Search Results

Search found 15860 results on 635 pages for 'document oriented databas'.

Page 550/635 | < Previous Page | 546 547 548 549 550 551 552 553 554 555 556 557  | Next Page >

  • Indexing and Searching Over Word Level Annotation Layers in Lucene

    - by dmcer
    I have a data set with multiple layers of annotation over the underlying text, such as part-of-tags, chunks from a shallow parser, name entities, and others from various natural language processing (NLP) tools. For a sentence like The man went to the store, the annotations might look like: Word POS Chunk NER ==== === ===== ======== The DT NP Person man NN NP Person went VBD VP - to TO PP - the DT NP Location store NN NP Location I'd like to index a bunch of documents with annotations like these using Lucene and then perform searches across the different layers. An example of a simple query would be to retrieve all documents where Washington is tagged as a person. While I'm not absolutely committed to the notation, syntactically end-users might enter the query as follows: Query: Word=Washington,NER=Person I'd also like to do more complex queries involving the sequential order of annotations across different layers, e.g. find all the documents where there's a word tagged person followed by the words arrived at followed by a word tagged location. Such a query might look like: Query: "NER=Person Word=arrived Word=at NER=Location" What's a good way to go about approaching this with Lucene? Is there anyway to index and search over document fields that contain structured tokens?

    Read the article

  • Problem uploading app to google app engine

    - by Oberon
    I'm having problems uploading an app to the google-app-engine from my work place. I believe the problem is related to proxy, because I do not see the same problem when following the same procedure from home. (I do not specify HTTP_PROXY from home). These are the commands I run: HTTP_PROXY=http://proxy.<thehostname>.com:8080 HTTP_PROXY=https://proxy.<thehostname>.com:8080 appcfg.py --insecure update myappfolder When running the commands I get prompted for email and password, as expected, but after that it immediately exits with this errormessage: Error 302: --- begin server output --- <HTML> <HEAD> <TITLE>Moved Temporarily</TITLE> </HEAD> <BODY BGCOLOR="#FFFFFF" TEXT="#000000"> <H1>Moved Temporarily</H1> The document has moved <A HREF="https://www.google.com/accounts/ClientLogin">here</A>. </BODY> </HTML> --- end server output --- Note: I added the --insecure option because else it gave a warning of missing ssl module. Any idea how to solve or workaround this problem?

    Read the article

  • jQuery/ajax working on IIS5.1 but not IIS6

    - by Mikejh99
    I'm running a weird issue here. I have code that makes jquery ajax calls to a web service and dynamically adds controls using jquery. Everything works fine on my dev machine running IIS 5.1, but not when deployed to IIS 6. I'm using VS2010/ASP.Net 4.0, C#, jQuery 1.4.2 and jQuery UI 1.8.1. I'm using the same browser for each. It partially works though. The code will add the controls to the page, but they aren't visible until I click them (they aren't visible though). I thought this was a css issue, but the styles are there too. The ajax calls look like this: $.ajax({ url: "/WebServices/AssetManager.asmx/Assets", type: "POST", datatype: "json", async: false, data: "{'q':'" + req.term + "', 'type':'Condition'}", contentType: "application/javascript; charset=utf-8", success: function (data) { res($.map(data.d, function (item) { return { label: item.Name, value: item.Name, id: item.Id, datatype: item.DataType } })) } }) Changing the content-type makes the autocomplete fail. I've quadruple checked and all the paths are correct, there is no document footer enabled in IIS, and I'm not using IIS compression. Any idea why the page will display and work properly in IIS 5 but only partially in IIS 6? (If it failed completely, that'd make more sense!). Is it a jQuery or CSS issue?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Issue reading in a cell from Excel with Apache POI

    - by Nick
    I am trying to use Apache POI to read in old (pre-2007 and XLS) Excel files. My program goes to the end of the rows and iterates back up until it finds something that's not either null or empty. Then it iterates back up a few times and grabs those cells. This program works just fine reading in XLSX and XLS files made in Office 2010. I get the following error message: Exception in thread "main" java.lang.NumberFormatException: empty String at sun.misc.FloatingDecimal.readJavaFormatString(Unknown Source) at java.lang.Double.parseDouble(Unknown Source) at the line: num = Double.parseDouble(str); from the code: str = cell.toString(); if (str != "" || str != null) { System.out.println("Cell is a string"); num = Double.parseDouble(str); } else { System.out.println("Cell is numeric."); num = cell.getNumericCellValue(); } where the cell is the last cell in the document that's not empty or null. When I try to print the first cell that's not empty or null, it prints nothing, so I think I'm not accessing it correctly.

    Read the article

  • Embedding XSL Stylesheet into XML

    - by user700996
    I have the following XML: <?xml version="1.0" encoding="ISO-8859-1"?> <?xml-stylesheet type="text/xsl" href="http://www.fakedomain.com/sally.xsl"?> And the following content in sally.xsl: <?xml version="1.0" encoding="ISO-8859-1"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:template match="/"> <html> <body> <xsl:for-each select="documentcollection/document"> <p> <xsl:for-each select="rss/channel/item"> <xsl:value-of select="title"/><br /> <xsl:value-of select="description"/><br /> <xsl:value-of select="link"/><br /> </xsl:for-each> </p> </xsl:for-each> </body> </html> </xsl:template> </xsl:stylesheet> However, the browser displays the XML as though the XSL line is not present. Do you know why the browser is ignoring the XSL stylesheet? Is the style sheet wrong? Thanks

    Read the article

  • how do I call a javacript function every 60 seconds?

    - by William
    So I'm trying to work on a Canvas demo, and I want this square to move from one side to the other, but I can't figure out how to call javascript in a way that repeats every 60 seconds. Here's what I got so far: <!DOCTYPE html> <html lang="en"> <head> <title>Canvas test</title> <meta charset="utf-8" /> <link href="/bms/style.css" rel="stylesheet" /> <style> body { text-align: center; background-color: #000000;} canvas{ background-color: #ffffff;} </style> <script type="text/javascript"> var x = 50; var y = 250; function update(){ draw(); x = x + 5; } function draw(){ var canvas = document.getElementById('screen1'); if (canvas.getContext){ var ctx = canvas.getContext('2d'); ctx.fillStyle = 'rgb(236,138,68)'; ctx.fillRect(x,y,24,24); } } </script> </head> <body onLoad="setTimeout(update(), 0);"> <canvas id="screen1" width="500" height="500"></canvas> </body> </html>

    Read the article

  • Syntax for documenting JSON structure

    - by Roman A. Taycher
    So I'm trying to document the format of the json returned by an api I am writing against and I'd like to know if there is any popular format for the documentation of json structure. Note I'm not trying to to test or validate anything, I'm just using this for documentation. Also some ways to add comments to non-constants(items always returned w/ the same value) would be nice. This the not totally thought out scheme I'm currently using: Plain names refer to identifiers or types. Some types have type-comment Strings that appear to be constant(always returned for that type of request) strings are "str" Constant Numbers would be just the number Constant null is null Booleans are true/false for constant booleans or Boolean otherwise [a,b,c] are lists with 3 items a,b,c [... ...] is a list of repeating elements of some types/constants/patterns {a:A,b:B,c:c} and {... ...} is the same for a dictionary. example: story := [header,footer] header := {"data":realHeader,"kind":"Listing"} realHeader := {"after": null, "before": null, "children": [{"data": realRealHeader, "kind": "t3"}], "modhash": ""} footer := {"data":AlmostComments,"kind":"Listing"} AlmostComments := {"data": {"after": null, "before": null, "children": comments, "modhash": ""}, "kind": "t1"} comments := [...{"data":comment, "kind":"t1"}...] realRealHeader := {"author": string, "clicked": boolean, "created": int, "created_utc": int, "domain": "code.reddit.com", "downs": int, "hidden": boolean, "id": string-id, "is_self": boolean, "levenshtein": null, "likes": null, "media": null, "media_embed": { }, "name": string-id, "num_comments": int, "over_18": false, "permalink": string-urlLinkToStoryStartingFrom/r, "saved": false, "score": int, "selftext": string, "selftext_html": string-html, "subreddit": string-subredditname, "subreddit_id": string-id, "thumbnail": "", "title": string, "ups": int, "url": "http://code.reddit.com/" } comments := { "author": string, "body": string-body_html-wout-html, "body_html": string-html-formated, "created": int, "created_utc": int, "downs": int, "id": string-id, "levenshtein": null, "likes": null, "link_id": string-id, "name": string-id", "parent_id": string-id, "replies": AlmostComments or null, "subreddit": string-subredditname, "subreddit_id": string-id, "ups": int }

    Read the article

  • Set .aspx page title to that of an Eval

    - by user1860529
    I am trying to use an <%# Eval("name") %> to be the title of my page. I can't seem to figure out any solutions online. I have tried the other StackOverflow question but that did now work either. The page is a bio.aspx and on the site it is displayed as bio.aspx?id=123 so the page title needs to vary depending on the ID. I figured I could just use the Eval("name") but no luck yet. I currently am using JavaScript: window.onload = function() { document.title = '<%# Eval("name") %> | Title Line'; } This works, but it still leaves the title tags empty, and it's kind of spammy. Here is the codebehind: using System; using System.Data; using System.Configuration; using System.Collections; using System.Web; using System.Web.Security; using System.Web.UI; using System.Web.UI.WebControls; using System.Web.UI.WebControls.WebParts; using System.Web.UI.HtmlControls; public partial class DoctorBio : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { Page.Title = "Your Page Title"; HtmlMeta metaDescription = new HtmlMeta(); metaDescription.Name = "description"; metaDescription.Content = "brief description"; Page.Header.Controls.Add(metaDescription); HtmlMeta metaKeywords = new HtmlMeta(); metaKeywords.Name = "keywords"; metaKeywords.Content = "keywords, keywords"; Page.Header.Controls.Add(metaKeywords); } protected void SetPageTitle(object title) { this.Title = title.ToString(); } protected string ReplaceLineBreaks(object text) { string newText = text as string; if (newText == null) { return string.Empty; } return newText.Replace("\r\n", "<br />"); } }

    Read the article

  • Jquery selectors question

    - by Ben
    Hi all, I am not an expert at jquery but trying to get a menu to work. Basically, I have a menu made of up to 3 levels of nested lists. The first level has a little arrow has a background image that opens or close when opening the first level list. Any other nested lists don't need to have the background image. My script opens the menu when you click on it and is also supposed to switch the first level list from a class "inactive" to a class "active". Here is the script: $(document).ready(function(){ $("#left-navigation-holder ul.level1 li.inactive").toggle(function(){ $(this).addClass("active"); }, function () { $(this).removeClass("active"); }); $("#left-navigation-holder li a").click(function(){ menu = $(this).parent('li').children('ul'); menu.toggle(); }); }); The problem is that the toggle function also happens when clicking on second and third level lists causing the arrows to toggle even if the first level list isn't clicked on. I thought using $("#left-navigation-holder ul.level1 li.inactive").toggle would limit the function to the first level list with a class "inactive". Any help would be really appreciated. Ben

    Read the article

  • Execute javascript in PHP

    - by Andreas Bonini
    I'm generating your typical Web 2.0 HTML page with PHP: it contains a lot of <script> tags and javascript code that will substantially change the DOM after the load event. Is there a way to get the final HTML code directly from PHP, without opening the page with any browser? For example, let's say the HTML for the page is (it's just an example): <html> <head> <script>...the jquery library code...</script> <script>$(document).ready(function() { $("body").append("<p>Hi!</p>");</script> </head> <body> </body> </html> This HTML is saved in the $html PHP variable. Now, I want to pass that variable to some function that will return $result = <html>....<body><p>Hi!</p></body></html>. Is this possible?

    Read the article

  • Choosing a W3C valid DOCTYPE and charset combination?

    - by George Carter
    I have a homepage with the following: <DOCTYPE html> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"> My choice of the DOCTYPE "html" is based on a recommendation for html pages using jQuery. My choice of charset=utf=8 is based on a recommendation to make my pages readable on most browsers. But these choices may be wrong. When I run this page thru the W3C HTML validator, I get messages you see below. Any way I can eliminate the 2 errors? ! Using experimental feature: HTML5 Conformance Checker. The validator checked your document with an experimental feature: HTML5 Conformance Checker. This feature has been made available for your convenience, but be aware that it may be unreliable, or not perfectly up to date with the latest development of some cutting-edge technologies. If you find any issue with this feature, please report them. Thank you. Validation Output: 2 Errors 1. Error Line 18, Column 70: Changing character encoding utf-8 and reparsing. …ntent-Type" content="text/html; charset=utf-8"> 2. Error Line 18, Column 70: Changing encoding at this point would need non-streamable behavior. …ntent-Type" content="text/html; charset=utf-8">

    Read the article

  • Returning an integer from a select box - JavaScript

    - by Ross
    Very simply, I want to be able to access the year from the select box as an integer. In my test, my alertbox is telling me the value is undefined. <form name="form1" method="post" action=""> <label>birth year <select name="birth year" id="dueYear"> <OPTION VALUE='' SELECTED>--Year--</OPTION> <OPTION VALUE='2011'>2011</OPTION> <OPTION VALUE='2010'>2010</OPTION> <OPTION VALUE='2009'>2009</OPTION></SELECT> </select> </label> </form> <script type="text/javascript"> var dueDateYear = parseInt(document.getElementById("dueYear")); </script> <button onclick="alert(dueDateYear)">Click Me!</button> All I want it to do, is tell me the year I have selected -- any help would be appreciated, I am a newbie :(

    Read the article

  • How to access child div elements under a given condition with javascript?

    - by hlovdal
    My main question is to calculate the last alert message, but any other information is also welcome. I am trying to learn javascript (to use with greasemonkey later), but I am struggling a bit to grasp the DOM and how to process it. <html> <head> <script type="text/javascript"> function my_test() { var elements = document.getElementsByTagName("div"); // prints "found [object HTMLCollection] with length 8" alert("found " + elements + " with length " + elements.length); // prints "0:[object HTMLDivElement]" alert("0:" + elements[0]); // how to calculate the following? alert("for intereting one is AAAA and three is CCCC"); } </script> </head> <body> <div class="interesing"> <div class="one">AAAA</div> <div class="two">BBBB</div> <div class="three">CCCC</div> </div> <div class="boring"> <div class="one">1111</div> <div class="two">2222</div> <div class="three">3333</div> </div> <input type="button" onclick="my_test()" value="my test" </body> </html> So elements is now an array of elements and I can access each of them individually. But where can I find what methods/properties these elements have?

    Read the article

  • jQuery - Unchecking checkboxes that act like radio buttons

    - by Cecil
    Hey All, I have the following jQuery code to make my checkboxes act like radio buttons, so that only 1 of the 3 can be checked at a time. <script type="text/javascript" language="javascript"> $(document).ready(function() { $("#testing input:checkbox").change(function(){ var checkname = $(this).attr("name"); $("input:checkbox[name='" + checkname + "']").removeAttr("checked"); this.checked = true; }); }); </script> The checkboxes are layed out like the following: <input type="checkbox" id="testing" name="testing" value="B"> <input type="checkbox" id="testing" name="testing" value="I"> <input type="checkbox" id="testing" name="testing" value="A"> This works exactly how i want it to work, not a problem, except once i click one of the 3, i cant unclick it so that none of them are checked, this is what i want to happen, so along with being only able to click one at a time, im able to uncheck them completely. Any help would be grand :)

    Read the article

  • Why doesn't Javascript recognize the HTML class attribute?

    - by Cornflake
    Can anyone help me with a Javascript question, please? Why does the following code display only message boxes with the word "null" in them? And I think there are not enough of them either. <html> <head> <script type="text/javascript"> function showElementClasses(node) { var els = node.getElementsByTagName("*"); for(var i=0,j=els.length; i<j; i++) alert(els[i].getAttribute("class")); alert("Class: " + els[i].className); } showElementClasses(document); </script> </head> <body class="bla"> <div class="myclass" style="width: 500; height: 400" id="map"></div> </body> </html>

    Read the article

  • calling java script function then C# function after clicking ASP.NET button

    - by Eyla
    I have this serious: I have ASP.NET page, This page contents Update panel with ASP.NET control. I have Java script function to do validation so when I click the button I will use onclientclick to call the java function to do the validation and after this one done should call then event click button function from code behind. I tried vew methods but they did not work for me. here is sample of my code that after I click the button onclientclick will call the java script function for validation and if the validation is OK should call onclick event. .................... java script function ........................ <script type="text/javascript" > function add(){ if (tag == trye) { document.getElementById('<%=btnInfor.ClientID%>').click(); alert("DataAdded") } else { alert("Requiered Field Missing.") return false; } } </script> ..................... ASP.NET button ................... <asp:Button ID="btnInfor" runat="server" Text="Add Information" Style="position: absolute; top: 1659px; left: 433px;" onclientclick="JavaScript: return myAdd()" /> .................... code behind in C# ...................... protected void btnInfor_Click(object sender, EventArgs e) { \\mycode }

    Read the article

  • Select ID in table ...

    - by Kris-I
    Hello, I have this code <% foreach (var item in Model.List) { %> <tr> <td><%: item.LastName %></td> <td><%: item.FirstName %></td> <td><%: item.IsEnable %></td> <td><a href="#" class="CustomerEdit">Edit</a></td> <td><a href="#" class="CustomerDetail">Detail</a></td> <td><a href="#" class="CustomerDelete">Delete</a></td> </tr> <% } %> <script language="javascript" type="text/javascript"> $(document).ready(function () { $(".CustomerEdit").click(function () { alert("blabla"); //need id here }); }); </script> It's not in the code but I have an "Item.Id", it's not place anywhere because I don't know where place it ;-). I'd like when I click on the "Edit" hyperlink get the id (item.Id) of the current line. Any idea ? Thanks,

    Read the article

  • macro collapse all in solution visual studio 2010

    - by rod
    Hi All, I found the CollapseAll macro online that has worked for me in vs2005 and vs2008. However, this half way works in vs2010. It looks like it only collapses the top nodes and not any subnodes that may be expanded? any ideas? Thanks, rod. Sub CollapseAll() ' Get the the Solution Explorer tree Dim UIHSolutionExplorer As UIHierarchy UIHSolutionExplorer = DTE.Windows.Item(Constants.vsext_wk_SProjectWindow).Object() ' Check if there is any open solution If (UIHSolutionExplorer.UIHierarchyItems.Count = 0) Then ' MsgBox("Nothing to collapse. You must have an open solution.") Return End If ' Get the top node (the name of the solution) Dim UIHSolutionRootNode As UIHierarchyItem UIHSolutionRootNode = UIHSolutionExplorer.UIHierarchyItems.Item(1) UIHSolutionRootNode.DTE.SuppressUI = True ' Collapse each project node Dim UIHItem As UIHierarchyItem For Each UIHItem In UIHSolutionRootNode.UIHierarchyItems 'UIHItem.UIHierarchyItems.Expanded = False If UIHItem.UIHierarchyItems.Expanded Then Collapse(UIHItem) End If Next ' Select the solution node, or else when you click ' on the solution window ' scrollbar, it will synchronize the open document ' with the tree and pop ' out the corresponding node which is probably not what you want. UIHSolutionRootNode.Select(vsUISelectionType.vsUISelectionTypeSelect) UIHSolutionRootNode.DTE.SuppressUI = False End Sub Private Sub Collapse(ByVal item As UIHierarchyItem) For Each eitem As UIHierarchyItem In item.UIHierarchyItems If eitem.UIHierarchyItems.Expanded AndAlso eitem.UIHierarchyItems.Count > 0 Then Collapse(eitem) End If Next item.UIHierarchyItems.Expanded = False End Sub End Module

    Read the article

  • Capture and handling the tab/Textchanged event in a textbox in asp.net MVC

    - by Icerman
    I have the following code th handle a user name validation on the server side. But the event seems not firing since break points in js or C# code didn't hit. Can anyone point out where I did wrong? Here is the user control which has a user name textbox: <%: Html.TextBox("UserName", Model.Username, new { maxlength = "40", size = "20", tabindex = "1", @onchange = "CheckAvailability()" })% CheckAvailability() is defined in the User.Validation.js and included in the above user control: $(document).ready(function () { function CheckAvailability() { $.post("/Home/Survey/CheckAvailability", { Username: $("#UserName").val() }, function (data) { var myObject = eval('(' + data + ')'); var newid = myObject; if (newid == 0) { $("#usernamelookupresult").html("<font color='green'>Available :-D</font>") } else { $("#usernamelookupresult").html("<font color='red'>Taken :-(</font>") } }); } }); Here is the survey controller function which will have server side validation: [HttpPost] public ActionResult CheckAvailability(string Username) { int Taken = 0; // This is where you add your database lookup if (Username == "abc") { Taken = 1; } return Json(Taken); }

    Read the article

  • How to do drag-n-drop and resize on an image using jQuery?

    - by Scott
    How do I resize and image using jQuery but keep its aspect ratio the same? <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.1//EN" "http://www.w3.org/TR/xhtml11/DTD/xhtml11.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en"> <head> <title>CrossSlide - A jQuery plugin to create pan and cross-fade animations</title> <link href="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8/themes/base/jquery-ui.css" rel="stylesheet" type="text/css"/> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.4/jquery.min.js"></script> <script src="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8/jquery-ui.min.js"></script> </head> <body> <style type="text/css"> #resizebleImage { background: silver; } </style> <script type="text/javascript"> $(document).ready(function(){ $("#resizebleImage").resizable().parent().draggable(); }); </script> <img id="resizebleImage" src="http://images.askmen.com/galleries/singer/gloria-estefan/pictures/gloria-estefan-picture-4.jpg"> </body> </html>

    Read the article

  • Why aren't these Canvases rendering?

    - by bpapa
    I'm creating a web app that allows users to enter a number of colors, by specifying RGB values. Upon submission, the user will see a canvas with a solid rectangle drawn in the color chosen. On this page, I have 7 canvases. The first one draws just fine, but none of the rest show up. The browser is Safari. Here's the relevant code: First, the script element in the header, which defines the function I use to draw to the canvas. <script language="JavaScript" TYPE="text/javascript"><!-- function drawCanvas(canvasId, red, green, blue) { var theCanvas = document.getElementById("canvas" + canvasId); var context = theCanvas.getContext("2d"); context.clearRect(0,0,100,100); context.setFillColor(red,green,blue,1.0); context.fillRect(0,0,100,100); } // --> </script> Next, the HTML source, where I have my canvas tags and some embedded Javascript to call my drawCanvas function <canvas id="canvas0" width="100" height="100"> </canvas> <script language="JavaScript" TYPE="text/javascript"><!-- drawCanvas(0,250,0,0); // --> </script> . . //more source . <canvas id="canvas1" width="100" height="100"> </canvas> <script language="JavaScript" TYPE="text/javascript"><!-- drawCanvas(1,4,250,6); // --> </script> Also provided is a screenshot. As you can see, the "red" canvas comes up just fine, but the second one, which should be green, doesn't show up at all. Any ideas?

    Read the article

  • How do I use a jQuery not selector to select relative URLs?

    - by Matt
    I'm working on a little jQuery script to add Google Analytics pageTracker onclick data to all relative URLs on my forum, allowing me to track clicks to external sites. I don't want to add the onclick to internal links on forum.sitename or sitename, and I don't want to add them to any hrefs marked # or that start with /. My script below works nicely, but for one minor problem! All of the forum's URLs are relative and don't start with /. I appear to have no way to change that, so need to modify the jQuery below to prevent it adding the onclick to links like as it currently does. What I want to do, is to write a .not() function like .not("[href!^=http") to prevent jQuery from adding the onclick to any hrefs which do not start with http. However, .not() appears not to support this. I'm new to jQuery and can't figure this out. Any pointers would be massively appreciated. $(document).ready(function(){ // Get URL from a href var URL = $("a").attr('href'); // Add pageTracker data for GA tracking $("a") .not("[href^=#]") .not("[href^=http://forum.sitename]") .not("[href^=http://www.sitename]") .attr("onclick","pageTracker._trackEvent('Outgoing_Links', 'Forum', " + URL + ");") ; }); Thanks!

    Read the article

  • Google Charts - Adding Tooltip to Colorized Column Chart

    - by David K
    I created a column chart with google charts that has a different color assigned to each column using the following posting: Assign different color to each bar in a google chart But now I'm trying to figure out how to customize the tooltips for each column to also include the number of users in addition to the percent, so "raw_data[i][1]" I would like it to look like "70% (80 Users)" I understand that there is "data.addColumn({type:'number',role:'tooltip'});" but I'm having trouble understanding how to implement it for this use-case. function drawAccountsChart() { var data = new google.visualization.DataTable(); var raw_data = [ ['Parents', 80, 160], ['Students', 94, 128], ['Teachers', 78, 90], ['Admins', 68, 120], ['Staff', 97, 111] ]; data.addColumn('string', 'Columns'); for (var i = 0; i < raw_data.length; ++i) { data.addColumn('number', raw_data[i][0]); } data.addRows(1); for (var i = 0; i < raw_data.length; ++i) { data.setValue(0, i+1, raw_data[i][1]/raw_data[i][2]*100); } var options = { height:220, chartArea: { left:30, width: "70%", height: "70%" }, backgroundColor: { fill:"transparent" }, tooltop:{ textStyle: {fontSize: "12px",}}, vAxis: {minValue: 0} }; var formatter = new google.visualization.NumberFormat({ suffix: '%', fractionDigits: 1 }); formatter.format(data, 1); formatter.format(data, 2); formatter.format(data, 3); formatter.format(data, 4); formatter.format(data, 5); var chart = new google.visualization.ColumnChart(document.getElementById('emailAccountsChart')); chart.draw(data, options); }

    Read the article

  • Passing jquery JSON from Codeigniter controller to view

    - by dede
    I've been struggling to make it work, but cannot pass the inserted data from the controler to the view in CI using JSON. The input value from the form is successfully inserted into the database, but cannot make it appear in the view. This is my view file ajax_view.php: <script type="text/javascript" src="<?php echo base_url(); ?>js/jquery-1.4.2.min.js"></script> $(document).ready(function(){ $("#submit").click(function(){ var inp = $('#inp').val(); $.post("ajax/ajax_input", { 'send' : inp }, function(data){ alert(data.input_text); }, "json"); }); }); </script> </head> <body> <form id="form1" method="post" action=""> <label for="inp">Text</label> <input type="text" name="inp" id="inp" /> <label for="submit"></label> <input type="submit" name="submit" id="submit" value="Submit" /> And this is the ajax_input method of the ajax.php controller: <?php // Initializing controller ..... // ............................. //ajax method function ajax_input(){ $var_1 = trim($this->input->post('send')); $array = array('input_text' => $var_1); echo json_encode($array); $this->db->insert('ajax',$array); } Trying to debug it with Firebug, it gives me that data.input_text is empty. What am I doing wrong? EDIT: I'm using XAMPP on Win, so is it posible that json configuration is the problem?

    Read the article

< Previous Page | 546 547 548 549 550 551 552 553 554 555 556 557  | Next Page >