Search Results

Search found 59278 results on 2372 pages for 'time estimation'.

Page 566/2372 | < Previous Page | 562 563 564 565 566 567 568 569 570 571 572 573  | Next Page >

• Windows Service suddenly doing nothing

  - by TB

  Hi, My windows service is using a Thread (not a timer) which is always looping and sleeps for 1 second every loop using : evet.WaitOne(interval); When I start the service it works fine and I can see in the task manager that it is running, consuming and releasing memory, consuming processor ... etc that is all normal, but after a while (random amount of time) the service simply stops!! it is still there in the task manager but it is not consuming any processor work now and its consumption to the memory is not changing. it simply (died but still there in the task manager like a Zombie). I know that many exceptions might have happened during running the service (it is really doing many things) but all those exceptions are handled in Try catch blocks, so why is my "always looping" thread stops ??? This thread also logs every time he loops, when he is freezig in this way he is not logging anything (of course)

  Read the article

• How do I safely destroy a dialog window of a wxPython application?

  - by Akira

  I created a wxPython application which shows some messages on a dialog window. The dialog window is needed to be force-destroyed by the application before I click the dialog OK button. I used wx.lib.delayedresult to make the destroy call. My code is: import wx dlg=wx.MessageDialog(somewindow,'somemessage') from wx.lib.delayedresult import startWorker def _c(d): dlg.EndModal(0) dlg.Destroy() def _w(): import time time.sleep(1.0) startWorker(_c,_w) dlg.ShowModal() This can do what I desire to do while I got a error message below: (python:15150): Gtk-CRITICAL **: gtk_widget_destroy: assertion `GTK_IS_WIDGET (widget)' failed How do I "safely" destroy a dialog without clicking the dialog button?

  Read the article

• Marker on Google Map added only once.

  - by Vafello

  I have the following code: function clicked(overlay, latlng) { var icon3 = new GIcon(); icon3.image = "marker.png"; icon3.iconAnchor = new GPoint(15, 40); var marker2 = new GMarker(latlng, { icon: icon3, draggable: true, title: 'Drag me' }); map.addOverlay(marker2); } Each time I click on the map a new marker is placed on the map. The problem is that I need only one marker and if I click several times, each time a new marker is added. How to change the code so only one marker is placed and when the map is clicked again it just changes its location?

  Read the article

• expand a varchar column very slowly , why?

  - by francs

  Hi We need to modify a column of a big product table , usually normall ddl statments will be excutely fast ,but the above ddl statmens takes about 10 minnutes?I wonder know the reason! I just want to expand a varchar column?The following is the detailsl --table size wapreader_log= select pg_size_pretty(pg_relation_size('log_foot_mark')); pg_size_pretty ---------------- 5441 MB (1 row) --table ddl wapreader_log= \d log_foot_mark Table "wapreader_log.log_foot_mark" Column | Type | Modifiers -------------+-----------------------------+----------- id | integer | not null create_time | timestamp without time zone | sky_id | integer | url | character varying(1000) | refer_url | character varying(1000) | source | character varying(64) | users | character varying(64) | userm | character varying(64) | usert | character varying(64) | ip | character varying(32) | module | character varying(64) | resource_id | character varying(100) | user_agent | character varying(128) | Indexes: "pk_log_footmark" PRIMARY KEY, btree (id) --alter column wapreader_log= \timing Timing is on. wapreader_log= ALTER TABLE wapreader_log.log_foot_mark ALTER column user_agent TYPE character varying(256); ALTER TABLE Time: 603504.835 ms

  Read the article

• Has anyone noticed that a WPF file dialog will pass through a click to the UI when double clicking t

  - by Ben

  I have some buttons on my WPF UI and I also need to choose files from time to time. I kept noticing strange problems where when I double-click an item in the file dialog, a button on the main UI would also get clicked. After experimenting, it seems that if you line up an item in the file dialog with a button behind it on the main UI and double click to select the file, it will single-click the button behind it as well. Has anyone else noticed this, or is it just a freak bug with the way I have my UI laid out?

  Read the article

• Apache 2.2 / Win7 - slow or not responsive

  - by joey

  My configuration - Windows 7 x64, Php 5.3, Apache 2.2.15, latest Mysql. When loading pages from localhost, the response time shown by firebug is more 530ms for the main 'index.php' file, sometimes the connection is reset. It's painfully slow. I googled the problem and found a workaround - switch off and on again a win service called BFE - base filtering engine. Then everything works like a lightning but xdebug doesn't work in netbeans. Why is this response time so long? Can you think of any other solution than BFE toggling? joey33

  Read the article

• What is the Software Development Lifecycle?

  - by j-t-s

  Our investor wants a SDLC. I've never written one before, and I don't have enough time to go and buy a book, or spend much time learning about them. From what I've been told about them, they consist of requirements (what needs to be done), and a list is done. Is this correct? Update: I have found this article which really helps to explain things in simple terms and very quickly. Not that I think an SDLC should be done quickly. In my case, I have no other option.

  Read the article

• Scoping in embedded groovy scripts

  - by Aaron Digulla

  In my app, I use Groovy as a scripting language. To make things easier for my customers, I have a global scope where I define helper classes and constants. Currently, I need to run the script (which builds the global scope) every time a user script is executed: context = setupGroovy(); runScript( context, "global.groovy" ); // Can I avoid doing this step every time? runScript( context, "user.groovy" ); Is there a way to setup this global scope once and just tell the embedded script interpreter: "Look here if you can't find a variable"? That way, I could run the global script once. Note: Security is not an issue here but if you know a way to make sure the user can't modify the global scope, that's an additional plus.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• CALayer: callback when animation ends?

  - by carloe

  Hi All, I have been running into some issues with animating multiple CALayers at the same time, and was hoping someone could point me in the right direction. My app contains an array of CALayer. The position of each layer is set to (previousLayer.position.y + previousLayer.bounds.height), which basically lays them out similar to a table. I then have a method that, every-time it is called, adds a new layer to the stack and sets its Y position is set to 0. The Y positions of all other layers in the array are then offset by the height of the new layer (essentially pushing all old layers down). What I am having problems with is preventing the adding of new layers until the previous animation has completed. Is there a way to tell when an implicit animation has finished? Or alternatively, if I use CABasicAnimation and animationDidFinish, is there a way to tell which object finished animating when animationDidFinish is called?

  Read the article

• The case against Maven?

  - by Asgeir S. Nilsen

  Time and time again I've read and heard people frustrated over Maven and how complicated it is. And that it's much easier to use Ant to build code. However, in order to: Compile code Run tests Package a deployable unit This is all you need from Maven: <project> <modelVersion>4.0.0</modelVersion> <groupId>type something here</groupId> <artifactId>type something here</artifactId> <version>type something here</version> </project> What would be the corresponding minimal Ant build file?

  Read the article

• Sometimes, scaling down a bitmap generates a bigger file. Why?

  - by Matías

  Hello, I'm trying to write a method to reduce the size of any image 50% each time is called but I've found a problem. Sometimes, I end up with a bigger filesize while the image is really just half of what it was. I'm taking care of DPI and PixelFormat. What else am I missing? Thank you for your time. public Bitmap ResizeBitmap(Bitmap origBitmap, int nWidth, int nHeight) { Bitmap newBitmap = new Bitmap(nWidth, nHeight, origBitmap.PixelFormat); newBitmap.SetResolution(origBitmap.HorizontalResolution, origBitmap.VerticalResolution); using (Graphics g = Graphics.FromImage((Image)newBitmap)) { g.InterpolationMode = InterpolationMode.HighQualityBicubic; g.DrawImage(origBitmap, 0, 0, nWidth, nHeight); } return newBitmap; }

  Read the article

• Does this Maven plugin really have an invalid descriptor?

  - by ovr

  COMMAND: mvn org.apache.maven.plugins:maven-archetype-plugin:2.0-alpha-4:generate -DarchetypeGroupId=org.beardedgeeks -DarchetypeArtifactId =gae-eclipse-maven-archetype -DarchetypeVersion=1.1.2 -DarchetypeRepository=http://beardedgeeks.googlecode.com/svn/repository/release s OUTPUT: [INFO] Scanning for projects... [INFO] ------------------------------------------------------------------------ [ERROR] BUILD ERROR [INFO] ------------------------------------------------------------------------ [INFO] Internal error in the plugin manager getting plugin 'org.apache.maven.plugins:maven-archetype-plugin': Plugin 'org.apache.maven .plugins:maven-archetype-plugin:2.0-alpha-4' has an invalid descriptor: 1) Plugin's descriptor contains the wrong group ID: net.kindleit 2) Plugin's descriptor contains the wrong artifact ID: maven-gae-plugin 3) Plugin's descriptor contains the wrong version: 0.5.9 [INFO] ------------------------------------------------------------------------ [INFO] For more information, run Maven with the -e switch [INFO] ------------------------------------------------------------------------ [INFO] Total time: < 1 second [INFO] Finished at: Wed Jun 09 20:48:35 CEST 2010 [INFO] Final Memory: 3M/15M [INFO] ------------------------------------------------------------------------ I have a hard time believing this Maven plugin has an invalid descriptor since other people seem to be using it with no problem. Am I doing something wrong?

  Read the article

• Python json memory bloat

  - by Anoop

  import json import time from itertools import count def keygen(size): for i in count(1): s = str(i) yield '0' * (size - len(s)) + str(s) def jsontest(num): keys = keygen(20) kvjson = json.dumps(dict((keys.next(), '0' * 200) for i in range(num))) kvpairs = json.loads(kvjson) del kvpairs # Not required. Just to check if it makes any difference print 'load completed' jsontest(500000) while 1: time.sleep(1) Linux top indicates that the python process holds ~450Mb of RAM after completion of 'jsontest' function. If the call to 'json.loads' is omitted then this issue is not observed. A gc.collect after this function execution does releases the memory. Looks like the memory is not held in any caches or python's internal memory allocator as explicit call to gc.collect is releasing memory. Is this happening because the threshold for garbage collection (700, 10, 10) was never reached ? I did put some code after jsontest to simulate threshold. But it didn't help.

  Read the article

• SQL query root parent child records

  - by Vish

  Hi, We have nested folders with parent-child relationship. We use MySQL MyISAM DB. The data is stored in the DB in the following manner. Every time a child folder is created in the nested structure, the previous parentID is added. I want to get the RootFolderID of a folder which is added in the hierarchy as tabulated below. FoldID ParentID |RootFolderID -----------------|------------------- 1 0 | 0 2 1 | 1 3 2 | 1 4 3 | 1 5 4 | 1 Please let me know how to get the root folderID and populate it in the RootFolderID column after a folder is created each time. Thanks.

  Read the article

• How do I make a class whose interface matches double, but upon which templates can be specialized?

  - by Neil G

  How do I make a class whose interface matches double, but whose templated types do not dynamic cast to double? The reason is that I have a run-time type system, and I want to be able to have a type that works just like double: template<int min_value, int max_value> class BoundedDouble: public double {}; And then inherit use template specialization to get run-time information about that type: template<typename T> class Type { etc. } template<int min_value, int max_value> class Type<BoundedDouble<min_value, max_value>> { int min() const { return min_value; } etc. } But, you can't inherit from double...

  Read the article

• Automatically "upgrade" user settings from previous version of app.config file?

  - by SqlRyan

  Every time I compile my app and the version number changes (I have an auto-incrementing build number), I lose the user-configured app.config settings, since they're stored in the AppData folder for a specific version. Essentially, every release of my application starts from scratch as far as user settings go. While this is a mild annoyance in development, it raises the question as I approach deployment/release - if I use the app.config to store my user settings, will the user's personalized settings be hosed every time they install a patch that changes the version number of my app? If so, is there an easy way to "upgrade" the settings from the previous release? I know that using HKCU in the registry is another option, but I like the ease of the My.Settings namespace, and I'd like to stay with app.config. Another SO question asks something similar, though the answer doesn't seem that clear. Will setting my MSI so it asks the user to upgrade be enough to preserve these user-level settings?

  Read the article

• Best approach to send data from a server to an Android device

  - by ElectricDialect

  I am developing an Android app that needs to communicate bi-directionally with a server. By that, I mean either the server or the device can send a message at any time, with an arbitrary amount of time in between messages. Sending data from the device to the server is a common and I think well understood task, but I'm not as sure what the best approach is to go in the opposite direction from the server to the device. I think having the device periodically poll the server may be a bad idea due to latency and the drain on the battery, but I'd be willing to consider this option. My plan at the moment is to send text messages from the server via an email-to-SMS bridge, and to have my app run a service to receive and handle these messages. The question I have is if there are any best practices for this scenario, and if using text messages has some downsides that I have failed to consider. For the sake of this question, I want to assume that users have an unlimited text data plan, so paying per text won't be an issue.

  Read the article

• Linq to SQL Azure generating Error "Specified cast is not valid."

  - by Rabbi

  B"H I have an application that has been working for months using Linq to SQL connecting to a SQLExpress. I tried migrating it to SQL Azure. I copied the structure and data using the Sync Framework. I viewed the data in SQL Azure using SSMS 2008 R2 and it seams to be exactly what I have in my Sql Server. However when I try to use Linq to SQL against it I get an error "Specified cast is not valid." I seams to be happening any time I get child records. i.e. whenever I fill (the first time I access) an entity set. It seams to be happening after the data returns and when Linq tries to put it into the objects. Remember, the application is working perfectly against sqlexpress, even when accessed across the internet or vpn.

  Read the article

• how to order a group result with Linq?

  - by Aaron

  How can I order the results from "group ... by... into..." statement in linq? For instance: var queryResult = from records in container.tableWhatever where records.Time >= DateTime.Today group records by tableWhatever.tableHeader.UserId into userRecords select new { UserID = userRecords.Key, Records = userRecords }; The query returns records in table "contain.tableWhatever" grouped by "UserId". I want the returned results within each group ordered by time decending. How can I do that? More specific, assume the above query return only one group like the following: {UserID = 1, Records= {name1 5/3/2010_7:10pm; name2 5/3/2010_8:10pm; name3 5/3/2010_9:10pm} } After insert the orderby statement in the above query, the returned results should be like this: {UserID = 1, Records= {name3 5/3/2010_9:10pm; name2 5/3/2010_8:10pm; name1 5/3/2010_7:10pm} } Thanks for help!

  Read the article

• Is there a short key for desk top in windows batch?

  - by user198729

  C:\Documents and Settings\Administrator\Desktop I don't want to type the above each time to refer to a file on the desktop

  Read the article

• Why does java have an interpreter? and not a compiler?

  - by Galaxin

  Iam a newbie to java and was wondering why java have a interpreter and not a compiler? While shifting from c++ to java we come across the differences between these two Compilation process being one of them. 1.A major difference between a compiler and interpreter is that compiler compiles the whole code at once and displays all the errors at a time whereas an interpreter interprets line by line. 2.Also a compiler takes a less time to compile a code when compared to an interpreter. When java was developed for more advanced and easy features and implementations why has it been restricted to a interpreter based on above facts? Is there any special reason why this is so? If yes what is it?

  Read the article

• Approaches to timing out sessions on a web app using AJAX autorefreshes

  - by Braintapper

  I'm writing a web application that autorefreshes data with an AJAX call at set intervals. Because it's doing that, server side user sessions never time out, since the last activity is refreshed with every ajax call. Are there good client side rules I could implement to time out the user? I.e. should I track mouse movements in the browser, etc., or should I point the AJAX calls to URLs that don't refresh the session? I like that my AJAX calls hit a session-enabled URL, because I can also validate that the user is logged in, etc. Any thoughts in terms of whether I should even bother timing out the users?

  Read the article

• [JavaScript] Loading Google Maps API after the page is displayed

  - by Goro

  Hello, My landing page contains a big google maps portion, which slows down the loading time. I am trying to do the following: Load the static elements first so the page loads fast initially. Display a loading notification in the map placeholder so that the user knows that the map is coming up Load and display the map I have done this: $(document).ready(function() { map_initialize(); } map_initialize() being the function which loads the map into its container div. However, this still will not display the static elements fist. The page will wait until the map_initialize() is finished, then load the static elements at the same time as the map. Thanks,

  Read the article

• How can I suspend \ resume the video caputre operation in v4l2 ?

  - by Ita

  Hi, I use the v4l2 api for video capture and image applying image processing algo' on each frame. I wish to be able to suspend the video capture. I see that there are 2 options for ioctling (new verb, its gonna catch) the stream. VIDIOC_STREAMON, VIDIOC_STREAMOFF will start and stop the stream. Is there a way to suspend \ resume it? Is this even necessary, or can I just use the start and stop controls with no extra processing time spent on creating the stream all over again ? Thank you for your time, Itamar

  Read the article

< Previous Page | 562 563 564 565 566 567 568 569 570 571 572 573  | Next Page >