    I have some code using Lucene that leaves the default conjunction operator as OR, and I want to change it to AND. Some of the code just uses a plain QueryParser, and that's fine - I can just call setDefaultOperator on those instances. Unfortunately, in one place the code uses a MultiFieldQueryParser, and calls the static "parse" method (taking String, String[], BooleanClause.Occur[], Analyzer), so it seems that setDefaultOperator can't help, because it's an instance method. Is there a way to keep using the same parser but have the default conjunction changed?

    Read the article

  • Java regex return after first match

    - by user216915
    hi how do i return after the first match of regular expression? (does the Matcher.find() method do that? ) say I have a string "abcdefgeee". I want to ask the regex engine stop finding immediately after it finds the first match of "e" for example. I am writing a method to return true/false if the pattern is found and i don't want to find the whole string for "e". (I am looking for a regex solution ) thanks

    Read the article

  • usage of try catch

    - by Muhammed Rauf K
    Which is best: Code Snippet 1 or Code Snippet 2 ? And Why? /* Code Snippet 1 * * Write try-catch in function definition */ void Main(string[] args) { AddMe(); } void AddMe() { try { // Do operations... } catch(Exception e) { } } /* Code Snippet 2 * * Write try-catch where we call the function. */ void Main(string[] args) { try { AddMe(); } catch (Exception e) { } } void AddMe() { // Do operations... }

    Read the article

  • UISearchDisplayController - how to display search result with only by scope button selected but empt

    - by billibala
    The UISearchDisplayController is very handy and implementing search is pretty straightforward. However, I bump into problem when, in my app, I want to display search result with empty search string but selected scope button. It seems like it's a must to enter some search string in order to get the search result table being initialized and displayed. Is there any ways to display search result immediately after user has picked a scope but not entered search word yet? Thanks Bill

    Read the article

  • Regex to match 0 - 999 but not blank

    - by James Cadd
    I'm working on a regex to match valid integer numbers such as the following: 0 1 99 999 However it should not allow matching an empty string. The closest I can get is: (0)|\\d{1,3} Which to me says a matching string will have either a zero or a series of digits between 1 and 3 characters long. However, empty strings still appear to match this pattern. What's the proper way to exclude empty strings from this regex?

    Read the article

  • C Programming - My program is good enough for my assignment but I know its not good

    - by Joe
    Hi there I'm just starting an assignment for uni and it's raised a question for me. I don't understand how to return a string from a function without having a memory leak. char* trim(char* line) { int start = 0; int end = strlen(line) - 1; /* find the start position of the string */ while(isspace(line[start]) != 0) { start++; } //printf("start is %d\n", start); /* find the position end of the string */ while(isspace(line[end]) != 0) { end--; } //printf("end is %d\n", end); /* calculate string length and add 1 for the sentinel */ int len = end - start + 2; /* initialise char array to len and read in characters */ int i; char* trimmed = calloc(sizeof(char), len); for(i = 0; i < (len - 1); i++) { trimmed[i] = line[start + i]; } trimmed[len - 1] = '\0'; return trimmed; } as you can see I am returning a pointer to char which is an array. I found that if I tried to make the 'trimmed' array by something like: char trimmed[len]; then the compiler would throw up a message saying that a constant was expected on this line. I assume this meant that for some reason you can't use variables as the array length when initialising an array, although something tells me that can't be right. So instead I made my array by allocating some memory to a char pointer. I understand that this function is probably waaaaay sub-optimal for what it is trying to do, but what I really want to know is: 1. Can you normally initialise an array using a variable to declare the length like: char trimmed[len]; ? 2. If I had an array that was of that type (char trimmed[]) would it have the same return type as a pointer to char (ie char*). 3. If I make my array by callocing some memory and allocating it to a char pointer, how do I free this memory. It seems to me that once I have returned this array, I can't access it to free it as it is a local variable. Many thanks in advance Joe

    Read the article

  • How to code a keyboard button to switch between 2 modes?

    - by le.shep20
    Hi! i'm doing a project, i'm not going to details but i will simplify my idea, i'm using Morse Code ( dot and dash) and i have 2 methods: convert_MorseToChar() and Convert_MorseTonum() in the convert_MorseToChar() method there is swich to compare the input from a user which will be Morse codes and mapping it to characters: private String convert_MorseToChar(ref string Ch) { switch (Ch) { Case ".-": MorsetoChar = "a" break; Case "-...": MorsetoChar = "b" break; Case "-.-.": MorsetoChar = "c" break; Case "-..": MorsetoChar = "d" break; Case ".": MorsetoChar = "e" break; } } and the other method Convert_MorseToNum(), ues the SAME combinations of Morse codes but mapping them to numbers: private String Convert_MorseToNum(ref string Ch) { switch (Ch) { Case ".-": MorsetoChar = "1" break; Case "-...": MorsetoChar = "2" break; Case "-.-.": MorsetoChar = "3" break; Case "-..": MorsetoChar = "4" break; Case ".": MorsetoChar = "5" break; } } now the senario is: there are 2 Textbox, one the user will write Morse codes in it and the other is for the output. The user will write dot "." and dash "-" from the keyboard and press Enter then the program will go to ONE of the 2 methods to convert the Morse codes. Now what tells the program where to go to convert?? my question is: I want to create mode key to swich between 2 modes: MorseTochar and MorseToNum. i want the down arrow key to act like a mode, when a user press the down arrow then it the program will be in MorseToChar mode, when ever the user input the program directly use the method convert_MorseToChar to convert to characters. and when the user press the down arrow agian, the prohram will swich to MorseToNum mode here when ever the user input as morsecode, the program will directly use the method Convert_MorseToNum() to convert to numbers. HOW I CAN DO THAT Pleaaaas!!! help me! Please excuse my English, English is not my native language :)

    Read the article

  • Sinatra / Rack fails with non-ascii characters in url

    - by Piotr Zolnierek
    I am getting Encoding::UndefinedConversionError at /find/Wroclaw "\xC5" from ASCII-8BIT to UTF-8 For some mysterious reason sinatra is passing the string as ASCII instead of UTF-8 as it should. I have found some kind of ugly workaround... I don't know why Rack assumes the encoding is ASCII-8BIT ... anyway, a way is to use string.force_encoding("UTF-8")... but doing this for all params is tedious

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • How do I require that an element has either one set of attributes or another in an XSD schema?

    - by Eli Courtwright
    I'm working with an XML document where a tag must either have one set of attributes or another. For example, it needs to either look like <tag foo="hello" bar="kitty" /> or <tag spam="goodbye" eggs="world" /> e.g. <root> <tag foo="hello" bar="kitty" /> <tag spam="goodbye" eggs="world" /> </root> So I have an XSD schema where I use the xs:choice element to choose between two different attribute groups: <xsi:schema xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema" attributeFormDefault="unqualified" elementFormDefault="qualified"> <xs:element name="root"> <xs:complexType> <xs:sequence> <xs:element maxOccurs="unbounded" name="tag"> <xs:choice> <xs:complexType> <xs:attribute name="foo" type="xs:string" use="required" /> <xs:attribute name="bar" type="xs:string" use="required" /> </xs:complexType> <xs:complexType> <xs:attribute name="spam" type="xs:string" use="required" /> <xs:attribute name="eggs" type="xs:string" use="required" /> </xs:complexType> </xs:choice> </xs:element> </xs:sequence> </xs:complexType> </xs:element> </xsi:schema> However, when using lxml to attempt to load this schema, I get the following error: >>> from lxml import etree >>> etree.XMLSchema( etree.parse("schema_choice.xsd") ) Traceback (most recent call last): File "<stdin>", line 1, in <module> File "xmlschema.pxi", line 85, in lxml.etree.XMLSchema.__init__ (src/lxml/lxml.etree.c:118685) lxml.etree.XMLSchemaParseError: Element '{http://www.w3.org/2001/XMLSchema}element': The content is not valid. Expected is (annotation?, ((simpleType | complexType)?, (unique | key | keyref)*))., line 7 Since the error is with the placement of my xs:choice element, I've tried putting it in different places, but no matter what I try, I can't seem to use it to define a tag to have either one set of attributes (foo and bar) or another (spam and eggs). Is this even possible? And if so, then what is the correct syntax?

    Read the article

< Previous Page | 539 540 541 542 543 544 545 546 547 548 549 550  | Next Page >