Search Results

Search found 62199 results on 2488 pages for 'first order logic'.

Page 547/2488 | < Previous Page | 543 544 545 546 547 548 549 550 551 552 553 554  | Next Page >

• Shared memory of same DLL in different 32 bit processes is sometimes different in a terminal session

  - by KBrusing

  We have an 32 bit application consisting of some processes. They communicate with shared memory of a DLL used by every process. Shared memory is build with global variables in C++ by "#pragma data_seg ("Shared")". When running this application sometime during starting a new process in addition to an existing (first) process we observe that the shared memory of both processes is not the same. All new started processes cannot communicate with the first process. After stopping all of our processes and restarting the application (with some processes) everything works fine. But sometime or other after successfully starting and finishing new processes the problem occurs again. Running on all other Windows versions or terminal sessions on Windows server 2003 our application never got this problem. Is there any new "feature" on Windows server 2008 that might disturb the hamony of our application?

  Read the article

• How to hang up (disconnect, terminate,..) incomings call???

  - by Cesar Valiente

  "How do you hang up incoming calls (in Android of course)?" First, I know this question has been asked and answered several times, and the response is always "you can't". But if we look in the market we get a few applications (all private software, no access to the source code... :-( ) that do this action, such as CallFilter, Panda firewall and others... So... does somebody know how these apps do the hang up action, (or terminate, or disconnect or whatever you call it..)? And other question, if the first don't get a response.. does somebody know how send an incoming call to the voice mail? Of course, all questions are about how to do it programmatically. So with the voicemail question I know there's a flag in contacts that is used for that, but like I said, I'd like to know the programmatical way. Thanks all!

  Read the article

• Strategies for testing reactive, asynchronous code

  - by Arne

  I am developing a data-flow oriented domain-specific language. To simplify, let's just look at Operations. Operations have a number of named parameters and can be asked to compute their result using their current state. To decide when an Operation should produce a result, it gets a Decision that is sensitive to which parameter got a value from who. When this Decision decides that it is fulfilled, it emits a Signal using an Observer. An Accessor listens for this Signal and in turn calls the Result method of the Operation in order to multiplex it to the parameters of other Operations. So far, so good, nicely decoupled design, composable and reusable and, depending on the specific Observer used, as asynchronous as you want it to be. Now here's my problem: I would love to start coding actual Tests against this design. But with an asynchronous Observer... how should I know that the whole signal-and-parameters-plumbing worked? Do I need to use time outs while waiting for a Signal in order to say that it was emitted successfully or not? How can I be, formally, sure that the Signal will not be emitted if I just wait a little longer (halting problem? ;-)) And, how can I be sure that the Signal was emitted because it was me who set a parameter, and not another Operation? It might well be that my test comes to early and sees a Signal that was emitted way before my setting a parameter caused a Decision to emit it. Currently, I guess the trivial cases are easy to test, but as soon as I want to test complex many-to-many - situations between operations I must resort to hoping that the design Just Works (tm)...

  Read the article

• Is using a DataSet's column Expression works in background same as manual calculation?

  - by Harikrishna

  I have one datatable which is not bindided and records are coming from the file by parsing it in the datatable dynamically every time. Now there is three columns in the datatable Marks1,Marks2 and FinalMarks. And their types is decimal. Now for making addition of columns Marks1 and Marks2 's records and store it into FinalMarks column,For that what I do is : datatableResult.Columns["FinalMarks"].Expression="Marks1+Marks2"; It's works properly. It can be done in other way also is foreach (DataRow r in datatableResult.Rows) { r["FinalMarks"]=Convert.ToDecimal(r["Marks1"])+Convert.ToDecimal(r["Marks2"]); } Is first approach same as second approach in background means is both approach same or what? EDIT: I want to know that first approach works in background as second approach.

  Read the article

• input type="file" auto click

  - by cf_PhillipSenn

  How do I automatically open the browse dialog of an input type="file" when the page first opens?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• How to move to another view without using a button

  - by Will

  My first view displays an image and action indicator while web-servers and database function are run in that background. I want the application to go to my tab view when the functions have been completed. How do I do this? Here is what the views look like. What I have tried: TabBarViewController *tab = [[TabBarViewController alloc]init]; [self presentViewController:tab animated:NO completion:nil]; and [self performSegueWithIdentifier:@"first" sender:self]; Please can you help my to understand how to do this. I have spent many hours googling this problem and couldn't work out how to do it. Thanks EDIT: Added Code

  Read the article

• How to extract certain columns from a big Notepad text file?

  - by user560464

  I have a big text file and the data in it are in 5 columns, but I need just the first and the last column of that. It will take many days and probably with mistake if I want to enter the data of this two column one-by-one from here to another file. Is there a fast way to do this? For example: 1 1.0000000000000000 0.0000000000 S {0} 2 1.5000000000000000 0.3010299957 C {2} 3 1.7500000000000000 0.6020599913 S {0,2} 4 2.0000000000000000 0.7781512504 C {3} 5 2.3333333333333333 1.0791812460 C {3,2} 6 2.5000000000000000 1.3802112417 S {3,0,2} 7 2.5277777777777778 1.5563025008 S {0,3} 8 2.5833333333333333 1.6812412374 S {3,0,0,2} 9 2.8000000000000000 1.7781512504 C {5,2} 10 3.0000000000000000 2.0791812460 C {5,0,2} I need the first column (numbering) and the last inside { }.

  Read the article

• What are the potential problems with exposing the Facebook API secret?

  - by genehack

  I'm writing a little web utility that posts status updates to Twitter and/or Facebook. That involved creating 'applications' with both those services in order to get API keys and 'secrets'. My question is how protected I really need to keep those secrets -- in order for this to work at all, you seem to need the secret to interact with the authentication part of the service to grant the app access to your account and/or grant it permission to post updates on your behalf. Facebook's documentation says to protect the secret, but at least one other Facebook utility distributes the API key and secret in the source. It's important to note: this isn't your standard Facebook 'application' that runs within the context of Facebook, nor is it a standard "desktop"-style compiled app -- it's a web-based application intended to be run on your own web server. The audience for this is probably small and somewhat more sophisticated than average -- so, one technical alternative would be to require people to obtain their own API key and secret to use the app. That seems like a lot of work, however, and a fairly large barrier to entry to anybody using this. Anybody know or have any insight on what sort of trouble I'm letting myself in for if I put both the secrets and the API keys in the config for my app and check it into Github for all the world to see?

  Read the article

• Perform tasks with delay, without delaying web response (ASP.NET)

  - by Tomas Lycken

  I'm working on a feature that needs to send two text messages with a 30 second delay, and it is crucial that both text messages are sent. Currently, this feature is built with ajax requests, that are sent with a 30 second javascript delay, but since this requires the user to have his browser open and left on the same page for at least 30 seconds, it is not a method I like. Instead, I have tried to solve this with threading. This is what I've done: Public Shared Sub Larma() Dim thread As New System.Threading.Thread(AddressOf Larma_Thread) thread.Start() End Sub Private Shared Sub Larma_Thread() StartaLarm() Thread.Sleep(1000 * 30) StoppaLarm() End Sub A web handler calls Larma(), and StartaLarm() and StoppaLarm() are the methods that send the first and second text messages respectively. However, I only get the first text message delivered - the second is never sent. Am I doing something wrong here? I have no deep understanding of how threading works in ASP.NET, so please let me know how to accomplish this.

  Read the article

• Memory interleaving

  - by Tim Green

  Hello, I have this question that has me rather confused. Suppose that a 1G x 32-bit main memory is built using 256M x 4-bit RAM chips and that this memory is byte-addressable. I have deduced that one would require 4*1G = 2^2*2*30 = 2^32 - so 32 bits to address the full memory. My problem now comes with, say, if you had memory (byte) address "14", determine which memory module this would go into. (There would have to be 8 chips per module to make the 32-bit wide memory, and 4 modules overall giving 32 chips in total. Modules are numbered from 0). In high-order interleave, it appears trivial that it's the first (0) memory module given a lot of the first few bits are 0. However, low-order interleave has me stumped. I can't figure out (for sure) how many bits are used to determine a memory module (possibly 2, given there are 4 in total?). The given solution is Module 3. This is not homework in the same sense so I will not be tagging it as such.

  Read the article

• How to get sub array in PHP?

  - by wamp

  I want to get an array composed of the first 4 rows of the original array $arr, how to do it in PHP?

  Read the article

• ontouch - Switching positions of two views(images) in Android

  - by idish

  I've been looking for that 2 days long and haven't found anything related to it. I'll give an example for my goal. Let's say I have 2 images positioned side by side horizontally. I want the user to be able to switch their positions onlongtouch listener. so let's say that the first image was on the left and the second was on the right side, after switching positions between them, the first image would be in the right and the second would be on the left side. Basically, it is just like in the launcher where you can switch apps positions. Please, if anything is not clear for you, I would like to know, and I'll try to explain it better, thank you.

  Read the article

• How is Javascript parsed/executed in a web browser exactly?

  - by ededed

  For example when I access web server likely Javascript will execute. From there on, how will the browser parse the Javascript, or "execute" the functions, the memory used, etc. How will the browser "handle" all of that? Does it act like a compilation lexer in that it passes line by line and generates object code, or does it use the DOM, and other specifications to handle memory, etc. Also, in terms of updating the page, and alterior concurrent executions as well, such as Flash, HTML, Java, etc. Point be simplified, how does the browser handle the scripts, the memory, and the logic on page from a javascript file?

  Read the article

• SSIS - user variable used in derived column transform is not available - in some cases

  - by soo

  Unfortunately I don't have a repro for my issue, but I thought I would try to describe it in case it sounds familiar to someone... I am using SSIS 2005, SP2. My package has a package-scope user variable - let's call it user_var first step in the control flow is an Execute SQL task which runs a stored procedure. All that SP does is insert a record in a SQL table (with an identity column) and then go back and get the max ID value. The Execute SQL task saves this output into user_var the control flow then has a Data Flow Task - it goes and gets some source data, has a derived column which sets a column called run_id to user_var - and saves the data to a SQL destination In most cases (this template is used for many packages, running every day) this all works great. All of the destination records created get set with a correct run_id. However, in some cases, there is a set of the destination data that does not get run_id equal to user_var, but instead gets a value of 0 (0 is the default value for user_var). I have 2 instances where this has happened, but I can't make it happen. In both cases, it was just less that 10,000 records that have run_id = 0. Since SSIS writes data out in 10,000 record blocks, this really makes me think that, for the first set of data written out, user_var was not yet set. Then, after that first block, for the rest of the data, run_id is set to a correct value. But control passed on to my data flow from the Execute SQL task - it would have seemed reasonable to me that it wouldn't go on until the SP has completed and user_var is set. Maybe it just runs the SP, but doesn't wait for it to complete? In both cases where this has happened there seemed to be a few packages hitting the table to get a new user_var at about the same time. And in both cases lots of data was written (40 million rows, 60 million rows) - my thinking is that that means the writes were happening for a while. Sorry to be both long-winded AND vague. A winning combination! Does this sound familiar to anyone? Thanks.

  Read the article

• MySql: Is it reasonable to use 'view' or I would better denormalize my DB?

  - by Budda

  There is 'team_sector' table with following fields: Id, team_id, sect_id, size, level It contains few records for each 'team' entity (referenced with 'team_id' field). Each record represent sector of team's stadium (totally 8 sectors). Now it is necessary to implement few searches: by overall stadium size (SUM(size)); the best quality (SUM(level)/COUNT(*)). I could create query something like this: SELECT TS.team_id, SUM(TS.size) as OverallSize, SUM(TS.Level)/COUNT(TS.Id) AS QualityLevel FROM team_sector GROUP BY team_id ORDER BY OverallSize DESC / ORDER BY QualityLevel DESC But my concern here is that calculation for each team will be done each time on query performed. It is not too big overhead (at least now), but I would like to avoid performance issues later. I see 2 options here. The 1st one is to create 2 additional fields in 'team' table (for example) and store there OverallSize and QualityLevel fields. If information if 'sector' table is changed - update those table too (probably would be good to do that with triggers, as sector table doesn't change too often). The 2nd option is to create a view that will provide required data. The 2nd option seems much easier for me, but I don't have a lot of experience/knowledge of work with views. Q1: What is the best option from your perspective here and why? Probably you could suggest other options? Q2: Can I create view in such way that it will do calculations rarely (at least once per day)? If yes - how? Q3: Is it reasonable to use triggers for such purpose (1st option). P.S. MySql 5.1 is used, overall number of teams is around 1-2 thousand, overall number of records in sector table - overall 6-8 thousand. I understand, those numbers are pretty small, but I would like to implement the best practice here.

  Read the article

• Can I set JFrame's normal size while it is maximized?

  - by icza

  I'd like to set the normal size of a visible JFrame while it is in Frame.MAXIMIZED_BOTH state (by normal size i mean the size of frame when it is in Frame.NORMAL state) . The reason I want to do this is so that when the user un-maximizes the frame, it will have the proper size I want it to be. But if I do so, the window will switch to normal state. If I set the size first, then switch to MAXIMIZED_BOTH state, then I will see a disturbing blink or resize (which I don't want to). I've also tried setting the size first, then changing state to MAXIMIZED_BOTH, and then making it visible, but the state change is deferred if the window is not visible (and will only be executed once it is made visible, also resulting in a visual resize). So what can I do if I want my frame to have a predefined normal size, but I want it to appear maximized?

  Read the article

• null pointer exception in textview of setcontent

  - by kitokid

  I am getting the java.lang.NullPointerException on createTabContent for the following code. There are two tabspecs. When I called and set the tab , changed the tabs for the first time it is ok. But when i called again while I am on the second tab, its hit the null pointer exception for line : NoStudentText.setVisibility(View.VISIBLE); I will show No Student Text if there is no data for the student list. It shows the text for the first time call. But If I do second time call to that tab, got the error. tspecStudent.setContent(new TabContentFactory() { public View createTabContent(String arg0) { if(listStudent != null && listStudent .size() > 0) { //show the student list } else { TextView noStudentText = (TextView)findViewById(R.id.NoStudentText); noStudentText.setVisibility(View.VISIBLE); return noStudentText; } } });

  Read the article

• How do i resolve method Overlapping in java/Processing [duplicate]

  - by user3718913

  This question already has an answer here: How do I compare strings in Java? 24 answers I have two methods/function in a class, called, Qestion1 and Question2, i want it in such a way that after the user has answered Question one correctly, the Question 2 method is called. Whenever i call the method 2, it displays both of them together instead exiting the first method first. Here's a dummy code to illustrate what i'm saying: void Question1() { String question="What is the capital of England?"; String Answer="London"; if(Answer=='London') { Question2(); } } void Question2() { String question="What is the capital of California?"; String Answer="Sacramento"; if(Answer=='Sacramento') { Question3(); } } Pls, this question is in no way related to that other question. Pls peruse the thread again.

  Read the article

• Mootools accordion inside another...

  - by jimbo

  Hi all, This is a funny one... I have created a mootools accordion with tabs, each section appears when clicked. This works fine. Now within the first accordion that shows, I have another accordion that displays more data. This was to keep the area small with the mass of information that is needed on the page. All works fine, the problem come when the information hidden is larger than the area that is worked our for the first tabs accordion, and it wont display. does any-one either understand what i'm trying to say, or have an idea of a fix or workaround? Hope this makes sense!

  Read the article

• Can I have different name and id attributes on a form element?

  - by ewitkows

  Hi all, I have a web form with usual elements (first name, last name, etc). The Postback URL is a different website altogether as the form is intented to post lead information to another website. The site that accepts the lead is expecting First Name to come over as "FName", and Last Name to come over as "LName". Is there any way I can set the ID of a textbox to "txtFName", but submit it over the wire as "FName"? I tried changing the name attribute, but at runtime it sets the name = id.

  Read the article

• Strange Locking Behaviour in SQL Server 2005

  - by SQL Learner

  Can anyone please tell me why does the following statement inside a given stored procedure returns repeated results even with locks on the rows used by the first SELECT statement? BEGIN TRANSACTION DECLARE @Temp TABLE ( ID INT ) INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue <= 10 INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue >= 5 SELECT * FROM @Temp COMMIT TRANSACTION Any values in SomeTable for which SomeValue is between 5 and 10 will be returned twice, even though they were locked in the first SELECT. I thought that locks were in place for the whole transaction, and so I wasn't expecting the query to return repeated results. Why is this happening?

  Read the article

• JDBC Pagination

  - by Zeeshan

  Hi, I want to implement pagination using JDBC. The actual thing I want to know is "How can i get first 50 and then next 50 records from database for page 1 and 2 respectively" My Query is Select * from data [data table contains 20,000 rows] For page #1 I get 50 records and for page #2 I want to get next 50 records. How can I implement it efficiently in JDBC? I have searched and found that rs.absolute(row) is the way to skip first page records but it takes some amount of time on large result sets and I don't want to bear this amount of time. Also, I don't want to use rownum and limit + offset in query because these are not good to use in query, I dont know why, still I don't want to use it in query. Can anyone help me how to get limited ResultSet for pagination or is there any way JDBC is giving us?

  Read the article

• Smarty/PHP loop not being passed to IE(Pc) or Chrome/FF(Mac)

  - by Kyle Sevenoaks

  Hi, I've been working on a site that has a lot of PHP/Smarty involved, I've been asked to re-skin a webstore checkout process, but during this we've discovered this issue. This particular quirk is one part of a tax calculation that doesn't get sent to the browser in IE for PC and Chrome/FF for the Mac. It's NOT in the output source in the browsers, but is in FF, Chrome and Opera on the PC. Here is the code that doesn't "work:" {foreach $cart.taxes.$currency as $tax} <div id="subTotalCaption2"><p style="width:100px;">{$tax.name_lang}:</p></div> <div id="taxAmount2"><p>{$tax.formattedAmount}</p></div> {/foreach} It's not a CSS issue as if you go all the way through the checkout process and then back to the order page (Not using the back button, using the on-site links) it works. There is another calculation on the last page of the process that does the same thing: {foreach from=$order.taxes.$currency item="tax"} <tr> <td colspan="{$colspan}" class="tax">{$tax.name_lang}:</td> <td>{$tax.formattedAmount}</td> </tr> {/foreach} I guess my question is what could cause this to not be read (Parsed?) in IE and the mac but other browsers do it fine on the PC. Thanks.

  Read the article

• compare two characters based on subset

  - by schultem

  I have a simple dataframe with two columns: df <- data.frame(x = c(1,1,2,2,3), y = c(rep(1:2,2),1), target = c('a','a','a','b','a')) I would like to compare the strings in the target column (find out whether they are equal or not, i.e., TRUE or FALSE) within every level of x (same number for x). First I would like to compare lines 1 and 2, then 3 and 4 ... My problem is that I am missing some comparisons, for example, line 5 has only one case instead of two - so it should turn out to be FALSE. Variable y indicates the first and second case within x. I played around with ddply doing something like: ddply(df, .(x), summarise, ifelse(as.character(df[df$y == '1',]$target), as.character(df[df$y == '2',]$target),0,1)) which is ugly ... and does not work ... Any insights how I could achieve this comparison? Thanks

  Read the article

< Previous Page | 543 544 545 546 547 548 549 550 551 552 553 554  | Next Page >