Search Results

Search found 14799 results on 592 pages for 'instance eval'.

Page 551/592 | < Previous Page | 547 548 549 550 551 552 553 554 555 556 557 558  | Next Page >

  • Several client waiting for the same event

    - by ff8mania
    I'm developing a communication API to be used by a lot of generic clients to communicate with a proprietary system. This proprietary system exposes an API, and I use a particular classes to send and wait messages from this system: obviously the system alert me that a message is ready using an event. The event is named OnMessageArrived. My idea is to expose a simple SendSyncMessage(message) method that helps the user/client to simply send a message and the method returns the response. The client: using ( Communicator c = new Communicator() ) { response = c.SendSync(message); } The communicator class is done in this way: public class Communicator : IDisposable { // Proprietary system object ExternalSystem c; String currentRespone; Guid currentGUID; private readonly ManualResetEvent _manualResetEvent; private ManualResetEvent _manualResetEvent2; String systemName = "system"; String ServerName = "server"; public Communicator() { _manualResetEvent = new ManualResetEvent(false); //This methods are from the proprietary system API c = SystemInstance.CreateInstance(); c.Connect(systemName , ServerName); } private void ConnectionStarter( object data ) { c.OnMessageArrivedEvent += c_OnMessageArrivedEvent; _manualResetEvent.WaitOne(); c.OnMessageArrivedEvent-= c_OnMessageArrivedEvent; } public String SendSync( String Message ) { Thread _internalThread = new Thread(ConnectionStarter); _internalThread.Start(c); _manualResetEvent2 = new ManualResetEvent(false); String toRet; int messageID; currentGUID = Guid.NewGuid(); c.SendMessage(Message, "Request", currentGUID.ToString()); _manualResetEvent2.WaitOne(); toRet = currentRespone; return toRet; } void c_OnMessageArrivedEvent( int Id, string root, string guid, int TimeOut, out int ReturnCode ) { if ( !guid.Equals(currentGUID.ToString()) ) { _manualResetEvent2.Set(); ReturnCode = 0; return; } object newMessage; c.FetchMessage(Id, 7, out newMessage); currentRespone = newMessage.ToString(); ReturnCode = 0; _manualResetEvent2.Set(); } } I'm really noob in using waithandle, but my idea was to create an instance that sends the message and waits for an event. As soon as the event arrived, checks if the message is the one I expect (checking the unique guid), otherwise continues to wait for the next event. This because could be (and usually is in this way) a lot of clients working concurrently, and I want them to work parallel. As I implemented my stuff, at the moment if I run client 1, client 2 and client 3, client 2 starts sending message as soon as client 1 has finished, and client 3 as client 2 has finished: not what I'm trying to do. Can you help me to fix my code and get my target? Thanks!

    Read the article

  • jquery 1.4.1 breaks my slideshow

    - by JMC Creative
    After toying with the jquery slideshow extension, I created my own that better suited my purposes ( I didn't like that all the images needed to load at the beginning for instance). Now, upon upgrading to jQuery 1.4.2 (I know I'm late), the slideshow loads the first image fine ( from the line$('div#slideshow img#ssone').fadeIn(1500); towards the bottom), but doesn't do anything beyond that. Does anyone have any idea which jquery construct is killing my script? The live page is at lplonline.org which is using 1.3.2 for the time being. Thanks in advance. Array.prototype.random = function( r ) { var i = 0, l = this.length; if( !r ) { r = this.length; } else if( r > 0 ) { r = r % l; } else { i = r; r = l + r % l; } return this[ Math.floor( r * Math.random() - i ) ]; }; jQuery(function($){ var imgArr = new Array(); imgArr[1] = "wp-content/uploads/rotator/Brbrshop4-hrmnywkshp72006.jpg"; imgArr[2] = "wp-content/uploads/rotator/IMGA0125.JPG"; //etc, etc, about 30 of these are created dynamically from a db function randImgs () { var randImg = imgArr.random(); var img1 = $('div#slideshow img#ssone'); var img2 = $('div#slideshow img#sstwo'); if(img1.is(':visible') ) { img2.fadeIn(1500); img1.fadeOut(1500,function() { img1.attr({src : randImg}); }); } else { img1.fadeIn(1500); img2.fadeOut(1500,function() { img2.attr({src : randImg}); }); } } setInterval(randImgs,9000); // 9 SECONDS $('div#slideshow img#ssone').fadeIn(1500); }); </script> <div id="slideshow"> <img id="ssone" style="display:none;" src="wp-content/uploads/rotator/quote-investments.png" alt="" /> <img id="sstwo" style="display:none;" src="wp-content/uploads/rotator/quote-drugs.png" alt="" /> </div>

    Read the article

  • Is Abstract Factory Pattern implemented correctly for given scenario.... ???

    - by Amit
    First thing... I am novice to pattern world, so correct me if wrong anywhere Scenario: There are multiple companies providing multiple products of diff size so there are 3 entities i.e. Companies, Their Product and size of product I have implement Abstract Pattern on this i.e. so that I will create instance of IProductFactory interface to get desired product... Is below implementation of Abstract Factory Pattern correct ??? If not then please correct the approach + Also tell me if any other pattern can be used for such scenario Thanks in advance... public enum Companies { Samsung = 0, LG = 1, Philips = 2, Sony = 3 } public enum Product { PlasmaTv = 0, DVD = 1 } public enum ProductSize { FortyTwoInch, FiftyFiveInch } interface IProductFactory { IPhilips GetPhilipsProduct(); ISony GetSonyProduct(); } interface ISony { string CreateProducts(Product product, ProductSize size); } interface IPhilips { string CreateProducts(Product product, ProductSize size); } class ProductFactory : IProductFactory { public IPhilips GetPhilipsProduct() { return new Philips(); } public ISony GetSonyProduct() { return new Sony(); } } class Philips : IPhilips { #region IPhilips Members public string CreateProducts(Product product, ProductSize size) {// I have ingnore size for now.... string output = string.Empty; if (product == Product.PlasmaTv) { output = "Plasma TV Created !!!"; } else if (product == Product.DVD) { output = "DVD Created !!!"; } return output; } #endregion } class Sony : ISony {// I have ingnore size for now.... #region ISony Members public string CreateProducts(Product product, ProductSize size) { string output = string.Empty; if (product == Product.PlasmaTv) { output = "Plasma TV Created !!!"; } else if (product == Product.DVD) { output = "DVD Created !!!"; } return output; } #endregion } IProductFactory prodFactory = new ProductFactory(); IPhilips philipsObj = prodFactory.GetPhilipsProduct(); MessageBox.Show(philipsObj.CreateProducts(Product.DVD, ProductSize.FortyTwoInch)); or //ISony sonyObj = prodFactory.GetSonyProduct(); //MessageBox.Show(sonyObj.CreateProducts(Product.DVD, ProductSize.FortyTwoInch));

    Read the article

  • Parallel programming in C#

    - by Alxandr
    I'm interested in learning about parallel programming in C#.NET (not like everything there is to know, but the basics and maybe some good-practices), therefore I've decided to reprogram an old program of mine which is called ImageSyncer. ImageSyncer is a really simple program, all it does is to scan trough a folder and find all files ending with .jpg, then it calculates the new position of the files based on the date they were taken (parsing of xif-data, or whatever it's called). After a location has been generated the program checks for any existing files at that location, and if one exist it looks at the last write-time of both the file to copy, and the file "in its way". If those are equal the file is skipped. If not a md5 checksum of both files is created and matched. If there is no match the file to be copied is given a new location to be copied to (for instance, if it was to be copied to "C:\test.jpg" it's copied to "C:\test(1).jpg" instead). The result of this operation is populated into a queue of a struct-type that contains two strings, the original file and the position to copy it to. Then that queue is iterated over untill it is empty and the files are copied. In other words there are 4 operations: 1. Scan directory for jpegs 2. Parse files for xif and generate copy-location 3. Check for file existence and if needed generate new path 4. Copy files And so I want to rewrite this program to make it paralell and be able to perform several of the operations at the same time, and I was wondering what the best way to achieve that would be. I've came up with two different models I can think of, but neither one of them might be any good at all. The first one is to parallelize the 4 steps of the old program, so that when step one is to be executed it's done on several threads, and when the entire of step 1 is finished step 2 is began. The other one (which I find more interesting because I have no idea of how to do that) is to create a sort of worker and consumer model, so when a thread is finished with step 1 another one takes over and performs step 2 at that object (or something like that). But as said, I don't know if any of these are any good solutions. Also, I don't know much about parallel programming at all. I know how to make a thread, and how to make it perform a function taking in an object as its only parameter, and I've also used the BackgroundWorker-class on one occasion, but I'm not that familiar with any of them. Any input would be appreciated.

    Read the article

  • JQuery Datepicker Date highlight Issue

    - by Isola Olufemi
    I have an in-line date picker in which I want to highlight some dates based on array of strings from the server side. I found out the on load of the page with the datepicker, events the matches in the current month will not be highlighted. when I click the next month button the events on the next moth will be highlighted. What I discovered that i the matching only get highlighted when I click to the next month and not when I click back to the previous month. Below is my script: var actionCalDates = new Array(); function getDates(month, year) { $.ajax({ url: "/Index/GetAllAlerts", data: { month: month, year: year }, success: function (result) { var date = new Date(); var i = new Number(date.getMonth()); i += 1; actionCalDates = result.split(","); } }); } function getTitle(ar, d) { var result = ""; for (var i = 0; i < ar.length; i++) { if (ar[i].indexOf(d) != -1) { var e = actionCalDates[i].split(";"); result += e[0] + "\n"; } } return result; } $('#calendar').datepicker({ numberOfMonths: [1, 1], showCurrentAtPos: 0, dateFormat: 'dd/mm/y', beforeShowDay: function (thedate) { var theday = thedate.getDate(); var x = new Number(thedate.getMonth()); x += 1; var date = thedate.getDate() + "/" + x + "/" + thedate.getFullYear(); getDates(x, thedate.getFullYear()); for (var i = 0; i < actionCalDates.length; i++) { var entry = actionCalDates[i].split(";"); if (date == entry[1]) { return [true, "highlight", getTitle(actionCalDates, date)]; } } return [true, "", ""]; }, onChangeMonthYear: function (year, month, inst) { getDates(month, year); }, onSelect: function (d, instance) { $.ajax({ url: '/Index/AlertConvertDate', datatype: 'text', data: { dateString: d }, error: function (xhr, ajaxOptions, thrownError) { alert(xhr.statusText); alert(thrownError); }, success: function (data) { window.SetHomeContent(data); } }); } }); Please can someone point out where I went wrong? Thank you all.

    Read the article

  • List<> of objects, different types, sort and pull out types individually?

    - by Brazos
    I've got a handful of products, any, all, or none of which may be associated with a specific submission. All 7 products are subclasses of the class Product. I need to store all the products associated with a submission, and then retrieve them and their field data on my presentation layer. I've been using a List, and List, but when I use the OfType, I throw an error saying that I can't implicitly convert systems.generic.IEnumerable to type 'Product'. I've tried to cast, but to no avail. When I use prodlist.OfType<EPL>(); there are no errors, but when I try and store that in an instance of EPL "tempEpl", I get the aforementioned cast-related error. What gives? Code below. ProductService pserv = new ProductService(); IList<object> prodlist = pserv.getProductById(x); EPL tempEpl = new EPL(); if ((prodlist.OfType<EPL>()) != null) { tempEpl = prodlist.OfType<EPL>(); // this throws a conversion error. } the Data layer List<object> TempProdList = new List<object>(); conn.Open(); SqlCommand EplCmd = new SqlCommand(EPLQuery, conn); SqlDataReader EplRead = null; EplRead = EplCmd.ExecuteReader(); EPL TempEpl = new EPL(); if (EplRead.Read()) { TempEpl.Entity1 = EplRead.GetString(0); TempEpl.Employees1 = EplRead.GetInt32(1); TempEpl.CA1 = EplRead.GetInt32(2); TempEpl.MI1 = EplRead.GetInt32(3); TempEpl.NY1 = EplRead.GetInt32(4); TempEpl.NJ1 = EplRead.GetInt32(5); TempEpl.PrimEx1 = EplRead.GetInt32(6); TempEpl.EplLim1 = EplRead.GetInt32(7); TempEpl.EplSir1 = EplRead.GetInt32(8); TempEpl.Premium1 = EplRead.GetInt32(9); TempEpl.Wage1 = EplRead.GetInt32(10); TempEpl.Sublim1 = EplRead.GetInt32(11); TempProdList.Add(TempEpl); }

    Read the article

  • General ORM design question

    - by Calvin
    Suppose you have 2 classes, Person and Rabbit. A person can do a number of things to a rabbit, s/he can either feed it, buy it and become its owner, or give it away. A rabbit can have none or at most 1 owner at a time. And if it is not fed for a while, it may die. Class Person { Void Feed(Rabbit r); Void Buy(Rabbit r); Void Giveaway(Person p, Rabbit r); Rabbit[] rabbits; } Class Rabbit { Bool IsAlive(); Person pwner; } There are a couple of observations from the domain model: Person and Rabbit can have references to each other Any actions on 1 object can also change the state of the other object Even if no explicit actions are invoked, there can still be a change of state in the objects (e.g. Rabbit can be starved to death, and that causes it to be removed from the Person.rabbits array) As DDD is concerned, I think the correct approach is to synchronize all calls that may change the states in the domain model. For instance, if a Person buys a Rabbit, s/he would need to acquire a lock in Person to make a change to the rabbits array AND also another lock in Rabbit to change its owner before releasing the first one. This would prevent a race condition where 2 Persons claim to be the owner of the little Rabbit. The other approach is to let the database to handle all these synchronizations. Who makes the first call wins, but then the DB needs to have some kind of business logics to figure out if it is a valid transaction (e.g. if a Rabbit already has an owner, it cannot change its owner unless the Person gives it away). There are both pros/cons in either approach, and I’d expect the “best” solution would be somewhere in-between. How would you do it in real life? What’s your take and experience? Also, is it a valid concern that there can be another race condition the domain model has committed its change but before it is fully committed in the database? And for the 3rd observation (i.e. state change due to time factor). How will you do it?

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • Should I skip authorization, with CanCan, of an action that instantiates a resource?

    - by irkenInvader
    I am writing a web app to pick random lists of cards from larger, complete sets of cards. I have a Card model and a CardSet model. Both models have a full RESTful set of 7 actions (:index, :new, :show, etc). The CardSetsController has an extra action for creating random sets: :random. # app/models/card_set.rb class CardSet < ActiveRecord::Base belongs_to :creator, :class_name => "User" has_many :memberships has_many :cards, :through => :memberships # app/models/card.rb class Card < ActiveRecord::Base belongs_to :creator, :class_name => "User" has_many :memberships has_many :card_sets, :through => :memberships I have added Devise for authentication and CanCan for authorizations. I have users with an 'editor' role. Editors are allowed to create new CardSets. Guest users (Users who have not logged in) can only use the :index and :show actions. These authorizations are working as designed. Editors can currently use both the :random and the :new actions without any problems. Guest users, as expected, cannot. # app/controllers/card_sets_controller.rb class CardSetsController < ApplicationController before_filter :authenticate_user!, :except => [:show, :index] load_and_authorize_resource I want to allow guest users to use the :random action, but not the :new action. In other words, they can see new random sets, but not save them. The "Save" button on the :random action's view is hidden (as designed) from the guest users. The problem is, the first thing the :random action does is build a new instance of the CardSet model to fill out the view. When cancan tries to load_and_authorize_resource a new CardSet, it throws a CanCan::AccessDenied exception. Therefore, the view never loads and the guest user is served a "You need to sign in or sign up before continuing" message. # app/controllers/card_sets_controllers.rb def random @card_set = CardSet.new( :name => "New Set of 10", :set_type => "Set of 10" ) I realize that I can tell load_and_authorize_resource to skip the :random action by passing :except => :random to the call, but that just feels "wrong" for some reason. What's the "right" way to do this? Should I create the new random set without instantiating a new CardSet? Should I go ahead and add the exception?

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • Voicexml how to store input into a global variable

    - by Tyzak
    Hello, I'm creating a voicexml appliacation. I want to store an user input into a global variable. I wondered, the input should be stored in the fieldvar. shouldn't it? After I tried it with this, i tried to store it in an global variable: <assign name="myvar" expr="'myinput'"/> but somehow it didn't work. I used value expr="var" as expr. <?xml version="1.0" encoding="UTF-8"?> <vxml xmlns="http://www.w3.org/2001/vxml" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.w3.org/2001/vxml http://www.w3.org/TR/voicexml20/vxml.xsd" version="2.0"> <var name="myProdukt" /> <form id="test"> <field name="var"> <prompt bargein="true" bargeintype="hotword" >Sagen Sie ein Produkt</prompt> <grammar root="main" version="1.0" xml:lang="de-DE"> <rule id="main" scope="public"> <one-of> <item> p1 </item> <item> p2 </item> <item> p3 </item> <item> p4 </item> </one-of> </rule> </grammar> <filled> <assign name="myProdukt" expr="<value expr="var"/>"/> </filled> </field> </form> <<!--[...] Here i want to use the input.--> </vxml> thanks in advance

    Read the article

  • mysql timeout - c/C++

    - by user1262876
    Guys i'm facing a problem with this code, the problem is the timeout by timeout i mean the time it takes the program to tell me if the server is connected or not. If i use my localhost i get the answer fast, but when i connect to outside my localhost it takes 50sc - 1.5 min to response and the program frezz until it done. HOw can i fix the frezzing, or make my own timeout, like if still waiting after 50sc, tell me connection failed and stop? please use codes as help, becouse i would understand it better, thanks for any help i get PS: USING MAC #include "mysql.h" #include <stdio.h> #include <stdlib.h> // Other Linker Flags: -lmysqlclient -lm -lz // just going to input the general details and not the port numbers struct connection_details { char *server; char *user; char *password; char *database; }; MYSQL* mysql_connection_setup(struct connection_details mysql_details) { // first of all create a mysql instance and initialize the variables within MYSQL *connection = mysql_init(NULL); // connect to the database with the details attached. if (!mysql_real_connect(connection,mysql_details.server, mysql_details.user, mysql_details.password, mysql_details.database, 0, NULL, 0)) { printf("Conection error : %s\n", mysql_error(connection)); exit(1); } return connection; } MYSQL_RES* mysql_perform_query(MYSQL *connection, char *sql_query) { // send the query to the database if (mysql_query(connection, sql_query)) { printf("MySQL query error : %s\n", mysql_error(connection)); exit(1); } return mysql_use_result(connection); } int main() { MYSQL *conn; // the connection MYSQL_RES *res; // the results MYSQL_ROW row; // the results row (line by line) struct connection_details mysqlD; mysqlD.server = (char*)"Localhost"; // where the mysql database is mysqlD.user = (char*)"root"; // the root user of mysql mysqlD.password = (char*)"123456"; // the password of the root user in mysql mysqlD.database = (char*)"test"; // the databse to pick // connect to the mysql database conn = mysql_connection_setup(mysqlD); // assign the results return to the MYSQL_RES pointer res = mysql_perform_query(conn, (char*) "SELECT * FROM me"); printf("MySQL Tables in mysql database:\n"); while ((row = mysql_fetch_row(res)) !=NULL) printf("%s - %s\n", row[0], row[1], row[2]); // <-- Rows /* clean up the database result set */ mysql_free_result(res); /* clean up the database link */ mysql_close(conn); return 0; }

    Read the article

  • WPF Datagrid items binding problem

    - by gencay
    I get a problem while displaying a List in WPF-Datagrid. When I do this line ... DocumentList dt = new DocumentList(fileWordList, fileUriType, fileUri, cosineSimilarityRatio, diceSimilarityRatio, extendedJaccardSimilarityRatio); documentList.Add(dt); ... dataGrid1.Items.Add(dt); ... It creates an empty row into dataGrid1 and no text is shown there. my xaml implementation is this: <GroupBox Canvas.Left="-0.003" Canvas.Top="0" Header="Display Results" Height="427.5" Name="groupBox2" Width="645.56"> <toolkit:DataGrid Canvas.Left="137.5" Canvas.Top="240" Height="392" Name="dgrDocumentList" Width="627" ItemsSource="{Binding DocumentList }"> <toolkit:DataGrid.Columns> <toolkit:DataGridTextColumn Header="Type" Binding="{Binding type}" IsReadOnly="True"> </toolkit:DataGridTextColumn> <toolkit:DataGridHyperlinkColumn Header="Uri" Binding="{Binding path}" IsReadOnly="True"> </toolkit:DataGridHyperlinkColumn> <toolkit:DataGridTextColumn Header="Cosine" Binding="{Binding cos}" IsReadOnly="True"> </toolkit:DataGridTextColumn> <toolkit:DataGridTextColumn Header="Dice" Binding="{Binding dice}" IsReadOnly="True"> </toolkit:DataGridTextColumn> <toolkit:DataGridTextColumn Header="Jaccard" Binding="{Binding jaccard}" IsReadOnly="True"> </toolkit:DataGridTextColumn> </toolkit:DataGrid.Columns> </toolkit:DataGrid> </GroupBox> and my DocumentList class class DocumentList { public List<WordList> wordList; public string type; public string path; public double cos; public double dice; public double jaccard; //public static string title; public DocumentList(List<WordList> wordListt, string typee, string pathh, double sm11, double sm22, double sm33) { type = typee; wordList = wordListt; path = pathh; cos = sm11; dice = sm22; jaccard = sm33; } I would like to do that: When i add a new element into documentList instance, would like to see the results on data grid. Thank you in advance.

    Read the article

  • How change Castor mapping to remove "xmlns:xsi" and "xsi:type" attributes from element in XML output

    - by Derek Mahar
    How do I change the Castor mapping <?xml version="1.0"?> <!DOCTYPE mapping PUBLIC "-//EXOLAB/Castor Mapping DTD Version 1.0//EN" "http://castor.org/mapping.dtd"> <mapping> <class name="java.util.ArrayList" auto-complete="true"> <map-to xml="ArrayList" /> </class> <class name="com.db.spgit.abstrack.ws.response.UserResponse"> <map-to xml="UserResponse" /> <field name="id" type="java.lang.String"> <bind-xml name="id" node="element" /> </field> <field name="deleted" type="boolean"> <bind-xml name="deleted" node="element" /> </field> <field name="name" type="java.lang.String"> <bind-xml name="name" node="element" /> </field> <field name="typeId" type="java.lang.Integer"> <bind-xml name="typeId" node="element" /> </field> <field name="regionId" type="java.lang.Integer"> <bind-xml name="regionId" node="element" /> </field> <field name="regionName" type="java.lang.String"> <bind-xml name="regionName" node="element" /> </field> </class> </mapping> to suppress the xmlns:xsi and xsi:type attributes in the element of the XML output? For example, instead of the output XML <?xml version="1.0" encoding="UTF-8"?> <ArrayList> <UserResponse xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:type="UserResponse"> <name>Tester</name> <typeId>1</typeId> <regionId>2</regionId> <regionName>US</regionName> </UserResponse> </ArrayList> I'd prefer <?xml version="1.0" encoding="UTF-8"?> <ArrayList> <UserResponse> <name>Tester</name> <typeId>1</typeId> <regionId>2</regionId> <regionName>US</regionName> </UserResponse> </ArrayList> such that the element name implies the xsi:type.

    Read the article

  • Spring transaction management breaks hibernate cascade

    - by TimmyJ
    I'm having a problem where the addition of spring's transaction management to an application causes Hibernate to throw the following error: org.hibernate.HibernateException: A collection with cascade="all-delete-orphan" was no longer referenced by the owning entity instance: org.fstrf.masterpk.domain.ReportCriteriaBean.treatmentArms org.hibernate.engine.Collections.processDereferencedCollection(Collections.java:96) org.hibernate.engine.Collections.processUnreachableCollection(Collections.java:39) org.hibernate.event.def.AbstractFlushingEventListener.flushCollections(AbstractFlushingEventListener.java:218) org.hibernate.event.def.AbstractFlushingEventListener.flushEverythingToExecutions(AbstractFlushingEventListener.java:77) org.hibernate.event.def.DefaultFlushEventListener.onFlush(DefaultFlushEventListener.java:26) org.hibernate.impl.SessionImpl.flush(SessionImpl.java:1000) org.springframework.orm.hibernate3.SpringSessionSynchronization.beforeCommit(SpringSessionSynchronization.java:135) org.springframework.transaction.support.TransactionSynchronizationUtils.triggerBeforeCommit(TransactionSynchronizationUtils.java:72) org.springframework.transaction.support.AbstractPlatformTransactionManager.triggerBeforeCommit(AbstractPlatformTransactionManager.java:905) org.springframework.transaction.support.AbstractPlatformTransactionManager.processCommit(AbstractPlatformTransactionManager.java:715) org.springframework.transaction.support.AbstractPlatformTransactionManager.commit(AbstractPlatformTransactionManager.java:701) org.springframework.transaction.interceptor.TransactionAspectSupport.commitTransactionAfterReturning(TransactionAspectSupport.java:321) org.springframework.transaction.interceptor.TransactionInterceptor.invoke(TransactionInterceptor.java:116) org.springframework.aop.framework.ReflectiveMethodInvocation.proceed(ReflectiveMethodInvocation.java:171) org.springframework.aop.framework.JdkDynamicAopProxy.invoke(JdkDynamicAopProxy.java:204) $Proxy92.saveNewReportCriteria(Unknown Source) org.fstrf.masterpk.domain.logic.MasterPkFacade.saveNewReportCriteria(MasterPkFacade.java:134) org.fstrf.masterpk.controllers.ReportCriteriaController.setupReportType(ReportCriteriaController.java:302) sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) java.lang.reflect.Method.invoke(Method.java:585) org.springframework.web.bind.annotation.support.HandlerMethodInvoker.doInvokeMethod(HandlerMethodInvoker.java:413) org.springframework.web.bind.annotation.support.HandlerMethodInvoker.invokeHandlerMethod(HandlerMethodInvoker.java:134) org.springframework.web.servlet.mvc.annotation.AnnotationMethodHandlerAdapter.invokeHandlerMethod(AnnotationMethodHandlerAdapter.java:310) org.springframework.web.servlet.mvc.annotation.AnnotationMethodHandlerAdapter.handle(AnnotationMethodHandlerAdapter.java:297) org.springframework.web.servlet.DispatcherServlet.doDispatch(DispatcherServlet.java:875) org.springframework.web.servlet.DispatcherServlet.doService(DispatcherServlet.java:809) org.springframework.web.servlet.FrameworkServlet.processRequest(FrameworkServlet.java:571) org.springframework.web.servlet.FrameworkServlet.doPost(FrameworkServlet.java:511) javax.servlet.http.HttpServlet.service(HttpServlet.java:710) javax.servlet.http.HttpServlet.service(HttpServlet.java:803) org.jboss.web.tomcat.filters.ReplyHeaderFilter.doFilter(ReplyHeaderFilter.java:96) I'm using Spring 2.5 and annotations to implement this management. Here is the class containing the saveNewReportCriteria method (which, as can be seen by the stack trace, is causing the error) @Transactional( propagation = Propagation.REQUIRED, isolation = Isolation.DEFAULT, readOnly = false) public class HibernateReportCriteriaDao implements ReportCriteriaDao{ private HibernateTemplate hibernateTemplate; public Integer saveNewReportCriteria(ReportCriteriaBean reportCriteria) { hibernateTemplate.save(reportCriteria); List<Integer> maxIdList = hibernateTemplate.find("SELECT max(id) from ReportCriteriaBean"); logger.info("ID of newly saved list is: " + maxIdList.get(0)); return maxIdList.get(0); } public void setHibernateTemplate(HibernateTemplate hibernateTemplate) { this.hibernateTemplate = hibernateTemplate; } } Then I added the following sections to my configuration files to tell spring that I am using annotation driven transaction management: <bean id="actgDataSource" class="org.springframework.jndi.JndiObjectFactoryBean"> <property name="jndiName" value="jdbc/actg" /> <property name="resourceRef" value="true" /> </bean> <bean id="transactionManager" class="org.springframework.jdbc.datasource.DataSourceTransactionManager"> <property name="dataSource" ref="actgDataSource" /> </bean> <tx:annotation-driven/> I'm pretty sure that the de-referencing error is being caused due to the proxy class that Spring AOP creates and uses in order to handle transaction management, but I have no idea how I'd go about fixing it.

    Read the article

  • X264 encoding using Opencv

    - by user573193
    I am working with a high resolution camera: 4008x2672. I a writing a simple program which grabs frame from the camera and sends the frame to a avi file. For working with such a high resolution, I found only x264 codec that could do the trick (Suggestions welcome). I am using opencv for most of the image handling stuff. As mentioned in this post http://doom10.org/index.php?topic=1019.0 , I modified the AVCodecContext members as per ffmpeg presets for libx264 (Had to do this to avoid broken ffmpeg defaults settings error). This is output I am getting when I try to run the program [libx264 @ 0x992d040]non-strictly-monotonic PTS 1294846981.526675 1 0 //Timestamp camera_no frame_no 1294846981.621101 1 1 1294846981.715521 1 2 1294846981.809939 1 3 1294846981.904360 1 4 1294846981.998782 1 5 1294846982.093203 1 6 Last message repeated 7 times [avi @ 0x992beb0]st:0 error, non monotone timestamps -614891469123651720 = -614891469123651720 OpenCV Error: Unspecified error (Error while writing video frame) in icv_av_write_frame_FFMPEG, file /home/ajoshi/ext/OpenCV-2.2.0/modules/highgui/src/cap_ffmpeg.cpp, line 1034 terminate called after throwing an instance of 'cv::Exception' what(): /home/ajoshi/ext/OpenCV-2.2.0/modules/highgui/src/cap_ffmpeg.cpp:1034: error: (-2) Error while writing video frame in function icv_av_write_frame_FFMPEG Aborted Modifications to the AVCodecContext are: if(codec_id == CODEC_ID_H264) { //fprintf(stderr, "Trying to parse a preset file for libx264\n"); //Setting Values manually from medium preset c-me_method = 7; c-qcompress=0.6; c-qmin = 10; c-qmax = 51; c-max_qdiff = 4; c-i_quant_factor=0.71; c-max_b_frames=3; c-b_frame_strategy = 1; c-me_range = 16; c-me_subpel_quality=7; c-coder_type = 1; c-scenechange_threshold=40; c-partitions = X264_PART_I8X8 | X264_PART_I4X4 | X264_PART_P8X8 | X264_PART_B8X8; c-flags = CODEC_FLAG_LOOP_FILTER; c-flags2 = CODEC_FLAG2_BPYRAMID | CODEC_FLAG2_MIXED_REFS | CODEC_FLAG2_WPRED | CODEC_FLAG2_8X8DCT | CODEC_FLAG2_FASTPSKIP; c-keyint_min = 25; c-refs = 3; c-trellis=1; c-directpred = 1; c-weighted_p_pred=2; } I am probably not setting the dts and pts values which I believed ffmpeg should be setting it for me. Any sugggestions welcome. Thanks in advance

    Read the article

  • Thinking about introducing PHP/MySQL into a .NET/SQL Server environment. Thoughts?

    - by abszero
    I posted this over at reddit but it didn't gain any momentum. So here is what is going on: our company was recently purchased by another web shop and I was promoted to head of development here in our office. Our office is completely .NET/SQL Server and the company who purchased us is a *nix/PHP/MySQL shop. Now several of our large clients who are on the .NET platform are up for complete rewrites (the sites are from '04 and are running on the 1.x framework.) While reviewing the proposal for one client with my superior I came across a pretty extensive module which would require several hundred man hours to complete and voiced some concern about it in relation to the quote. One of the guys from the PHP group happen to hear this and told me of a module that they (PHP Group) use in Drupal that does exactly what the proposal in front of me was describing and it only took, at most, 8 hours to completely setup / configure. My superior suggested that I take a look at Drupal and the module in question over the weekend but stressed that we should only go that route if it really made sense. So this weekend I spun up a CentOS instance in VirtualBox and started playing around with Drupal. I am still fleshing it out so don't have a solid opinion on it just yet. Anyway I have some questions / fears that I was hoping progit could help me out in! Has anyone had experience doing this and, if so, how did it turn out? I am completely ignorant to what IDE's (if any) are available to for PHP. The last time I worked with PHP it was in Notepad and that was less than intuitive. So is there are more intuitive IDE out there for PHP dev? I don't want to scare my .NET guys. Since the merger all of our new business clients that have had relatively small websites have gone on Drupal with the larger sites going on .NET. My concern is that if they see a large site go onto Drupal that they might start getting anxious and start handing out their resumes. For the foreseeable future there are no plans to liquidate the .NET platform and really we can't just from a support standpoint. What would be the best way to approach this? Any other helpful info? Thanks!

    Read the article

  • SQL Server architecture guidance

    - by Liam
    Hi, We are designing a new version of our existing product on a new schema. Its an internal web application with possibly 100 concurrent users (max)This will run on a SQL Server 2008 database. On of the discussion items recently is whether we should have a single database of split the database for performance reasons across 2 separate databases. The database could grow anywhere from 50-100GB over 5 years. We are Developers and not DBAs so it would be nice to get some general guidance. [I know the answer is not simple as it depends on the schema, archiving policy, amount of data etc. ] Option 1 Single Main Database [This is my preferred option]. The plan would be to have all the tables in a single database and possibly to use file groups and partitioning to separate the data if required across multiple disks. [Use schema if appropriate]. This should deal with the performance concerns One of the comments wrt this was that the a single server instance would still be processing this data so there would still be a processing bottle neck. For reporting we could have a separate reporting DB but this is still being discussed. Option 2 Split the database into 2 separate databases DB1 - Customers, Accounts, Customer resources etc DB2 - This would contain the bulk of the data [i.e. Vehicle tracking data, financial transaction tables etc]. These tables would typically contain a lot of data. [It could reside on a separate server if required] This plan would involve keeping the main data in a smaller database [DB1] and retaining the [mainly] read only transaction type data in a separate DB [DB2]. The UI would mainly read from DB1 and thus be more responsive. [I'm aware that this option makes it harder for Referential Integrity to be enforced.] Points for consideration As we are at the design stage we can at least make proper use of indexes to deal performance issues so thats why option 1 to me is attractive and its more of a standard approach. For both options we are considering implementing an archiving database. Apologies for the long Question. In summary the question is 1 DB or 2? Thanks in advance, Liam

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • WndProc(ref Message m), Prevent minimize Games, Send key strokes.

    - by Stanomatic
    Overview: I am going to create a touch application that interfaces with games and other apps. This concept is similar to the app found on touch-buddy.com but I will be using C# and WPF instead of how the application is written in Perl. I have a few challenges I would like to evaluate. The touch-buddy app uses two approaches while interacting with games; 1. Client mode (Same machine runs both game and touch-buddy). 2. Server / Client mode where a separate box sends commands to the game machine. The reason I believe for this method was to circumvent the issue with games minimizing. In Client only mode I am faced with the issue where I touch a screen OTHER than the main screen where the game is viewed and then the game minimizes. Not all games have this behavior but I would like to conquer the games that do minimize and prevent it. Is it possible to keep a game front and center Focused and prevent minimizing utilizing C# WndProc(ref Message m)? I have been experimenting with WndProc(ref Message m) where I created a win form and when I press minimize on my own Win form and it will close an instance of notepad. This proves to me that I can capture a message, prevent that message from bubbling up and then send a message to another application. I then tried to click on notepad with my touch screen and keep my win form application in focus and not minimize. At this point I am unsuccessful. I need more time understanding message codes. Is this the right approach? Can it be done? Should I look at other libraries such as Windows Automation? Key input is my other concern. What is the best way to send key strokes to other apps/games. Should I tap into DirectX, use some kind of send key, Automation Framework? Can any of these handle the multiple key strokes that some simulation games require? I appreciate any links and or insight you may have. If you have gone down this path for any reason I would love to hear your comments. Stan

    Read the article

  • How to compute a unicode string which bidirectional representation is specified?

    - by valdo
    Hello, fellows. I have a rather pervert question. Please forgive me :) There's an official algorithm that describes how bidirectional unicode text should be presented. http://www.unicode.org/reports/tr9/tr9-15.html I receive a string (from some 3rd-party source), which contains latin/hebrew characters, as well as digits, white-spaces, punctuation symbols and etc. The problem is that the string that I receive is already in the representation form. I.e. - the sequence of characters that I receive should just be presented from left to right. Now, my goal is to find the unicode string which representation is exactly the same. Means - I need to pass that string to another entity; it would then render this string according to the official algorithm, and the result should be the same. Assuming the following: The default text direction (of the rendering entity) is RTL. I don't want to inject "special unicode characters" that explicitly override the text direction (such as RLO, RLE, etc.) I suspect there may exist several solutions. If so - I'd like to preserve the RTL-looking of the string as much as possible. The string usually consists of hebrew words mostly. I'd like to preserve the correct order of those words, and characters inside those words. Whereas other character sequences may (and should) be transposed. One naive way to solve this is just to swap the whole string (this takes care of the hebrew words), and then swap inside it sequences of non-hebrew characters. This however doesn't always produce correct results, because actual rules of representation are rather complex. The only comprehensive algorithm that I see so far is brute-force check. The string can be divided into sequences of same-class characters. Those sequences may be joined in random order, plus any of them may be reversed. I can check all those combinations to obtain the correct result. Plus this technique may be optimized. For instance the order of hebrew words is known, so we only have to check different combinations of their "joining" sequences. Any better ideas? If you have an idea, not necessarily the whole solution - it's ok. I'll appreciate any idea. Thanks in advance.

    Read the article

  • Jetty: Stopping programatically causes "1 threads could not be stopped"

    - by Ondra Žižka
    Hi, I have an embedded Jetty 6.1.26 instance. I want to shut it down by HTTP GET sent to /shutdown. So I created a JettyShutdownServlet: @Override protected void doGet(HttpServletRequest req, HttpServletResponse resp) throws ServletException, IOException { resp.setStatus(202, "Shutting down."); resp.setContentType("text/plain"); ServletOutputStream os = resp.getOutputStream(); os.println("Shutting down."); os.close(); resp.flushBuffer(); // Stop the server. try { log.info("Shutting down the server..."); server.stop(); } catch (Exception ex) { log.error("Error when stopping Jetty server: "+ex.getMessage(), ex); } However, when I send the request, Jetty does not stop - a thread keeps hanging in org.mortbay.thread.QueuedThreadPool on the line with this.wait(): // We are idle // wait for a dispatched job synchronized (this) { if (_job==null) this.wait(getMaxIdleTimeMs()); job=_job; _job=null; } ... 2011-01-10 20:14:20,375 INFO org.mortbay.log jetty-6.1.26 2011-01-10 20:14:34,756 INFO org.mortbay.log Started [email protected]:17283 2011-01-10 20:25:40,006 INFO org.jboss.qa.mavenhoe.MavenHoeApp Shutting down the server... 2011-01-10 20:25:40,006 INFO org.mortbay.log Graceful shutdown [email protected]:17283 2011-01-10 20:25:40,006 INFO org.mortbay.log Graceful shutdown org.mortbay.jetty.servlet.Context@1672bbb{/,null} 2011-01-10 20:25:40,006 INFO org.mortbay.log Graceful shutdown org.mortbay.jetty.webapp.WebAppContext@18d30fb{/jsp,file:/home/ondra/work/Mavenhoe/trunk/target/classes/org/jboss/qa/mavenhoe/web/jsp} 2011-01-10 20:25:43,007 INFO org.mortbay.log Stopped [email protected]:17283 2011-01-10 20:25:43,009 WARN org.mortbay.log 1 threads could not be stopped 2011-01-10 20:26:43,010 INFO org.mortbay.log Shutdown hook executing 2011-01-10 20:26:43,011 INFO org.mortbay.log Shutdown hook complete It blocks for exactly one minute, then shuts down. I've added the Graceful shutdown, which should allow me to shut the server down from a servlet; However, it does not work as you can see from the log. I've solved it this way: Server server = new Server( PORT ); server.setGracefulShutdown( 3000 ); server.setStopAtShutdown(true); ... server.start(); if( server.getThreadPool() instanceof QueuedThreadPool ){ ((QueuedThreadPool) server.getThreadPool()).setMaxIdleTimeMs( 2000 ); } setMaxIdleTimeMs() needs to be called after the start(), becase the threadPool is created in start(). However, the threads are already created and waiting, so it only applies after all threads are used at least once. I don't know what else to do except some awfulness like interrupting all threads or System.exit(). Any ideas? Is there a good way? Thanks, Ondra

    Read the article

  • Is there a reason why a base class decorated with XmlInclude would still throw a type unknown exception when serialized?

    - by Tedford
    I will simplify the code to save space but what is presented does illustrate the core problem. I have a class which has a property that is a base type. There exist 3 dervived classes which could be assigned to that property. If I assign any of the derived classes to the container then the XmlSerializer throws dreaded "The type xxx was not expected. Use the XmlInclude or SoapInclude attribute to specify types that are not known statically." exception when attempting to seralize the container. However my base class is already decorated with that attribute so I figure there must be an additional "hidden" requirement. The really odd part is that the default WCF serializer has no issues with this class hierarchy. The Container class [DataContract] [XmlRoot(ElementName = "TRANSACTION", Namespace = Constants.Namespace)] public class PaymentSummaryRequest : CommandRequest { /// <summary> /// Gets or sets the summary. /// </summary> /// <value>The summary.</value> /// <remarks></remarks> [DataMember] public PaymentSummary Summary { get; set; } /// <summary> /// Initializes a new instance of the <see cref="PaymentSummaryRequest"/> class. /// </summary> public PaymentSummaryRequest() { Mechanism = CommandMechanism.PaymentSummary; } } The base class [DataContract] [XmlInclude(typeof(xxxPaymentSummary))] [XmlInclude(typeof(yyyPaymentSummary))] [XmlInclude(typeof(zzzPaymentSummary))] [KnownType(typeof(xxxPaymentSummary))] [KnownType(typeof(xxxPaymentSummary))] [KnownType(typeof(zzzPaymentSummary))] public abstract class PaymentSummary { } One of the derived classes [DataContract] public class xxxPaymentSummary : PaymentSummary { } The serialization code var serializer = new XmlSerializer(typeof(PaymentSummaryRequest)); serializer.Serialize(Console.Out,new PaymentSummaryRequest{Summary = new xxxPaymentSummary{}}); The Exception System.InvalidOperationException: There was an error generating the XML document. --- System.InvalidOperationException: The type xxxPaymentSummary was not expected. Use the XmlInclude or SoapInclude attribute to specify types that are not known statically. at Microsoft.Xml.Serialization.GeneratedAssembly.XmlSerializationWriterPaymentSummaryRequest.Write13_PaymentSummary(String n, String ns, PaymentSummary o, Boolean isNullable, Boolean needType) at Microsoft.Xml.Serialization.GeneratedAssembly.XmlSerializationWriterPaymentSummaryRequest.Write14_PaymentSummaryRequest(String n, String ns, PaymentSummaryRequest o, Boolean isNullable, Boolean needType) at Microsoft.Xml.Serialization.GeneratedAssembly.XmlSerializationWriterPaymentSummaryRequest.Write15_TRANSACTION(Object o) --- End of inner exception stack trace --- at System.Xml.Serialization.XmlSerializer.Serialize(XmlWriter xmlWriter, Object o, XmlSerializerNamespaces namespaces, String encodingStyle, String id) at System.Xml.Serialization.XmlSerializer.Serialize(TextWriter textWriter, Object o, XmlSerializerNamespaces namespaces) at UserQuery.RunUserAuthoredQuery() in c:\Users\Tedford\AppData\Local\Temp\uqacncyo.0.cs:line 47

    Read the article

  • How to cache queries in EJB and return result efficient (performance POV)

    - by Maxym
    I use JBoss EJB 3.0 implementation (JBoss 4.2.3 server) At the beginning I created native query all the time using construction like Query query = entityManager.createNativeQuery("select * from _table_"); Of couse it is not that efficient, I performed some tests and found out that it really takes a lot of time... Then I found a better way to deal with it, to use annotation to define native queries: @NamedNativeQuery( name = "fetchData", value = "select * from _table_", resultClass=Entity.class ) and then just use it Query query = entityManager.createNamedQuery("fetchData"); the performance of code line above is two times better than where I started from, but still not that good as I expected... then I found that I can switch to Hibernate annotation for NamedNativeQuery (anyway, JBoss's implementation of EJB is based on Hibernate), and add one more thing: @NamedNativeQuery( name = "fetchData2", value = "select * from _table_", resultClass=Entity.class, readOnly=true) readOnly - marks whether the results are fetched in read-only mode or not. It sounds good, because at least in this case of mine I don't need to update data, I wanna just fetch it for report. When I started server to measure performance I noticed that query without readOnly=true (by default it is false) returns result with each iteration better and better, and at the same time another one (fetchData2) works like "stable" and with time difference between them is shorter and shorter, and after 5 iterations speed of both was almost the same... The questions are: 1) is there any other way to speed query using up? Seems that named queries should be prepared once, but I can't say it... In fact if to create query once and then just use it it would be better from performance point of view, but it is problematic to cache this object, because after creating query I can set parameters (when I use ":variable" in query), and it changes query object (isn't it?). well, is here any way to cache them? Or named query is the best option I can use? 2) any other approaches how to make results retrieveng faster. I mean, for instance I don't need those Entities to be attached, I won't update them, all I need is just fetch collection of data. Maybe readOnly is the only available way, so I can't speed it up, but who knows :) P.S. I don't ask about DB performance, all I need now is how not to create query all the time, so use it efficient, and to "allow" EJB to do less job with the same result concerning data returning.

    Read the article

  • Android Camera takePicture function does not call Callback function

    - by Tomáš 'Guns Blazing' Frcek
    I am working on a custom Camera activity for my application. I was following the instruction from the Android Developers site here: http://developer.android.com/guide/topics/media/camera.html Everything seems to works fine, except the Callback function is not called and the picture is not saved. Here is my code: public class CameraActivity extends Activity { private Camera mCamera; private CameraPreview mPreview; private static final String TAG = "CameraActivity"; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.camera); // Create an instance of Camera mCamera = getCameraInstance(); // Create our Preview view and set it as the content of our activity. mPreview = new CameraPreview(this, mCamera); FrameLayout preview = (FrameLayout) findViewById(R.id.camera_preview); preview.addView(mPreview); Button captureButton = (Button) findViewById(R.id.button_capture); captureButton.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { Log.v(TAG, "will now take picture"); mCamera.takePicture(null, null, mPicture); Log.v(TAG, "will now release camera"); mCamera.release(); Log.v(TAG, "will now call finish()"); finish(); } }); } private PictureCallback mPicture = new PictureCallback() { @Override public void onPictureTaken(byte[] data, Camera camera) { Log.v(TAG, "Getting output media file"); File pictureFile = getOutputMediaFile(); if (pictureFile == null) { Log.v(TAG, "Error creating output file"); return; } try { FileOutputStream fos = new FileOutputStream(pictureFile); fos.write(data); fos.close(); } catch (FileNotFoundException e) { Log.v(TAG, e.getMessage()); } catch (IOException e) { Log.v(TAG, e.getMessage()); } } }; private static File getOutputMediaFile() { String state = Environment.getExternalStorageState(); if (!state.equals(Environment.MEDIA_MOUNTED)) { return null; } else { File folder_gui = new File(Environment.getExternalStorageDirectory() + File.separator + "GUI"); if (!folder_gui.exists()) { Log.v(TAG, "Creating folder: " + folder_gui.getAbsolutePath()); folder_gui.mkdirs(); } File outFile = new File(folder_gui, "temp.jpg"); Log.v(TAG, "Returnng file: " + outFile.getAbsolutePath()); return outFile; } } After clicking the Button, I get logs: "will now take picture", "will now release camera" and "will now call finish". The activity finishes succesfully, but the Callback function was not called during the mCamera.takePicture(null, null, mPicture); function (There were no logs from the mPicture callback or getMediaOutputFile functions) and there is no file in the location that was specified. Any ideas? :) Much thanks!

    Read the article

< Previous Page | 547 548 549 550 551 552 553 554 555 556 557 558  | Next Page >