Search Results

Search found 34207 results on 1369 pages for 'query output'.

Page 550/1369 | < Previous Page | 546 547 548 549 550 551 552 553 554 555 556 557  | Next Page >

  • My rewrite rule is not working

    - by DijkeMark
    I need to make a rewrite rule for a page, but it does not work. I do have mod_rewrite for apache enabled This is my .htacces file: <IfModule mod_rewrite.c> RewriteEngine on RewriteRule ^gameofthrones/(full|house|characters)\.(all|Stark|Lannister)\.(html|xml|json)$ index.php?output=$3&house=$2&info=$1 </IfModule> But when I enter this url: localhost/school/str-webservices/eindopdracht/index.php?output=html&house=all&info=full It stays that way, but it should be something like: localhost/school/str-webservices/eindopdracht/gameofthrones/full/all/html What am I doing wrong? Thanks in advance, Mark

    Read the article

  • Firing events in script task

    - by Anonymouslemming
    I've got an SSIS project where I am constructing an SQL command based on some variables. I'm constructing the command in a script task, and want to output the constructed SQL to the 'Execution Results' window. I am trying to do this using a FireInformation line from inside my script as follows: Dts.Events.FireInformation(99, "test", "Make this event appear!", "", 0, true); However, in the script editor when editing ScriptMain.cs, that line is underlined in red, and on mouseover, I get the following message: Error: The best overloaded method match for 'Microsoft.SqlServer.Dts.Tasks.ScriptTask.EventsObjectWrapper.FireInformation(int, string, string, string, int, ref bool') has some invalid arguments As a result, my script does not compile and I cannot execute it. Any idea what I'm doing wrong here, or what I need to change to be able to see the values of my variables at this point in the Execution output?

    Read the article

  • Python structure mistake

    - by jaddy123
    I'm writing a program in which I can Reverse the sequence and Replace all As with Ts, all Cs with Gs, all Gs with Cs, and all Ts with As. the program is to read a sequence of bases and output the reverse complement sequence. I am having trouble to do it so can anyone please help me with this by having a look on my code: word = raw_input("Enter sequence: ") a = word.replace('A', 'T') b = word.replace('C', 'G') c = word.replace('G', 'C') d = word.replace('T', 'A') if a == word and b == word and c == word and d == word: print "Reverse complement sequence: ", word And I want this sort of output: Enter sequence: CGGTGATGCAAGG Reverse complement sequence: CCTTGCATCACCG Regards

    Read the article

  • MySQL "IS IN" equivalent?

    - by nute
    A while ago I worked on a MS-SQL project and I remember a "IS IN" thing. I tried it on a MySQL project and it did not work. Is there an equivalent? Workaround? Here is the full query I am trying to run: SELECT * FROM product_product, product_viewhistory, product_xref WHERE ( (product_viewhistory.productId = product_xref.product_id_1 AND product_xref.product_id_2 = product_product.id) OR (product_viewhistory.productId = product_xref.product_id_2 AND product_xref.product_id_1 = product_product.id) ) AND product_product.id IS IN (SELECT DISTINCT pvh.productId FROM product_viewhistory AS pvh WHERE pvh.cookieId = :cookieId ORDER BY pvh.viewTime DESC LIMIT 10) AND product_viewhistory.cookieId = :cookieId AND product_product.outofstock='N' ORDER BY product_xref.hits DESC LIMIT 10 It's pretty big ... but the part I am interested in is: AND product_product.id IS IN (SELECT DISTINCT pvh.productId FROM product_viewhistory AS pvh WHERE pvh.cookieId = :cookieId ORDER BY pvh.viewTime DESC LIMIT 10) Which basically says I want the products to be in the "top 10" of that sub-query. How would you achieve that with MySQL (while trying to be efficient)?

    Read the article

  • Using template specialization in C++

    - by user550413
    How can I write a function using template specialization that has 2 different input types and an output type: template <class input1, class input2, class output> and return the sum of the 2 numbers (integers/doubles). However, if I get 2 integers I want to return an integer type but for any other combinations of integer and double I'll always return double. I am trying to do that without using directly the '+' operator but having the next functions instead: double add_double_double(double a, double b) {return (a+b);} double add_int_double(int a, double b) {return ((double)(a)+b);} int add_int_int(int a, int b) {return (a+b);}

    Read the article

  • MySQL : Calculate business day difference between two dates column

    - by yokoyoko
    My sql query returns back two columns, first column is "date created" and second column is "date updated", first column has a prior timestamp with respect to second column. I need to add a third column which can display business day hrs (9:00am to 5:00pm) response i.e. if date created is 2012-01-01 09:00:20 and "dated updated" is 4:00pm same day then third column should display 7 hrs If date created is 2012-01-01 16:00:20 (4:00pm) and "date updated" is 10:00m on 2012:01:02 (2nd Jan) then third column should display 2 hrs. It should exclude Saturday and Sunday. Can you please suggest appropriate SQL query for this.

    Read the article

  • SQL Select between two fields depending on the value of one field

    - by Filip
    Hi. I am using a PostgreSQL database, and in a table representing some measurements I've two columns: measurement, and interpolated. In the first I've the observation (measurement), and b is the interpolated value depending on nearby values. Every record with an original value has also an interpolated value. However, there are a lot of records without "original" observations (NULL), hence the values are interpolated and stored in the second column. So basically there are just two cases in the database: Value Value NULL Value Of course, it is preferable to use the value from the first column if available, hence I need to build a query to select the data from the first column, and if not available (NULL), then the database returns the value from the second column for the record in question. I have no idea how to build the SQL query. Please help. Thanks.

    Read the article

  • how to get key value of array with curl (php)

    - by Vierri
    Hello I want to make use of an API but it print alot of info and i don't know how i can get a few key values of the array. <?php $query = "SELECT * FROM kvk WHERE adres='Wit-geellaan 158'"; $host = "http://api.openkvk.nl/php/"; $url = $host ."/". rawurlencode($query); $curl = curl_init(); curl_setopt($curl, CURLOPT_FOLLOWLOCATION, 1); curl_setopt($curl, CURLOPT_URL, $url); curl_setopt($curl, CURLOPT_HEADER, 0); curl_exec($curl); curl_close($curl); ?> Is my php script and it shows array(array("RESULT"=>array("TYPES"=>array("int","bigint","varchar","varchar","varchar","varchar","varchar","int","int","smallint","smallint","int"),"HEADER"=>array("id","kvk","bedrijfsnaam","adres","postcode","plaats","type","kvks","sub","bedrijfsnaam_size","adres_size","verhuisd"),"ROWS"=>array(array("1303095","271242250000","Schoonmaakbedrijf Regio","Wit-geellaan 158","2718CK","Zoetermeer","Hoofdvestiging","27124225","0","23","16","0"))))) Thanks in advance Greetings, Vierri

    Read the article

  • How can I get the JSON array data from nsstring or byte in xcode 4.2?

    - by user1471568
    I'm trying to get values from nsdata class and doesn't work. here is my JSON data. { "count": 3, "item": [{ "id": "1", "latitude": "37.556811", "longitude": "126.922015", "imgUrl": "http://175.211.62.15/sample_res/1.jpg", "found": false }, { "id": "3", "latitude": "37.556203", "longitude": "126.922629", "imgUrl": "http://175.211.62.15/sample_res/3.jpg", "found": false }, { "id": "2", "latitude": "37.556985", "longitude": "126.92286", "imgUrl": "http://175.211.62.15/sample_res/2.jpg", "found": false }] } and here is my code -(NSDictionary *)getDataFromItemList { NSData *dataBody = [[NSData alloc] initWithBytes:buffer length:sizeof(buffer)]; NSDictionary *iTem = [[NSDictionary alloc]init]; iTem = [NSJSONSerialization JSONObjectWithData:dataBody options:NSJSONReadingMutableContainers error:nil]; NSLog(@"id = %@",[iTem objectForKey:@"id"]); //for Test output = [[NSString alloc] initWithBytes:buffer length:rangeHeader.length encoding:NSUTF8StringEncoding]; NSLog(@"%@",output); return iTem; } how can I access every value in the JSON? Please help me.

    Read the article

  • making links with out anchor tag using dojo

    - by vetri
    I have a image with link <div id="img"><a href="src/blah.html"><img src="/src/img.png"/></a></div> but i don't wanna use tag for linking.the page has multiple entries like this in a page as it is being populated for a search result.Some 10 or more entries will be there in a page.its all inside a <div id="result"></div> have an idea for doing it dojo.help me finish that function(){ dojo.query('.Result').forEach(function(item){ try{ var href = dojo.query('.img',item)[0] //do things dojo.connect(Node,'onclick',dojo.hitch(this,function(){ window.location = location; }));

    Read the article

  • Concatinate integer arrays iteratively

    - by Ojtwist
    I have a methode in2.getImagesOneDim() which gives me an array of integers, to be more precise the pixel values of an image. Now i want to create one big array with all the pixel values of all the images. Therefore I have to call this method several times. Now I would like to concatenate the previous output to the current output until all images are read. In some kind of pseudo code, where the + is a concatination ... : for (int i = 1; i < 25; i++) { ConArray = ConArray + in2.getImagesOneDim("../images/"+i); } How would I do this in java ?

    Read the article

  • Increment number in string

    - by iform
    Hi, I am stumped... I am trying to get the following output until a certain condition is met. test_1.jpg test_2.jpg .. test_50.jpg The solution (if you could remotely call it that) that I have is fileCount = 0 while (os.path.exists(dstPath)): fileCount += 1 parts = os.path.splitext(dstPath) dstPath = "%s_%d%s" % (parts[0], fileCount, parts[1]) however...this produces the following output. test_1.jpg test_1_2.jpg test_1_2_3.jpg .....etc The Question: How do I get change the number in its current place (without appending numbers to the end)? Ps. I'm using this for a file renaming tool.

    Read the article

  • Detecting when a process has finished (but not exited)

    - by Egwor
    I have a program that's run in unix (that I have no control over) that when finished prints 'Completed successfully' but does not exit. I want to automatically detect when the process finishes (by checking the output of the command), so that I can kill the process and so that I can proceed do other activities. The complexity comes because I want to be able to run multiples of these scripts concurrently. (One activity I need to do requires the script to be called with various inputs, but each time the script runs it takes a while to return, and so I want to do them in parallel) Has anyone done something similar to this? I could redirect the stderr and stdout output of the command to a temporary file which has a random file name, then tail the file and pipe to grep for the end conditions (I.e. the certain log lines). The problem is, surely tail -f would keep running, and so it would never exit. Should I poll? If so, what's the best approach?

    Read the article

  • Coalesce and Case-When with To_Date not working as expected (Postgres bug?)

    - by ADTC
    I'm using Postgres 9.1. The following query does not work as expected. Coalesce should return the first non-null value. However, this query returns null (1?) instead of the date (2). select COALESCE( TO_DATE('','yyyymmdd'), --(1) TO_DATE('20130201','yyyymmdd') --(2) ); --(1) this evaluates independently to null --(2) this evaluates independently to the date, and therefore is the first non-null value What am I doing wrong? Any workaround? Edit: This may have nothing to do with Coalesce at all. I tried some experiments with Case When constructs; it turns out, Postgres has this big ugly bug where it treats TO_DATE('','yyyymmdd') as not null, even though selecting it returns null.

    Read the article

  • GAE JCache NumberFormatException, will I need to write Java to avoid?

    - by Jasper
    This code below produces a NumberFormatException in this line: val cache = cf.createCache(Collections.emptyMap()) Do you see any errors? Will I need to write a Java version to avoid this, or is there a Scala way? ... import java.util.Collections import net.sf.jsr107cache._ object QueryGenerator extends ServerResource { private val log = Logger.getLogger(classOf[QueryGenerator].getName) } class QueryGenerator extends ServerResource { def getCounter(cache:Cache):long = { if (cache.containsKey("counter")) { cache.get("counter").asInstanceOf[long] } else { 0l } } @Get("html") def getHtml(): Representation = { val cf = CacheManager.getInstance().getCacheFactory() val cache = cf.createCache(Collections.emptyMap()) val counter = getCounter(cache) cache.put("counter", counter + 1) val q = QueueFactory.getQueue("query-generator") q.add(TaskOptions.Builder.url("/tasks/query-generator").method(Method.GET).countdownMillis(1000L)) QueryGenerator.log.warning(counter.toString) new StringRepresentation("QueryGenerator started!", MediaType.TEXT_HTML) } } Thanks!

    Read the article

  • LinqToSql Sub Entiity Multiple And Operators

    - by halit
    Hi I have an Array of Featureset Id , My Vehicles table has got sub table as FeatureSets I wrote Sql Query Like SELECT [t0].[ID] FROM [dbo].[SearchResultView] AS [t0] Join [dbo].[VehicleFeatureSet] AS [t1] on t0.ID = t1.VehicleID where t1.FeatureSetID = 1 and t1.FeatureSetID= 2 and t1.FeatureSetID= 3 I tried. But I Couldn't var features = Request.QueryString["FeatureSets"].Split(',').ToList().ConvertAll(new Converter<string, int>(StrinToint)); IQueryable<SearchResultView> result = db.SearchResultViews.Where(m => m.Active == true); foreach (var featuree in features) { result = result.Where(m => m.VehicleFeatureSets.Any(c => c.FeatureSetID == featuree)); } How Can I write this LINQ Query

    Read the article

  • Are these 2 sql queries equivalent in all respects (e.g. estimated and actual execution plan)?

    - by Xerion
    Are query 1) == 2) in terms of estimated query plan AND actual plan? (can statistics affect the actual plan here, ever?) declare @cat int -- input param from prc ... 1) select * from A as a join B as b on b.id = a.id on b.cat = @cat join C as c on c.fid = b.fid on c.cat = @cat where a.cat = @cat 2) select * from A as a join B as b on b.id = a.id on b.cat = a.cat join C as c on c.fid = b.fid on c.cat = b.cat where a.cat = @cat It seems to me that these should logically be equivalent and the execution plan should always be the same regardless of actual difference in tables. And adding more conditions either in join, or where, or add more tables to join shouldn't change this. Are there cases this is not true?

    Read the article

  • it is possible to "group by" without losing the original rows?

    - by toPeerOrNotToPeer
    i have a query like this: ID | name | commentsCount 1 | mysql for dummies | 33 2 | mysql beginners guide | 22 SELECT ..., commentsCount // will return 33 for first row, 22 for second one FROM mycontents WHERE name LIKE "%mysql%" also i want to know the total of comments, of all rows: SELECT ..., SUM(commentsCount) AS commentsCountAggregate // should return 55 FROM mycontents WHERE name LIKE "%mysql%" but this one obviously returns a single row with the total. now i want to merge these two queries in one single only, because my actual query is very heavy to execute (it uses boolean full text search, substring offset search, and sadly lot more), then i don't want to execute it twice is there a way to get the total of comments without making the SELECT twice? !! custom functions are welcome !! also variable usage is welcome, i never used them...

    Read the article

  • Run a proc on several different values of one parameter

    - by WEFX
    I have the following query that gets run within a proc. The function MyFunction returns a table, and this query joins on that table. This proc works great when a @MyArg value is supplied. However, I’m wondering if there’s a way to run this on all @MyArg values in the database. I’m sure there’s a way to do it within a loop, but I know that loops are generally to be avoided at the db layer. I really just need to perform this for the sake of checking (and possibly cleansing) some bad data. SELECT ColumnA, ColumnB, ColumnC FROM ( SELECT a.ColumnA, a.ColumnB, a.ColumnC, ROW_NUMBER() over(partition by a.ColumnD order by f.ColumnX) as RowNum FROM dbo.MyTableA AS a INNER JOIN dbo.MyFunction(@MyArg) f ON f.myID = a.myID WHERE (a.myBit = 1 OR a.myID = @MyArg) ) AS x WHERE x.rownum = 1;

    Read the article

  • Java PreparedStatement Throws MySQLSyntaxErrorException

    - by sqlBugs
    I have the following Java code: String query = "Select 1 from myTable where name = ? and age = ?"; PreparedStatement stmt = conn.prepareStatement(query); stmt.setString(1, name); stmt.setInt(2, age); ResultSet rs = stmt.executeQuery(); Whenever I run the above code, it throws an exception on line 2 (where the PreparedStatement is declared): Error 0221202: SQLException = com.mysql.jdbc.exceptions.MySQLSyntaxErrorException: You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near '? AND age = ?' at line 1 Does anyone have any suggestions about what I am doing wrong? Thanks!

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • PHP/MySQL Interview - How would you have answered?

    - by martincarlin87
    I was asked this interview question so thought I would post it here to see how other users would answer: Please write some code which connects to a MySQL database (any host/user/pass), retrieves the current date & time from the database, compares it to the current date & time on the local server (i.e. where the application is running), and reports on the difference. The reporting aspect should be a simple HTML page, so that in theory this script can be put on a web server, set to point to a particular database server, and it would tell us whether the two servers’ times are in sync (or close to being in sync). This is what I put: // Connect to database server $dbhost = 'localhost'; $dbuser = 'xxx'; $dbpass = 'xxx'; $dbname = 'xxx'; $conn = mysql_connect($dbhost, $dbuser, $dbpass) or die (mysql_error()); // Select database mysql_select_db($dbname) or die(mysql_error()); // Retrieve the current time from the database server $sql = 'SELECT NOW() AS db_server_time'; // Execute the query $result = mysql_query($sql) or die(mysql_error()); // Since query has now completed, get the time of the web server $php_server_time = date("Y-m-d h:m:s"); // Store query results in an array $row = mysql_fetch_array($result); // Retrieve time result from the array $db_server_time = $row['db_server_time']; echo $db_server_time . '<br />'; echo $php_server_time; if ($php_server_time != $db_server_time) { // Server times are not identical echo '<p>Database server and web server are not in sync!</p>'; // Convert the time stamps into seconds since 01/01/1970 $php_seconds = strtotime($php_server_time); $sql_seconds = strtotime($db_server_time); // Subtract smaller number from biggest number to avoid getting a negative result if ($php_seconds > $sql_seconds) { $time_difference = $php_seconds - $sql_seconds; } else { $time_difference = $sql_seconds - $php_seconds; } // convert the time difference in seconds to a formatted string displaying hours, minutes and seconds $nice_time_difference = gmdate("H:i:s", $time_difference); echo '<p>Time difference between the servers is ' . $nice_time_difference; } else { // Timestamps are exactly the same echo '<p>Database server and web server are in sync with each other!</p>'; } Yes, I know that I have used the deprecated mysql_* functions but that aside, how would you have answered, i.e. what changes would you make and why? Are there any factors I have omitted which I should take into consideration? The interesting thing is that my results always seem to be an exact number of minutes apart when executed on my hosting account: 2012-12-06 11:47:07 2012-12-06 11:12:07

    Read the article

  • How to easily get the unmatched condition in mysql

    - by leivli
    I have a "server" table which has a column named 'SN' in mysql, when do query to retrive servers with some sns from 'sn1' to 'sn10000', we can: select * from server where sn in ('sn1','sn2','sn3',...'sn10000'); If there is only one sn in 'sn1'-'sn10000' which not exists in database, then the query above will retrive 9999 rows of result. The question is how can I easily get which one in 'sn1'-'sn10000' is not exists in database except the additional work, such as handling the result with shell script etc. I have an ugly sql like below can use: select * from (select 'sn1' as sn union select 'sn2' union select 'sn3' .... union select 'sn10000') as SN where not exists (select id from server where server.sn=SN.sn); Is Anyone has other better methods? Thanks.

    Read the article

  • Getting Null value with JSON from MySQL, how to retrive data from MySQL to JSON correctly?

    - by sky
    I'm using following code but cannot return data from MySQL. This is the output: <script type="text/javascript"> var somethings= [null,null,null]; </script> It does have three post, but I couldn't get the title(message) output. EDIT: this is the code I'm using: <?php $session = mysql_connect('localhost','name','pass'); mysql_select_db('dbname', $session); $result= mysql_query('SELECT * FROM posts', $session); $somethings= array(); while ($row= mysql_fetch_assoc($result)) { $somethings[]= $row['something']; } ?> <script type="text/javascript"> var somethings= <?php echo json_encode($somethings); ?>; </script> This is the table: message Try iPhone post! Welcome to Yo~ :) ??!

    Read the article

< Previous Page | 546 547 548 549 550 551 552 553 554 555 556 557  | Next Page >