Search Results

Search found 20092 results on 804 pages for 'python import'.

Page 559/804 | < Previous Page | 555 556 557 558 559 560 561 562 563 564 565 566  | Next Page >

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Django Managers

    - by owca
    I have the following models code : from django.db import models from categories.models import Category class MusicManager(models.Manager): def get_query_set(self): return super(MusicManager, self).get_query_set().filter(category='Music') def count_music(self): return self.all().count() class SportManager(models.Manager): def get_query_set(self): return super(MusicManager, self).get_query_set().filter(category='Sport') class Event(models.Model): title = models.CharField(max_length=120) category = models.ForeignKey(Category) objects = models.Manager() music = MusicManager() sport = SportManager() Now by registering MusicManager() and SportManager() I am able to call Event.music.all() and Event.sport.all() queries. But how can I create Event.music.count() ? Should I call self.all() in count_music() function of MusicManager to query only on elements with 'Music' category or do I still need to filter through them in search for category first ?

    Read the article

  • Reverse engineering to get answers

    - by cornjuliox
    So I've spent the last few days looking for a way to create a simple image drawing app with wxPython, and I think the key to doing just that is understanding how to use Device Contexts. The problem is that the wxPython demo program doesn't demonstrate DCs, and the docs for both wxPython and wxWidgets don't explain as much as I'd like to know so I've decided to try and 'reverse engineer' an existing app to see how its done. The first problem I have is that I don't know of any drawing apps written in wxPython (or any written in Python for that matter o.o), and the second is I don't know how I'd go about doing it. Am I right in saying that I'm going to need a copy of an application's Python source and something like Winpdb? What do professional programmers do when they find themselves in a situation like mine, needing answers that the docs don't provide?

    Read the article

  • Parsing Json Feeds with google Gson

    - by mnml
    I would like to know how to parse a json feed by items, eg. url / title / description for each item. I have had a look to the doc / api but, it didn't help me. This is what I got so far import com.google.gson.Gson; import com.google.gson.JsonObject; public class ImportSources extends Job { public void doJob() throws IOException { String json = stringOfUrl("http://feed.test/all.json"); JsonObject jobj = new Gson().fromJson(json, JsonObject.class); Logger.info(jobj.get("responseData").toString()); } public static String stringOfUrl(String addr) throws IOException { ByteArrayOutputStream output = new ByteArrayOutputStream(); URL url = new URL(addr); IOUtils.copy(url.openStream(), output); return output.toString(); } }

    Read the article

  • JavaScript/Dojo Module Pattern - how to debug?

    - by djna
    I'm working with Dojo and using the "Module Pattern" as described in Mastering Dojo. So far as I can see this pattern is a general, and widely used, JavaScript pattern. My question is: How do we debug our modules? So far I've not been able to persuade Firebug to show me the source of my module. Firebug seems to show only the dojo eval statement used to execute the factory method. Hence I'm not able to step through my module source. I've tried putting "debugger" statements in my module code, and Firebug seems to halt correctly, but does not show the source. Contrived example code below. This is just an example of sufficient complexity to make the need for debugging plausible, it's not intended to be useful code. The page <!-- Experiments with Debugging --> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> <html> <head> <title>console me</title> <style type="text/css"> @import "../dojoroot/dojo/resources/dojo.css"; @import "../dojoroot/dijit/themes/tundra/tundra.css"; @import "edf.css"; </style> <script type="text/javascript" src="../dojoroot/dojo/dojo.js"> </script> <script type="text/javascript" > dojo.registerModulePath("mytest", "../../mytest"); dojo.require("mytest.example"); dojo.addOnLoad(function(){ mytest.example.greet(); }); </script> </head> <body class="tundra"> <div id="bulletin"> <p>Just Testing</p> </div> </body> </html> <!-- END: snip1 --> The java script I'd like to debug dojo.provide("mytest.example"); dojo.require("dijit.layout.ContentPane"); /** * define module */ (function(){ //define the main program functions... var example= mytest.example; example.greet= function(args) { var bulletin = dojo.byId("bulletin"); console.log("bulletin:" + bulletin); if ( bulletin) { var content = new dijit.layout.ContentPane({ id: "dummy", region: "center" }); content.setContent('Greetings!'); dojo._destroyElement(bulletin); dojo.place(content.domNode, dojo.body(), "first"); console.log("greeting done"); } else { console.error("no bulletin board"); } } })();

    Read the article

  • Convert Wordpress.com Hosted Blog to BlogEngine.NET

    - by Chris Marisic
    I'm looking at what is needed to move from wordpress.com to a BlogEngine.NET or similar blog. I've seen a tool for replacing export.php so that it will export your wordpress site in BlogML format so it can easily be imported into BlogEngine.NET, however I'd really not want to have to setup php/wordpress just so I can import a back up from wordpress.com and then use the export from my local wordpress to have a BlogML file. Are there any tools that will convert the wordpress file? Is there a different blog that will natively import the wordpress file? Edit: For the question about other blog providers, I am open to them as long as they are .NET based, preferably C#.

    Read the article

  • What's a good Minimal Server-Side Javascript Framework?

    - by Nick Retallack
    So I was writing a web app with web.py that uses plenty of client-side javascript, and my database is on couchdb so the queries are in javascript too, and eventually I just got to thinking, why not skip the python and go all javascript? Besides, some functions need to run once on the client and again on the server to make sure you're not spoofing, so why translate between javascript and python? So I'm looking for a simple lightweight javascript web framework. All I really need is the url routing, request and response stuff (standard wsgi?), and a way to hook into a big http server like nginx. What do you guys recommend?

    Read the article

  • Run bat file in Java and wait 2

    - by Savvas Dalkitsis
    This is a followup question to my other question : http://stackoverflow.com/questions/2434125/run-bat-file-in-java-and-wait The reason i am posting this as a separate question is that the one i already asked was answered correctly. From some research i did my problem is unique to my case so i decided to create a new question. Please go read that question before continuing with this one as they are closely related. Running the proposed code blocks the program at the waitFor invocation. After some research i found that the waitFor method blocks if your process has output that needs to be proccessed so you should first empty the output stream and the error stream. I did those things but my method still blocks. I then found a suggestion to simply loop while waiting the exitValue method to return the exit value of the process and handle the exception thrown if it is not, pausing for a brief moment as well so as not to consume all the CPU. I did this: import java.io.BufferedReader; import java.io.IOException; import java.io.InputStreamReader; public class Test { public static void main(String[] args) { try { Process p = Runtime.getRuntime().exec( "cmd /k start SQLScriptsToRun.bat" + " -UuserName -Ppassword" + " projectName"); final BufferedReader input = new BufferedReader(new InputStreamReader(p.getInputStream())); final BufferedReader error = new BufferedReader(new InputStreamReader(p.getErrorStream())); new Thread(new Runnable() { @Override public void run() { try { while (input.readLine()!=null) {} } catch (IOException e) { e.printStackTrace(); } } }).start(); new Thread(new Runnable() { @Override public void run() { try { while (error.readLine()!=null) {} } catch (IOException e) { e.printStackTrace(); } } }).start(); int i = 0; boolean finished = false; while (!finished) { try { i = p.exitValue(); finished = true; } catch (IllegalThreadStateException e) { e.printStackTrace(); try { Thread.sleep(500); } catch (InterruptedException e1) { e1.printStackTrace(); } } } System.out.println(i); } catch (IOException e) { e.printStackTrace(); } } } but my process will not end! I keep getting this error: java.lang.IllegalThreadStateException: process has not exited Any ideas as to why my process will not exit? Or do you have any libraries to suggest that handle executing batch files properly and wait until the execution is finished?

    Read the article

  • how to get trac to run with apache?

    - by ajsie
    i have some problems getting trac to be running with apache. have no idea of how to do and the tutorial i followed doesnt work. i have an empty /etc/apache2/httpd.conf. should it be empty? then i followed the tutorial (http://trac.edgewall.org/wiki/TracModPython) and typed in: LoadModule python_module modules/mod_python.so so now it contains one row. i have ubuntu and i installed mod_python with: apt-get install libapache2-mod-python libapache2-mod-python-doc however, when i run a2enmod mod_python it says: ERROR: Module mod_python does not exist! but i have checked that it exists in /usr/lib/apache2/modules/mod_python.so. so whats the problem?

    Read the article

  • Embedding swank-clojure in java program

    - by user237417
    Based on the Embedding section of http://github.com/technomancy/swank-clojure, I'm using the following to test it out. Is there a better way to do this that doesn't use Compiler? Is there a way to programmatically stop swank? It seems start-repl takes control of the thread. What would be a good way to spawn off another thread for it and be able to kill that thread programatically. import clojure.lang.Compiler; import java.io.StringReader; public class Embed { public static void main(String[] args) throws Exception { final String startSwankScript = "(ns my-app\n" + " (:use [swank.swank :as swank]))\n" + "(swank/start-repl) "; Compiler.load(new StringReader(startSwankScript)); } } Any help much appreciated, hhh

    Read the article

  • ICalendar not readable by google calendar.

    - by Sagar
    Operating system : WinXP Program and version you use to access Google Calendar (FF3.5): I'm developing a script (based on an existing vCal ASP.NET class I found online) to generate an .ics file. This file works perfectly when importing to Outlook 2003. When I try to import to Google Calendar, I get the following error: Failed to import events: Unable to process your iCal/CSV file.. I don't know too much about the vCal format or syntax, but everything looks fine to me. I'll post the sample test calendar .ics below: BEGIN:VCALENDAR PRODID:-//jpalm.se//iCalendar example with ASP.NET MVC//EN VERSION:2.0 CALSCALE:GREGORIAN METHOD:PUBLISH X-MS-OLK-FORCEINSPECTOROPEN:TRUE BEGIN:VEVENT DTSTART:20100304T000000Z DTEND:20100304T000000Z TRANSP:OPAQUE SEQUENCE:0 UID:7c9d6dd7-41f2-4171-8ae4-35820974efa4 DESCRIPTION:uba:Project20100321:sagar . SUMMARY:First Milestone END:VEVENT X-MS-OLK-FORCEINSPECTOROPEN:TRUE BEGIN:VEVENT DTSTART:20100330T230000Z DTEND:20100330T230000Z TRANSP:OPAQUE SEQUENCE:0 UID:8a982519-b99b-429a-8dad-c0f95c50d0e6 DESCRIPTION:uba:Project20100321:imanage2010 pm SUMMARY:upcoming milestones END:VEVENT X-MS-OLK-FORCEINSPECTOROPEN:TRUE BEGIN:VEVENT DTSTART:20100329T230000Z DTEND:20100329T230000Z TRANSP:OPAQUE SEQUENCE:0 UID:588750a1-6f10-4b5d-8a51-3f3818024726 DESCRIPTION:uba:Project20100321:sagar . SUMMARY:test END:VEVENT X-MS-OLK-FORCEINSPECTOROPEN:TRUE BEGIN:VEVENT DTSTART:20100407T230000Z DTEND:20100407T230000Z TRANSP:OPAQUE SEQUENCE:0 UID:36eaa726-a0a0-40a1-ba7c-09857f8ed006 DESCRIPTION:uba:Project20100321:imanage2010 pm SUMMARY:Rad apps devs END:VEVENT X-MS-OLK-FORCEINSPECTOROPEN:TRUE BEGIN:VEVENT DTSTART:20100408T125632Z DTEND:20100408T125632Z TRANSP:OPAQUE SEQUENCE:0 UID:8521ad53-916a-43cc-8eeb-42c1b3d670d3 DESCRIPTION:uba:Project20100321:imanage2010 pm SUMMARY:this is a test ms END:VEVENT X-MS-OLK-FORCEINSPECTOROPEN:TRUE BEGIN:VEVENT DTSTART:20100415T125643Z DTEND:20100415T125643Z TRANSP:OPAQUE SEQUENCE:0 UID:e4b295d8-2271-4393-9899-3e9c858f4e8c DESCRIPTION:uba:Project20100321:imanage2010 pm SUMMARY:Test msssss END:VEVENT X-MS-OLK-FORCEINSPECTOROPEN:TRUE BEGIN:VEVENT DTSTART:20100430T055201Z DTEND:20100430T055201Z TRANSP:OPAQUE SEQUENCE:0 UID:1e464698-1064-4cb2-8166-2a843b63ca5a DESCRIPTION:uba:Project20100321:imanage2010 pm SUMMARY:this is a new milestones for testing on 30th april END:VEVENT X-MS-OLK-FORCEINSPECTOROPEN:TRUE BEGIN:VEVENT DTSTART:20100731T093917Z DTEND:20100731T093917Z TRANSP:OPAQUE SEQUENCE:0 UID:5262ef58-73bc-4d66-a207-4e884e249629 DESCRIPTION:uba:Project20100321:imanage2010 pm SUMMARY:555555555555555555 END:VEVENT X-MS-OLK-FORCEINSPECTOROPEN:TRUE BEGIN:VEVENT DTSTART:20100328T230000Z DTEND:20100328T230000Z TRANSP:OPAQUE SEQUENCE:0 UID:f654262d-714e-41d9-9690-005bb467f8aa DESCRIPTION:uba:Untitled project:imanage2010 pm SUMMARY:first milestone END:VEVENT X-MS-OLK-FORCEINSPECTOROPEN:TRUE BEGIN:VEVENT DTSTART:20100401T095537Z DTEND:20100401T095537Z TRANSP:OPAQUE SEQUENCE:0 UID:3f4a6c16-f460-457d-a281-b4c010958796 DESCRIPTION:uba:ProjectIcal:imanage2010 pm SUMMARY:new ms ical END:VEVENT X-MS-OLK-FORCEINSPECTOROPEN:TRUE BEGIN:VEVENT DTSTART:20100331T230000Z DTEND:20100331T230000Z TRANSP:OPAQUE SEQUENCE:0 UID:e5bf28d1-3559-48e9-90f8-2b5233489a13 DESCRIPTION:uba:ProjectIcal:imanage2010 pm SUMMARY:new ms 2 ical END:VEVENT END:VCALENDAR And the source for generating the above code is which is nothing but the mvc view:: <%@ Import Namespace ="iManageProjectPM.Controllers" % <%@ Page Language="C#" Inherits="System.Web.Mvc.ViewPage"% BEGIN:VCALENDAR VERSION:2.0<%if (Model.Events.Count 1) {% CALSCALE:GREGORIAN METHOD:PUBLISH<%}% X-MS-OLK-FORCEINSPECTOROPEN:TRUE <%foreach(var evnt in Model.Events){% BEGIN:VEVENT DTSTART<%=Model.GetTimeString(evnt.StartTime)% DTEND<%=Model.GetTimeString(evnt.EndTime)% TRANSP:OPAQUE SEQUENCE:0 UID:<%=evnt.UID% DESCRIPTION:<%=evnt.Desc% SUMMARY:<%=evnt.Title% END:VEVENT<%}% END:VCALENDAR

    Read the article

  • What is the scope of xsl apply-imports?

    - by calavera.info
    My original idea about apply-imports was that if there are two templates which matches the same node, then using apply-imports in a template with higher priority runs the template with the lower priority. But I recently find out that it's important how are imports organized. Two cases interests me particularly. Will apply imports work on a template which is imported in imported file (nested import)? How about a "sibling import" (master file imports two files with templates matching the same nodes) It seems to me that this is not clearly described in specification. Could someone provide authoritative guidelines? EDIT: I can try those cases on my own, but there is always a danger that it will be implementation specific behavior.

    Read the article

  • Haskell: Left-biased/short-circuiting function

    - by user2967411
    Two classes ago, our professor presented to us a Parser module. Here is the code: module Parser (Parser,parser,runParser,satisfy,char,string,many,many1,(+++)) where import Data.Char import Control.Monad import Control.Monad.State type Parser = StateT String [] runParser :: Parser a -> String -> [(a,String)] runParser = runStateT parser :: (String -> [(a,String)]) -> Parser a parser = StateT satisfy :: (Char -> Bool) -> Parser Char satisfy f = parser $ \s -> case s of [] -> [] a:as -> [(a,as) | f a] char :: Char -> Parser Char char = satisfy . (==) alpha,digit :: Parser Char alpha = satisfy isAlpha digit = satisfy isDigit string :: String -> Parser String string = mapM char infixr 5 +++ (+++) :: Parser a -> Parser a -> Parser a (+++) = mplus many, many1 :: Parser a -> Parser [a] many p = return [] +++ many1 p many1 p = liftM2 (:) p (many p) Today he gave us an assignment to introduce "a left-biased, or short-circuiting version of (+++)", called (<++). His hint was for us to consider the original implementation of (+++). When he first introduced +++ to us, this was the code he wrote, which I am going to call the original implementation: infixr 5 +++ (+++) :: Parser a -> Parser a -> Parser a p +++ q = Parser $ \s -> runParser p s ++ runParser q s I have been having tons of trouble since we were introduced to parsing and so it continues. I have tried/am considering two approaches. 1) Use the "original" implementation, as in p +++ q = Parser $ \s - runParser p s ++ runParser q s 2) Use the final implementation, as in (+++) = mplus Here are my questions: 1) The module will not compile if I use the original implementation. The error: Not in scope: data constructor 'Parser'. It compiles fine using (+++) = mplus. What is wrong with using the original implementation that is avoided by using the final implementation? 2) How do I check if the first Parser returns anything? Is something like (not (isNothing (Parser $ \s - runParser p s) on the right track? It seems like it should be easy but I have no idea. 3) Once I figure out how to check if the first Parser returns anything, if I am to base my code on the final implementation, would it be as easy as this?: -- if p returns something then p <++ q = mplus (Parser $ \s -> runParser p s) mzero -- else (<++) = mplus Best, Jeff

    Read the article

  • Can FPDF/FPDI use a PDF in landscape format as a template?

    - by Jim OHalloran
    I am trying to import an existing PDF as a template with FPDI. The template is in landscape format. If I import the template into a new document the template page is inserted in portrait form with the content rotated 90 degrees. If my new document is in portrait the full content appears, but if the new document is also landscape, the content is cropped. Is it possible to use a landscape template with FPDI? Thanks in advance! Jim.

    Read the article

  • Haskell: how to get through 'no instance for' ?

    - by artemave
    I am learning Haskell. I am on the 8th chapter of this book. The main thing I've learned so far is that Haskell is very unfriendly to me and it bites my ass where possible. Moreover... Heck! Enough mourning, to business. Here is the code: module GlobRegex ( globToRegex, matchesGlob ) where import Text.Regex.Posix import Text.Regex.Posix.String import Text.Regex.Base.RegexLike data CaseOpt = Case | NoCase deriving (Eq) matchesGlob :: String -> String -> CaseOpt -> Bool matchesGlob name pat caseopt = match regex name where regex = case caseopt of NoCase -> makeRegexOpts (defaultCompOpt + compIgnoreCase) defaultExecOpt (globToRegex pat) Case -> makeRegex (globToRegex pat) globToRegex :: String -> String ... And here is how it fails to compile: Prelude Text.Regex.Posix Text.Regex.Base.RegexLike> :load globtoregex\GlobRegex. hs [1 of 1] Compiling GlobRegex ( globtoregex\GlobRegex.hs, interpreted ) globtoregex\GlobRegex.hs:14:31: No instance for (RegexLike regex [Char]) arising from a use of `match' at globtoregex\GlobRegex.hs:14:31-46 Possible fix: add an instance declaration for (RegexLike regex [Char]) In the expression: match regex name In the definition of `matchesGlob': matchesGlob name pat caseopt = match regex name where regex = case caseopt of { NoCase -> makeRegexOpts (defaultCompOpt + compIgnoreCase) defaultExecOpt (globToRegex pat) Case -> makeRegex (globToRegex pat) } globtoregex\GlobRegex.hs:17:23: No instance for (RegexMaker regex CompOption execOpt String) arising from a use of `makeRegex' at globtoregex\GlobRegex.hs:17:23-49 Possible fix: add an instance declaration for (RegexMaker regex CompOption execOpt String) In the expression: makeRegex (globToRegex pat) In a case alternative: Case -> makeRegex (globToRegex pat) In the expression: case caseopt of { NoCase -> makeRegexOpts (defaultCompOpt + compIgnoreCase) defaultExecOpt (globToRegex p at) Case -> makeRegex (globToRegex pat) } Failed, modules loaded: none. To my best understanding, Text.Regex.Posix.String provides instances for RegexLike Regex String and RegexMaker Regex CompOption ExecOption String, so it should work. On the other hand, I can see that regex in the error message is type variable, not a concrete type, so, perhaps not... Anyway, this is where I am stuck. May be there is a common pattern for resolving no instance for type of problems? Or, in Haskell terms, instance of SmartGuess typeclass for no instance for?

    Read the article

  • Django Admin drop down combobox and assigned values

    - by Daniel Garcia
    I have several question for the Django Admin feature. Im kind of new in Django so im not sure how to do it. Basically what Im looking to do is when Im adding information on the model. Some of the fields i want them to be drop-downs and maybe combo-boxes with AutoCompleteMode. Also looking for some fields to have the same information, for example if i have a datatime field I want that information to feed the fields day, month and year from hoti.hotiapp.models import Occurrence from django.contrib import admin class MyModelAdmin(admin.ModelAdmin): exclude = ['reference',] admin.site.register(Occurrence, MyModelAdmin) Anything helps Thanks in advance

    Read the article

  • How to create an Intellij and Eclipse compatible code style and code formatting configuration (for j

    - by user141634
    Few weeks ago I tried Intellij and I found it really awesome. Now, at my project there's two programmers (including me) using Intellij and few other programmers gonna still be using Eclipse. Since this project is already very large and it gonna be growing a lot, we need to use compatible Code Style and Code Formatting between Intellij and Eclipse. We do not want to have problems when one user edit one file and reformat it before save. With Eclipse "alone" we used to have some exported configuration, and before anybody starts to work, the first step is just to import this configuration. We already tried to use External Code Formatter, but it didn't work on Intellij 9. So, I have a bunch of questions here: 1 - Is there any way to import eclipse formatting configuration on Intellij 9? 2 - Anybody could share their experience managing this kind of situation? Do you guys have any other suggestion to manage this situation?

    Read the article

  • Rails 3 and Bootstrap 2.1.0 - can't fix my footer

    - by ExiRe
    I have Rails application with bootstrap 2.1.0 (i use twitter-bootstrap-rails gem for that). But i can't get working footer. It is not visible unless i scroll down the page. I can't get how to fix that. Application.html.haml !!! %html %head %title MyApp = stylesheet_link_tag "application", :media => "all" = javascript_include_tag "application" = csrf_meta_tags %meta{ :name => "viewport", :content => "width=device-width, initial-scale=1.0" } %body %div{ :class => "wrapper" } = render 'layouts/navbar_template' %div{ :class => "container-fluid" } - flash.each do |key, value| = content_tag( :div, value, :class => "alert alert-#{key}" ) %div{ :class => "row-fluid" } %div{:class => "span10"} =yield %div{:class => "span2"} %h2 Test sidebar %footer{ :class => "footer" } = debug(params) if Rails.env.development? bootstrap_and_overrides.css.less @import "twitter/bootstrap/bootstrap"; body { padding-top: 60px; } @import "twitter/bootstrap/responsive"; // Set the correct sprite paths @iconSpritePath: asset-path('twitter/bootstrap/glyphicons-halflings.png'); @iconWhiteSpritePath: asset-path('twitter/bootstrap/glyphicons-halflings-white.png'); // Set the Font Awesome (Font Awesome is default. You can disable by commenting below lines) // Note: If you use asset_path() here, your compiled boostrap_and_overrides.css will not // have the proper paths. So for now we use the absolute path. @fontAwesomeEotPath: '/assets/fontawesome-webfont.eot'; @fontAwesomeWoffPath: '/assets/fontawesome-webfont.woff'; @fontAwesomeTtfPath: '/assets/fontawesome-webfont.ttf'; @fontAwesomeSvgPath: '/assets/fontawesome-webfont.svg'; // Font Awesome @import "fontawesome"; // Your custom LESS stylesheets goes here // // Since bootstrap was imported above you have access to its mixins which // you may use and inherit here // // If you'd like to override bootstrap's own variables, you can do so here as well // See http://twitter.github.com/bootstrap/less.html for their names and documentation // // Example: // @linkColor: #ff0000; //MY CSS IS HERE. html, body { height: 100%; } footer { color: #666; background: #F5F5F5; padding: 17px 0 18px 0; border-top: 1px solid #000; } footer a { color: #999; } footer a:hover { color: #efefef; } .wrapper { min-height: 100%; height: auto !important; height: 10px; margin-bottom: -10px; }

    Read the article

  • Trying to understand Java Classloading

    - by Jens
    Hello, I'm currently getting to know Java and OSGi, so I've read a few books. In one particular book the class loading is described. You can download it (free and legal) from the authors page (Neil Bartlett): OSGi Book On page 9 and 10 are this pictures: It seems like there is the possibility that our class "Foo" won't use the class "Bar" of foobar.jar, but instead class "Bar" from naughty.jar. Because of the flat and global structure of the Java classpath this could be, but as far as I know you would define a package from where you want to import a certain class: import foobar.Bar This should prevent loading the wrong class, shouldn't it? Of course assuming that the package is called "foobar".

    Read the article

  • apache virtual host to work with django

    - by khelll
    My project is under: /home/projects/testing and I'm adding this to the buttom of my /etc/httpd/conf/httpd.conf file on Centos machine, but that is not working, <Location "/testing/"> SetHandler python-program PythonHandler django.core.handlers.modpython SetEnv DJANGO_SETTINGS_MODULE testing.settings PythonOption django.root /testing PythonDebug On PythonPath "['/home/projects/'] + sys.path" </Location> but when requesting http://localhost/testing/jobs for example, I get: Mod_python error: "PythonHandler django.core.handlers.modpython" Traceback (most recent call last): File "/usr/lib/python2.4/site-packages/mod_python/apache.py", line 299, in HandlerDispatch result = object(req) ............. File "/usr/lib/python2.4/site-packages/Django-1.1.1-py2.4.egg/django/conf/__init__.py", line 75, in __init__ raise ImportError, "Could not import settings '%s' (Is it on sys.path? Does it have syntax errors?): %s" % (self.SETTINGS_MODULE, e) ImportError: Could not import settings 'testing.settings' (Is it on sys.path? Does it have syntax errors?): No module named testing.settings

    Read the article

  • Reading inputs in java

    - by Gandalf StormCrow
    Hello everyone I'm trying to improve my Java skills by solving some problems from ACM, now the thing is my sample input looks like this : 3 100 34 100 75 250 27 2147483647 101 304 101 303 -1 -1 So at first I'm just trying to read them but its not working here is the java code: import java.io.BufferedInputStream; import java.util.Scanner; public class Main { public static void main(String args[]) { Scanner stdin = new Scanner(new BufferedInputStream(System.in)); while (stdin.hasNext()) { System.out.println(stdin.nextInt() + " and the next " + stdin.nextInt()); } } } I'm trying to send these inputs as an argument, and not by reading them from file, here is how: The program just spins(executes) but not printing anything. How can I fix this?

    Read the article

  • Andorid - Display HTML Formatted String

    - by Soren
    I need an example how to display the strings that I have marked up with simple html into a TextView. I have found "Spanned fromHtml(String source)", but I don't know how to plug it into my java code. Here is my Java: package com.SorenWinslow.TriumphHistory; import android.app.ListActivity; import android.os.Bundle; import android.widget.ArrayAdapter; public class TriumphHistory extends ListActivity { String[] HistoryList; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); ArrayAdapter<String> adapter; HistoryList = getResources().getStringArray(R.array.history); adapter = new ArrayAdapter<String> (this,R.layout.historylistlayout,HistoryList); setListAdapter(adapter); } } Here is a sample of history: <?xml version="1.0" encoding="utf-8"?> <resources> <string-array name="history"> <item><b>1883</b><br/>Some stuff happened</item> <item><b>1884</b><br/>Some more stuff happened <i>before</i> the other stuff </item> <resources> Here is my historylistlayout.xml: <?xml version="1.0" encoding="utf-8"?> <TextView xmlns:android="http://schemas.android.com/apk/res/android" android:id="@android:id/text1" android:layout_width="fill_parent" android:layout_height="wrap_content" android:textAppearance="?android:attr/textAppearanceLarge" android:gravity="center_vertical" android:textColor="#ffffff" android:background="#000050" android:layout_marginTop="5px" android:minHeight="?android:attr/listPreferredItemHeight" android:padding="3px" android:textSize="8pt" android:layout_gravity="top|left"/> And here is my main.xml <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:orientation="vertical" android:textColor="#ffffff" android:background="#000080" android:isScrollContainer="true" android:layout_height="fill_parent" android:layout_width="fill_parent" android:scrollbarStyle="insideOverlay"> <ListView xmlns:android="http://schemas.android.com/apk/res/android" android:id="@android:id/list" android:layout_width="fill_parent" android:layout_height="wrap_content" android:clickable="true" android:dividerHeight="1px"/> </LinearLayout>

    Read the article

  • Web Service Client Java

    - by zeckk
    I generated java web service client from here -- http://api.search.live.net/search.wsdl.. I want to make search and listing the return values. How i can show result ? my code is : import java.rmi.RemoteException; import com.microsoft.schemas.LiveSearch._2008._03.Search.*; public class searchtry { public static void main(String[] args) throws RemoteException { LiveSearchPortTypeProxy client=new LiveSearchPortTypeProxy(); SearchRequest request=new SearchRequest(); SearchRequestType1 type1=new SearchRequestType1(); sorgu.setAppId("*****************"); //Windows Live gave this id for using that service sorgu.setSources(new SourceType[]{SourceType.Web}); sorgu.setQuery("Java"); aratip.setParameters(request); SearchResponseType0 answer= client.search(type1); System.out.println(answer.toString()); }

    Read the article

  • Obj-msg-send error in numberOfSectionsInTableView

    - by mukeshpawar
    import "AddBillerCategoryViewController.h" import "Globals.h" import "AddBillerViewController.h" import "AddBillerListViewController.h" import"KlinnkAppDelegate.h" @implementation AddBillerCategoryViewController @synthesize REASON, RESPVAR, currentAttribute,tbldata,strOptions; // This recipe adds a title for each section //Initialize the table view controller with the grouped style (AddBillerCategoryViewController *) init { if (self = [super initWithStyle:UITableViewStyleGrouped]);// self.title = @"Crayon Colors"; return self; } -(void)showBack { [[self navigationController] pushViewController:[[AddBillerViewController alloc] init] animated:YES]; } (void)navigationController:(UINavigationController *)navigationController willShowViewController:(UIViewController *)viewController animated:(BOOL)animated { if ([viewController isKindOfClass:[AddBillerCategoryViewController class]]) { AddBillerCategoryViewController *controller = (AddBillerCategoryViewController *)viewController; [controller.tbldata reloadData]; } } (void)viewDidLoad { appDelegate = (KlinnkAppDelegate *)[[UIApplication sharedApplication] delegate]; appDelegate.catListArray.count; // Uncomment the following line to display an Edit button in the navigation bar for this view controller. // self.navigationItem.rightBarButtonItem = self.editButtonItem; //self.navigationItem.leftBarButtonItem = [[[UIBarButtonItem alloc] // initWithTitle:@"Back" // style:UIBarButtonItemStylePlain // target:self // action:@selector(showBack)] autorelease]; if(gotOK == 0) { //self.navigationItem.leftBarButtonItem.enabled = FALSE; dt = [[DateTime alloc] init]; strChannelID = @"IGLOO|MOBILE"; strDateTime = [dt findDateTime]; strTemp = [dt findSessionTime]; strSessionID = [appDelegate.KMobile stringByAppendingString:strTemp]; strResponseURL = @"http://115.113.110.139/Test/CbbpServerRequestHandler"; strResponseVar = @"serverResponseXML"; strRequestType = @"GETCATEGORY"; NSLog(@"Current Session id - %@", strSessionID); //conn = [[NSURLConnection alloc] init]; receivedData = [[NSMutableData data] retain]; //.................... currentAttribute = [[NSMutableString alloc] init]; // create XMl xmlData = [[NSData alloc] init]; xmlData = [self createXML]; // XMl has been created now convert it in to string xmlString = [[NSString alloc] initWithData:xmlData encoding:NSASCIIStringEncoding]; // Ataching other infromatin to he xml parameterString = [[NSString alloc] initWithString:@"mobileRequestXML="]; requestString = [[NSString alloc] init]; requestString = [parameterString stringByAppendingString:xmlString]; // give space betn two element. requestString = [requestString stringByReplacingOccurrencesOfString:@"<" withString:@" <"]; // Initalizing other parameters postData = [requestString dataUsingEncoding:NSASCIIStringEncoding allowLossyConversion:YES]; postLength = [NSString stringWithFormat:@"%d",[postData length]]; firstRequest = [[[NSMutableURLRequest alloc] init] autorelease]; REASON = [[NSMutableString alloc] init]; RESPVAR = [[NSMutableString alloc] init]; NSLog(@"\n \n Sending for 1st time........\n"); [self sendRequest]; NSLog(@"\n \n Sending for 2nd time........\n"); [self sendRequest]; NSLog(@"\n \n both request send........\n \n "); } //[tbldata reloadData]; [self retain]; [super viewDidLoad]; } -(void)sendRequest { finished = FALSE; NSLog(@"\n Sending Request \n\n %@", requestString); conn = [[NSURLConnection alloc] init]; if(gotOK == 0) [firstRequest setURL:[NSURL URLWithString:@"http://115.113.110.139/Test/CbbpMobileRequestHandler"]]; if(gotOK == 1) { [firstRequest setURL:[NSURL URLWithString:@"http://115.113.110.139//secure"]]; gotOK = 2; } [firstRequest setHTTPMethod:@"POST"]; [firstRequest setValue:postLength forHTTPHeaderField:@"Content-Length"]; [firstRequest setValue:@"application/x-www-form-urlencoded" forHTTPHeaderField:@"Content-Type"]; [firstRequest setHTTPBody:postData]; conn = [conn initWithRequest:firstRequest delegate:self startImmediately:YES]; [conn start]; while(!finished) { [[NSRunLoop currentRunLoop] runMode:NSDefaultRunLoopMode beforeDate:[NSDate distantFuture]]; } if (conn) { //receivedData = [[NSMutableData data] retain]; NSLog(@"\n\n Received %d bytes of data",[receivedData length]); } else { NSLog(@"\n Not responding"); } } (void)connection:(NSURLConnection *)connection didReceiveResponse:(NSURLResponse *)response { NSLog(@" \n Send didReciveResponse"); [receivedData setLength:0]; } (void)connection:(NSURLConnection *)connection didReceiveData:(NSData *)data { NSLog(@" \n Send didReciveData"); [receivedData appendData:data]; } (void)connectionDidFinishLoading:(NSURLConnection *)connection { finished = TRUE; NSLog(@" \n Send didFinishLaunching"); // do something with the data // receivedData is declared as a method instance elsewhere NSLog(@"\n\n Succeeded! DIDFINISH Received %d bytes of data\n\n ",[receivedData length]); NSString *aStr = [[NSString alloc] initWithData:receivedData encoding:NSASCIIStringEncoding]; NSLog(aStr); //[conn release]; if([aStr isEqualToString:@"OK"]) gotOK = 1; NSLog(@" Value of gotOK - %d", gotOK); if(gotOK == 2) { responseData = [aStr dataUsingEncoding:NSASCIIStringEncoding allowLossyConversion:YES]; parser = [[NSXMLParser alloc] initWithData:responseData]; [parser setDelegate:self]; NSLog(@"\n start parsing"); [parser parse]; NSLog(@"\n PArsing over"); NSLog(@"\n check U / S and the RESVAR is - %@",RESPVAR); NSRange textRange; textRange =[aStr rangeOfString:@"<"]; if(textRange.location != NSNotFound) { if([RESPVAR isEqualToString:@"U"]) { self.navigationItem.rightBarButtonItem.enabled = TRUE; self.navigationItem.leftBarButtonItem.enabled = TRUE; NSLog(@" \n U......."); UIAlertView *alert = [[UIAlertView alloc] initWithTitle:@"Error" message:REASON delegate:self cancelButtonTitle:nil otherButtonTitles:@"OK", nil]; [alert show]; [alert release]; } if([RESPVAR isEqualToString:@"S"]) { NSLog(@"\n S........"); [[self navigationController] pushViewController:[[AddBillerCategoryViewController alloc] init] animated:YES]; //[self viewDidLoad]; //[tbldata reloadData]; } } else { UIAlertView *alert = [[UIAlertView alloc] initWithTitle:@"Connection Problem" message:@"Enable to process your request at this time. Please try again." delegate:self cancelButtonTitle:nil otherButtonTitles:@"OK", nil]; [alert show]; [alert release]; //self.navigationItem.leftBarButtonItem.enabled = TRUE; } } NSLog(@"\n Last line of connectionDidFinish "); //[tableView reloadData]; } -(NSData *)createXML { NSString *strXmlNode = @" channel alliaceid session reqtype responseurl responsevar "; NSString *tempchannel = [strXmlNode stringByReplacingOccurrencesOfString:@"channel" withString:strChannelID options:NSBackwardsSearch range:NSMakeRange(0, [strXmlNode length])]; NSString *tempalliance = [tempchannel stringByReplacingOccurrencesOfString:@"alliaceid" withString:@"WALLET365" options:NSBackwardsSearch range:NSMakeRange(0, [tempchannel length])]; NSString *tempsession = [tempalliance stringByReplacingOccurrencesOfString:@"session" withString:strSessionID options:NSBackwardsSearch range:NSMakeRange(0, [tempalliance length])]; NSString *tempreqtype = [tempsession stringByReplacingOccurrencesOfString:@"reqtype" withString:strRequestType options:NSBackwardsSearch range:NSMakeRange(0,[tempsession length])]; NSString *tempresponseurl = [tempreqtype stringByReplacingOccurrencesOfString:@"responseurl" withString:strResponseURL options:NSBackwardsSearch range:NSMakeRange(0, [tempreqtype length])]; NSString *tempresponsevar = [tempresponseurl stringByReplacingOccurrencesOfString:@"responsevar" withString:strResponseVar options:NSBackwardsSearch range:NSMakeRange(0,[tempresponseurl length])]; NSData *data= [[NSString stringWithString:tempresponsevar] dataUsingEncoding:NSUTF8StringEncoding]; return data; } (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName attributes:(NSDictionary *)attributeDict { if([elementName isEqualToString:@"RESPVAL"]) currentAttribute = [NSMutableString string]; if([elementName isEqualToString:@"REASON"]) currentAttribute = [NSMutableString string]; if([elementName isEqualToString:@"COUNT"]) currentAttribute = [NSMutableString string]; if([elementName isEqualToString:@"CATNAME"]) currentAttribute = [NSMutableString string]; } (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName { if([elementName isEqualToString:@"RESPVAL"]) { [RESPVAR setString:currentAttribute]; //NSLog(@"\n Response VAR - %@", RESPVAR); } if([elementName isEqualToString:@"REASON"]) { [REASON setString:currentAttribute]; //NSLog(@"\n Reason - %@", REASON); } if([elementName isEqualToString:@"COUNT"]) { NSString *temp1 = [[NSString alloc] init]; temp1 = [temp1 stringByAppendingString:currentAttribute]; catCount = [temp1 intValue]; [temp1 release]; //NSLog(@"\n Cat Count - %d", catCount); } if([elementName isEqualToString:@"CATNAME"]) { [appDelegate.catListArray addObject:[NSString stringWithFormat:currentAttribute]]; //NSLog(@"%@", appDelegate.catListArray); } } (void)parser:(NSXMLParser *)parser foundCharacters:(NSString *)string { if(self.currentAttribute) [self.currentAttribute setString:string]; } /* (void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; } */ /* (void)viewDidAppear:(BOOL)animated { [super viewDidAppear:animated]; } */ /* (void)viewWillDisappear:(BOOL)animated { [super viewWillDisappear:animated]; } */ /* (void)viewDidDisappear:(BOOL)animated { [super viewDidDisappear:animated]; } */ /* // Override to allow orientations other than the default portrait orientation. (BOOL)shouldAutorotateToInterfaceOrientation:(UIInterfaceOrientation)interfaceOrientation { // Return YES for supported orientations return (interfaceOrientation == UIInterfaceOrientationPortrait); } */ (void)didReceiveMemoryWarning { [super didReceiveMemoryWarning]; // Releases the view if it doesn't have a superview // Release anything that's not essential, such as cached data } pragma mark Table view methods -(NSInteger)numberOfSectionsInTableView:(UITableView *)tableView { return 1; } // Customize the number of rows in the table view. -(NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { KlinnkAppDelegate *appDelegated = (KlinnkAppDelegate *)[[UIApplication sharedApplication] delegate]; return appDelegated.catListArray.count; } // Customize the appearance of table view cells. (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:CellIdentifier] autorelease]; } // Set up the cell... AddBillerCategoryViewController *mbvc = (AddBillerCategoryViewController *)[appDelegate.catListArray objectAtIndex:indexPath.row]; [cell setText:mbvc.strOptions]; return cell; } (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { // Navigation logic may go here. Create and push another view controller. // AnotherViewController *anotherViewController = [[AnotherViewController alloc] initWithNibName:@"AnotherView" bundle:nil]; // [self.navigationController pushViewController:anotherViewController]; // [anotherViewController release]; gotOK = 0; int j = indexPath.row; appDelegate.catName = [[NSString alloc] init]; appDelegate.catName = [appDelegate.catName stringByAppendingString:[appDelegate.catListArray objectAtIndex:j]]; [[self navigationController] pushViewController:[[AddBillerListViewController alloc] init] animated:YES]; } /* // Override to support conditional editing of the table view. (BOOL)tableView:(UITableView *)tableView canEditRowAtIndexPath:(NSIndexPath *)indexPath { // Return NO if you do not want the specified item to be editable. return YES; } */ /* // Override to support editing the table view. (void)tableView:(UITableView *)tableView commitEditingStyle:(UITableViewCellEditingStyle)editingStyle forRowAtIndexPath:(NSIndexPath *)indexPath { if (editingStyle == UITableViewCellEditingStyleDelete) { // Delete the row from the data source [tableView deleteRowsAtIndexPaths:[NSArray arrayWithObject:indexPath] withRowAnimation:YES]; } else if (editingStyle == UITableViewCellEditingStyleInsert) { // Create a new instance of the appropriate class, insert it into the array, and add a new row to the table view } } */ /* // Override to support rearranging the table view. (void)tableView:(UITableView *)tableView moveRowAtIndexPath:(NSIndexPath *)fromIndexPath toIndexPath:(NSIndexPath *)toIndexPath { } */ /* // Override to support conditional rearranging of the table view. (BOOL)tableView:(UITableView *)tableView canMoveRowAtIndexPath:(NSIndexPath *)indexPath { // Return NO if you do not want the item to be re-orderable. return YES; } */ (void)dealloc { [REASON release]; [RESPVAR release]; [currentAttribute release]; [tbldata release]; [super dealloc]; } @end In the Above code .. numberOfSectionsInTableView ,i get error of obj-msg-send i have intialize the array catlist and even not released it anywhere still why i am getting this error please help me i am badly stuck' thanks in advacnce

    Read the article

  • Xpages - Get number of active sessions

    - by Jairo
    How do I get the number of active sessions in Xpage. I'm trying to use managed beans but it just returns a weird string. Here's the simple code: import javax.servlet.http.HttpSessionEvent; import javax.servlet.http.HttpSessionListener; public class SessionCounterListener implements HttpSessionListener { private static int totalActiveSessions; public static int getTotalActiveSessions(){ return totalActiveSessions | 0; } public void sessionCreated(HttpSessionEvent arg0) { totalActiveSessions++; System.out.println("sessionCreated - add one session into counter"); } public void sessionDestroyed(HttpSessionEvent arg0) { totalActiveSessions--; System.out.println("sessionDestroyed - deduct one session from counter"); } } I got this from here. But when I call SessionCounterListener.getTotalActiveSessions(), it only returns a weird string, example com.gs3.beans.SessionCounterListener@46c446c4. Please help me. Thanks a lot!

    Read the article

< Previous Page | 555 556 557 558 559 560 561 562 563 564 565 566  | Next Page >