Search Results

Search found 35400 results on 1416 pages for 'string interpolation'.

Page 546/1416 | < Previous Page | 542 543 544 545 546 547 548 549 550 551 552 553  | Next Page >

  • How to remove list of words from strings

    - by zeljko
    What I would like to do (in Clojure): For example, I have a vector of words that need to be removed: (def forbidden-words [":)" "the" "." "," " " ...many more...]) ... and a vector of strings: (def strings ["the movie list" "this.is.a.string" "haha :)" ...many more...]) So, each forbidden word should be removed from each string, and the result, in this case, would be: ["movie list" "thisisastring" "haha"]. How to do this ?

    Read the article

  • How to write this Linq SQL as a Dynamic Query (using strings)?

    - by Dr. Zim
    Skip to the "specific question" as needed. Some background: The scenario: I have a set of products with a "drill down" filter (Query Object) populated with DDLs. Each progressive DDL selection will further limit the product list as well as what options are left for the DDLs. For example, selecting a hammer out of tools limits the Product Sizes to only show hammer sizes. Current setup: I created a query object, sent it to a repository, and fed each option to a SQL "table valued function" where null values represent "get all products". I consider this a good effort, but far from DDD acceptable. I want to avoid any "programming" in SQL, hopefully doing everything with a repository. Comments on this topic would be appreciated. Specific question: How would I rewrite this query as a Dynamic Query? A link to something like 101 Linq Examples would be fantastic, but with a Dynamic Query scope. I really want to pass to this method the field in quotes "" for which I want a list of options and how many products have that option. from p in db.Products group p by p.ProductSize into g select new Category { PropertyType = g.Key, Count = g.Count() } Each DDL option will have "The selection (21)" where the (21) is the quantity of products that have that attribute. Upon selecting an option, all other remaining DDLs will update with the remaining options and counts. Edit: Additional notes: .OrderBy("it.City") // "it" refers to the entire record .GroupBy("City", "new(City)") // This produces a unique list of City .Select("it.Count()") //This gives a list of counts... getting closer .Select("key") // Selects a list of unique City .Select("new (key, count() as string)") // +1 to me LOL. key is a row of group .GroupBy("new (City, Manufacturer)", "City") // New = list of fields to group by .GroupBy("City", "new (Manufacturer, Size)") // Second parameter is a projection Product .Where("ProductType == @0", "Maps") .GroupBy("new(City)", "new ( null as string)")// Projection not available later? .Select("new (key.City, it.count() as string)")// GroupBy new makes key an object Product .Where("ProductType == @0", "Maps") .GroupBy("new(City)", "new ( null as string)")// Projection not available later? .Select("new (key.City, it as object)")// the it object is the result of GroupBy var a = Product .Where("ProductType == @0", "Maps") .GroupBy("@0", "it", "City") // This fails to group Product at all .Select("new ( Key, it as Product )"); // "it" is property cast though What I have learned so far is LinqPad is fantastic, but still looking for an answer. Eventually, completely random research like this will prevail I guess. LOL. Edit:

    Read the article

  • UISearchDisplayController - how to display search result with only by scope button selected but empt

    - by billibala
    The UISearchDisplayController is very handy and implementing search is pretty straightforward. However, I bump into problem when, in my app, I want to display search result with empty search string but selected scope button. It seems like it's a must to enter some search string in order to get the search result table being initialized and displayed. Is there any ways to display search result immediately after user has picked a scope but not entered search word yet? Thanks Bill

    Read the article

  • Binary data instead of actual image in C#

    - by acadia
    Hello, I am using the below mentioned library to create a barcode which is storing in a specified location as shown below: My question is, is there a way instead of saving it to a png file I get byte data? thanks Code39 code = new Code39("10090"); code.Paint().Save("c:/NewBARCODE.png", ImageFormat.Png); using System; using System.Collections.Generic; using System.Drawing; using System.Drawing.Imaging; using System.Diagnostics; namespace BarCode39 { public class Code39Settings { private int height = 60; public int BarCodeHeight { get { return height; } set { height = value; } } private bool drawText = true; public bool DrawText { get { return drawText; } set { drawText = value; } } private int leftMargin = 10; public int LeftMargin { get { return leftMargin; } set { leftMargin = value; } } private int rightMargin = 10; public int RightMargin { get { return rightMargin; } set { rightMargin = value; } } private int topMargin = 10; public int TopMargin { get { return topMargin; } set { topMargin = value; } } private int bottomMargin = 10; public int BottomMargin { get { return bottomMargin; } set { bottomMargin = value; } } private int interCharacterGap = 2; public int InterCharacterGap { get { return interCharacterGap; } set { interCharacterGap = value; } } private int wideWidth = 2; public int WideWidth { get { return wideWidth; } set { wideWidth = value; } } private int narrowWidth = 1; public int NarrowWidth { get { return narrowWidth; } set { narrowWidth = value; } } private Font font = new Font(FontFamily.GenericSansSerif, 12); public Font Font { get { return font; } set { font = value; } } private int codeToTextGapHeight = 10; public int BarCodeToTextGapHeight { get { return codeToTextGapHeight; } set { codeToTextGapHeight = value; } } } public class Code39 { #region Static initialization static Dictionary<char, Pattern> codes; static Code39() { object[][] chars = new object[][] { new object[] {'0', "n n n w w n w n n"}, new object[] {'1', "w n n w n n n n w"}, new object[] {'2', "n n w w n n n n w"}, new object[] {'3', "w n w w n n n n n"}, new object[] {'4', "n n n w w n n n w"}, new object[] {'5', "w n n w w n n n n"}, new object[] {'6', "n n w w w n n n n"}, new object[] {'7', "n n n w n n w n w"}, new object[] {'8', "w n n w n n w n n"}, new object[] {'9', "n n w w n n w n n"}, new object[] {'A', "w n n n n w n n w"}, new object[] {'B', "n n w n n w n n w"}, new object[] {'C', "w n w n n w n n n"}, new object[] {'D', "n n n n w w n n w"}, new object[] {'E', "w n n n w w n n n"}, new object[] {'F', "n n w n w w n n n"}, new object[] {'G', "n n n n n w w n w"}, new object[] {'H', "w n n n n w w n n"}, new object[] {'I', "n n w n n w w n n"}, new object[] {'J', "n n n n w w w n n"}, new object[] {'K', "w n n n n n n w w"}, new object[] {'L', "n n w n n n n w w"}, new object[] {'M', "w n w n n n n w n"}, new object[] {'N', "n n n n w n n w w"}, new object[] {'O', "w n n n w n n w n"}, new object[] {'P', "n n w n w n n w n"}, new object[] {'Q', "n n n n n n w w w"}, new object[] {'R', "w n n n n n w w n"}, new object[] {'S', "n n w n n n w w n"}, new object[] {'T', "n n n n w n w w n"}, new object[] {'U', "w w n n n n n n w"}, new object[] {'V', "n w w n n n n n w"}, new object[] {'W', "w w w n n n n n n"}, new object[] {'X', "n w n n w n n n w"}, new object[] {'Y', "w w n n w n n n n"}, new object[] {'Z', "n w w n w n n n n"}, new object[] {'-', "n w n n n n w n w"}, new object[] {'.', "w w n n n n w n n"}, new object[] {' ', "n w w n n n w n n"}, new object[] {'*', "n w n n w n w n n"}, new object[] {'$', "n w n w n w n n n"}, new object[] {'/', "n w n w n n n w n"}, new object[] {'+', "n w n n n w n w n"}, new object[] {'%', "n n n w n w n w n"} }; codes = new Dictionary<char, Pattern>(); foreach (object[] c in chars) codes.Add((char)c[0], Pattern.Parse((string)c[1])); } #endregion private static Pen pen = new Pen(Color.Black); private static Brush brush = Brushes.Black; private string code; private Code39Settings settings; public Code39(string code) : this(code, new Code39Settings()) { } public Code39(string code, Code39Settings settings) { foreach (char c in code) if (!codes.ContainsKey(c)) throw new ArgumentException("Invalid character encountered in specified code."); if (!code.StartsWith("*")) code = "*" + code; if (!code.EndsWith("*")) code = code + "*"; this.code = code; this.settings = settings; } public Bitmap Paint() { string code = this.code.Trim('*'); SizeF sizeCodeText = Graphics.FromImage(new Bitmap(1, 1)).MeasureString(code, settings.Font); int w = settings.LeftMargin + settings.RightMargin; foreach (char c in this.code) w += codes[c].GetWidth(settings) + settings.InterCharacterGap; w -= settings.InterCharacterGap; int h = settings.TopMargin + settings.BottomMargin + settings.BarCodeHeight; if (settings.DrawText) h += settings.BarCodeToTextGapHeight + (int)sizeCodeText.Height; Bitmap bmp = new Bitmap(w, h, PixelFormat.Format32bppArgb); Graphics g = Graphics.FromImage(bmp); int left = settings.LeftMargin; foreach (char c in this.code) left += codes[c].Paint(settings, g, left) + settings.InterCharacterGap; if (settings.DrawText) { int tX = settings.LeftMargin + (w - settings.LeftMargin - settings.RightMargin - (int)sizeCodeText.Width) / 2; if (tX < 0) tX = 0; int tY = settings.TopMargin + settings.BarCodeHeight + settings.BarCodeToTextGapHeight; g.DrawString(code, settings.Font, brush, tX, tY); } return bmp; } private class Pattern { private bool[] nw = new bool[9]; public static Pattern Parse(string s) { Debug.Assert(s != null); s = s.Replace(" ", "").ToLower(); Debug.Assert(s.Length == 9); Debug.Assert(s.Replace("n", "").Replace("w", "").Length == 0); Pattern p = new Pattern(); int i = 0; foreach (char c in s) p.nw[i++] = c == 'w'; return p; } public int GetWidth(Code39Settings settings) { int width = 0; for (int i = 0; i < 9; i++) width += (nw[i] ? settings.WideWidth : settings.NarrowWidth); return width; } public int Paint(Code39Settings settings, Graphics g, int left) { #if DEBUG Rectangle gray = new Rectangle(left, 0, GetWidth(settings), settings.BarCodeHeight + settings.TopMargin + settings.BottomMargin); g.FillRectangle(Brushes.Gray, gray); #endif int x = left; int w = 0; for (int i = 0; i < 9; i++) { int width = (nw[i] ? settings.WideWidth : settings.NarrowWidth); if (i % 2 == 0) { Rectangle r = new Rectangle(x, settings.TopMargin, width, settings.BarCodeHeight); g.FillRectangle(brush, r); } x += width; w += width; } return w; } } } }

    Read the article

  • Start oracle dequeue on startup

    - by Geln
    Hi, I got the following error of Oracle, ORA-25226: dequeue failed, queue string.string is not enabled for dequeue And the following is the Cause and Action for it from the official document: Cause: The queue has not been enabled for dequeue. Action: Enable the queue using START_QUEUE. But this error occurs every time when restart the database, is there any configuration to set to start the dequeue on database startup? thanks!

    Read the article

  • JSON encoding on RTL languages

    - by Lev
    Hi, I'm using JSON to integrate open flash chart to my web page. When I have a Right to Left language string which contains more the one word the JSON encodes it backwards (For example: "Hello world" is encoded as "world hello"). The string is extracted from a database, there for can be of any language. How do I force the correct encoding of Right to Left language without ruining other languages? Thanks

    Read the article

  • How efficient is Python substring extraction?

    - by Cameron
    I've got the entire contents of a text file (at least a few KB) in string myStr. Will the following code create a copy of the string (less the first character) in memory? myStr = myStr[1:] I'm hoping it just refers to a different location in the same internal buffer. If not, is there a more efficient way to do this? Thanks! Note: I'm using Python 2.5.

    Read the article

  • Ultimate Get/Post with Android Thread for Dummies

    - by Jayomat
    Hi, I'm writing an app to check for the bus timetable's. Therefor I need to post some data to a html page, submit it, and parse the resulting page with htmlparser. Though it may be asked a lot, can some one help me identify if 1) this page does support post/get (I think it does) 2) which fields I need to use? 3) How to make the actual request? this is my code so far: String url = "http://busspur02.aseag.de/bs.exe?Cmd=RV&Karten=true&DatumT=30&DatumM=4&DatumJ=2010&ZeitH=&ZeitM=&Suchen=%28S%29uchen&GT0=&HT0=&GT1=&HT1="; String charset = "CP1252"; System.out.println("startFrom: "+start_from); System.out.println("goTo: "+destination); //String tag.v List<NameValuePair> params = new ArrayList<NameValuePair>(); params.add(new BasicNameValuePair("HTO", start_from)); params.add(new BasicNameValuePair("HT1", destination)); params.add(new BasicNameValuePair("GTO", "Aachen")); params.add(new BasicNameValuePair("GT1", "Aachen")); params.add(new BasicNameValuePair("DatumT", day)); params.add(new BasicNameValuePair("DatumM", month)); params.add(new BasicNameValuePair("DatumJ", year)); params.add(new BasicNameValuePair("ZeitH", hour)); params.add(new BasicNameValuePair("ZeitM", min)); UrlEncodedFormEntity query = new UrlEncodedFormEntity(params, charset); HttpPost post = new HttpPost(url); post.setEntity(query); InputStream response = new DefaultHttpClient().execute(post).getEntity().getContent(); // Now do your thing with the facebook response. String source = readText(response,"CP1252"); Log.d(TAG_AVV,response.toString()); System.out.println("STREAM "+source); One person also gave me a hint to use firebug to read what's going on at the page, but I don't really understand what to look for, or more precisely, how to use the provided information. I also find it confusing, for example, that when I enter the data by hand, the url says, for example, "....HTO=Kaiserplatz&...", but in Firebug, the same Kaiserplatz is connected to a different field, in this case: \<\td class="Start3" Kaiserplatz <\/td (I inserted \ to make it visible) The last line in my code prints the html page, but without having send a request.. it's printed as if there was no input at all... My app is almost done, I hope someone can help me out to finish it! thanks in advance

    Read the article

  • Weird Javascript Regex Replace Backreference Behavior

    - by arshaw
    why does the following js expression: "test1 foo bar test2".replace(/foo.bar/, "$'") result in the following string? "test1 test2 test2" is the $' in the replace string some sort of control code for including everything after the match??? this behavior was screwing with me most of the day. can anyone explain this? thanks a lot ps- this is the case in all browsers i've tested

    Read the article

  • Java regex return after first match

    - by user216915
    hi how do i return after the first match of regular expression? (does the Matcher.find() method do that? ) say I have a string "abcdefgeee". I want to ask the regex engine stop finding immediately after it finds the first match of "e" for example. I am writing a method to return true/false if the pattern is found and i don't want to find the whole string for "e". (I am looking for a regex solution ) thanks

    Read the article

  • Getting the relative path

    - by Brigadier Jigar
    I have to fetch all the files from a folder and i am using the function GetFiles() like string[] dirImages = Directory.GetFiles(strPathYearImages + intYear , "*.png"); where strPathYearImages="Images\Holiday\2010\" but when i write the whole path like string[] dirImages = Directory.GetFiles(@"E:\IWP\Images\Holiday\"+ intYear , "*.png"); i get the required result. How to solve this problem? I dont want to use the whole path. Help me out. Regards, Jigar <3

    Read the article

  • Get Attribute value in ViewEngine ASP.NET MVC 3

    - by Kushan Fernando
    I'm writting my own view engine. public class MyViewEngine : RazorViewEngine { public override ViewEngineResult FindView(ControllerContext controllerContext, string viewName, string masterName, bool useCache) { // Here, how do I get attributes defined on top of the Action ? } } ASP.NET MVC Custom Attributes within Custom View Engine Above SO Question has how to get attributes defined on top of the Controller. But I need to get attributes defined on Action.

    Read the article

  • List input and output audio devices in Applet

    - by Jhonny Everson
    I am running a signed applet that needs to provide the ability for the user to select the input and output audio devices ( similar to what skype provides). I borrowed the following code from other thread: import javax.sound.sampled.*; public class SoundAudit { public static void main(String[] args) { try { System.out.println("OS: "+System.getProperty("os.name")+" "+ System.getProperty("os.version")+"/"+ System.getProperty("os.arch")+"\nJava: "+ System.getProperty("java.version")+" ("+ System.getProperty("java.vendor")+")\n"); for (Mixer.Info thisMixerInfo : AudioSystem.getMixerInfo()) { System.out.println("Mixer: "+thisMixerInfo.getDescription()+ " ["+thisMixerInfo.getName()+"]"); Mixer thisMixer = AudioSystem.getMixer(thisMixerInfo); for (Line.Info thisLineInfo:thisMixer.getSourceLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Source Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}} for (Line.Info thisLineInfo:thisMixer.getTargetLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Target Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}}} } catch (Exception e) {e.printStackTrace();}} public static String AnalyzeControl(Control thisControl) { String type = thisControl.getType().toString(); if (thisControl instanceof BooleanControl) { return " Control: "+type+" (boolean)"; } if (thisControl instanceof CompoundControl) { System.out.println(" Control: "+type+ " (compound - values below)"); String toReturn = ""; for (Control children: ((CompoundControl)thisControl).getMemberControls()) { toReturn+=" "+AnalyzeControl(children)+"\n";} return toReturn.substring(0, toReturn.length()-1);} if (thisControl instanceof EnumControl) { return " Control:"+type+" (enum: "+thisControl.toString()+")";} if (thisControl instanceof FloatControl) { return " Control: "+type+" (float: from "+ ((FloatControl) thisControl).getMinimum()+" to "+ ((FloatControl) thisControl).getMaximum()+")";} return " Control: unknown type";} } But what I get: Mixer: Software mixer and synthesizer [Java Sound Audio Engine] Mixer: No details available [Microphone (Pink Front)] I was expecting the get the real list of my devices (My preferences panels shows 3 output devices and 1 Microphone). I am running on Mac OS X 10.6.7. Is there other way to get that info from Java?

    Read the article

  • Generic Property in C#

    - by ml123
    Hi, I'm not quite sure how to do that, but what I would like to do is to create a special type of property that will perform specific tasks at the get and set, and will be defined on generic type. For example, when writing this: MyProp<String name; a pre-defined get and set will be performed on the string value. How can that be done? Thanks!

    Read the article

  • Simplejson dumps char \

    - by Monty
    Hi! Im programming with django and i need to serialize an object to a string, but i need to get the string \/ serialized. An example: simplejson.dumps({'id' : 'root\/leaf'}) I need an output like this: '{"id": "root\/leaf"}' but i get this: '{"id": "root\\\\leaf"}' Thank you!! PD: Sorry for my english :-P

    Read the article

  • Flex/Flash 4 datagrid literally displays XML

    - by Setori
    Problem: Flex/Flash4 client (built with FlashBuilder4) displays the xml sent from the server exactly as is - the datagrid keeps the format of the xml. I need the datagrid to parse the input and place the data in the correct rows and columns of the datagrid. flow: click on a date in the tree and it makes a server request for batch information in xml form. Using a CallResponder I then update the datagrid's dataProvider. [code] <fx:Script> <![CDATA[ import mx.controls.Alert; [Bindable]public var selectedTreeNode:XML; public function taskTreeChanged(event:Event):void { selectedTreeNode=Tree(event.target).selectedItem as XML; var searchHubId:String = selectedTreeNode.@hub; var searchDate:String = selectedTreeNode.@lbl; if((searchHubId == "") || (searchDate == "")){ return; } findShipmentBatches(searchDate,searchHubId); } protected function findShipmentBatches(searchDate:String, searchHubId:String):void{ findShipmentBatchesResult.token = actWs.findShipmentBatches(searchDate, searchHubId); } protected function updateBatchDataGridDP():void{ task_list_dg.dataProvider = findShipmentBatchesResult.lastResult; } ]]> </fx:Script> <fx:Declarations> <actws:ActWs id="actWs" fault="Alert.show(event.fault.faultString + '\n' + event.fault.faultDetail)" showBusyCursor="true"/> <s:CallResponder id="findShipmentBatchesResult" result="updateBatchDataGridDP()"/> </fx:Declarations> <mx:AdvancedDataGrid id="task_list_dg" width="100%" height="95%" paddingLeft="0" paddingTop="0" paddingBottom="0"> <mx:columns> <mx:AdvancedDataGridColumn headerText="Receiving date" dataField="rd"/> <mx:AdvancedDataGridColumn headerText="Msg type" dataField="mt"/> <mx:AdvancedDataGridColumn headerText="SSD" dataField="ssd"/> <mx:AdvancedDataGridColumn headerText="Shipping site" dataField="sss"/> <mx:AdvancedDataGridColumn headerText="File name" dataField="fn"/> <mx:AdvancedDataGridColumn headerText="Batch number" dataField="bn"/> </mx:columns> </mx:AdvancedDataGrid> [/code] I cannot upload a pic, but this is the xml: [code] 2010-04-23 16:35:51.0 PRESHIP 2010-02-15 00:00:00.0 100000009 DF-Ocean-PRESHIPSUM-Quanta-PACT-EMEA-Scheduled Ship Date 20100215.csv 10053 [/code] and the xml is pretty much displayed exactly as is in the datagrid columns... I would appreciate your assistance.

    Read the article

  • Sinatra / Rack fails with non-ascii characters in url

    - by Piotr Zolnierek
    I am getting Encoding::UndefinedConversionError at /find/Wroclaw "\xC5" from ASCII-8BIT to UTF-8 For some mysterious reason sinatra is passing the string as ASCII instead of UTF-8 as it should. I have found some kind of ugly workaround... I don't know why Rack assumes the encoding is ASCII-8BIT ... anyway, a way is to use string.force_encoding("UTF-8")... but doing this for all params is tedious

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • How to get Alfresco login ticket without user password, but with impersonating user with user principal name (UPN)

    - by dok
    I'm writing a DLL that has function for getting Alfresco login ticket without using user password, using only a user principal name (UPN). I’m calling alfresco REST API service /wcservice. I use NTLM in Alfresco. I’m impersonating users using WindowsIdentity constructor as explained here http://msdn.microsoft.com/en-us/library/ms998351.aspx#paght000023_impersonatingbyusingwindowsidentity. I checked and user is properly impersonated (I checked WindowsIdentity.GetCurrent().Name property). After impersonating a user, I try to make HttpWebRequest and set its credentials with CredentialsCache.DefaultNetworkCredentials. I get the error: The remote server returned an error: (401) Unauthorized. at System.Net.HttpWebRequest.GetResponse() When I use new NetworkCredential("username", "P@ssw0rd") to set request credentials, I get Alfresco login ticket (HttpStatusCode.OK, 200). Is there any way that I can get Alfresco login ticket without user password? Here is the code that I'm using: private string GetTicket(string UPN) { WindowsIdentity identity = new WindowsIdentity(UPN); WindowsImpersonationContext context = null; try { context = identity.Impersonate(); MakeWebRequest(); } catch (Exception e) { return e.Message + Environment.NewLine + e.StackTrace; } finally { if (context != null) { context.Undo(); } } } private string MakeWebRequest() { string URI = "http://alfrescoserver/alfresco/wcservice/mg/util/login"; HttpWebRequest request = WebRequest.Create(URI) as HttpWebRequest; request.CookieContainer = new CookieContainer(1); //request.Credentials = new NetworkCredential("username", "p@ssw0rd"); // It works with this request.Credentials = CredentialCache.DefaultNetworkCredentials; // It doesn’t work with this //request.Credentials = CredentialCache.DefaultCredentials; // It doesn’t work with this either try { using (HttpWebResponse response = request.GetResponse() as HttpWebResponse) { StreamReader sr = new StreamReader(response.GetResponseStream()); return sr.ReadToEnd(); } } catch (Exception e) { return (e.Message + Environment.NewLine + e.StackTrace); } } Here are records from Alfresco stdout.log (if it helps in any way): 17:18:04,550 DEBUG [app.servlet.NTLMAuthenticationFilter] Processing request: /alfresco/wcservice/mg/util/login SID:7453F7BD4FD2E6A61AD40A31A37733A5 17:18:04,550 DEBUG [web.scripts.DeclarativeRegistry] Web Script index lookup for uri /mg/util/login took 0.526239ms 17:18:04,550 DEBUG [app.servlet.NTLMAuthenticationFilter] New NTLM auth request from 10.**.**.** (10.**.**.**:1229) 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Processing request: /alfresco/wcservice/mg/util/login SID:7453F7BD4FD2E6A61AD40A31A37733A5 17:18:04,566 DEBUG [web.scripts.DeclarativeRegistry] Web Script index lookup for uri /mg/util/login took 0.400909ms 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Received type1 [Type1:0xe20882b7,Domain:<NotSet>,Wks:<NotSet>] 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Client domain null 17:18:04,675 DEBUG [app.servlet.NTLMAuthenticationFilter] Sending NTLM type2 to client - [Type2:0x80000283,Target:AlfrescoServerA,Ch:197e2631cc3f9e0a]

    Read the article

  • Question regarding factory pattern

    - by eriks
    I have a factory class to build objects of base class B. The object (D) that uses this factory received a list of strings representing the actual types. What is the correct implementation: the factory receives an Enum (and uses switch inside the Create function) and D is responsible to convert the string to Enum. the factory receives a string and checks for a match to a set of valid strings (using ifs') other implementation i didn't think of.

    Read the article

  • Fractional to Decimal Form.

    - by ThePower
    Hi, there probably isn't an answer to this apart from "Create it yourself", but you never know, there might be some string representation for this. Basically, I would like to display number values as fractional instead of decimal when displaying the values as a string. Instead of a value displaying as: 1.1428571428571428571428571428571 I would prefer it to display as 8/7 Is there any way of doing this without writing the functionality myself? Regards Lloyd

    Read the article

< Previous Page | 542 543 544 545 546 547 548 549 550 551 552 553  | Next Page >