Search Results

Search found 59278 results on 2372 pages for 'time estimation'.

Page 566/2372 | < Previous Page | 562 563 564 565 566 567 568 569 570 571 572 573  | Next Page >

  • Which will be the best query OR there is an another one?

    - by serhan
    SELECT k.id,k.adsoyad, COUNT(DISTINCT(e.id)) as iletisimbilgisisay, COUNT(DISTINCT(f.id)) AS ilangonderensay, COUNT(DISTINCT(g.id)) AS emlaksahibisay, isNULL(MAX(eb.yonetici_kisi),0) AS yoneticiid FROM dbo.kisiler k LEFT OUTER JOIN dbo.emlaklar e ON e.iletisimbilgisi=k.id LEFT OUTER JOIN dbo.emlaklar f ON f.ilangonderen=k.id LEFT OUTER JOIN dbo.emlaklar g ON g.emlaksahibi=k.id LEFT OUTER JOIN dbo.emlakcibilgileri eb ON eb.yonetici_kisi=k.id GROUP BY k.id,k.adsoyad ORDER BY yoneticiid DESC, iletisimbilgisisay DESC, ilangonderensay DESC total execution time (above) 28 SELECT id,adsoyad, (select COUNT(id) FROM dbo.emlaklar WHERE iletisimbilgisi=k.id) AS iletisimbilgisisay, (select COUNT(id) FROM dbo.emlaklar WHERE emlaksahibi=k.id) AS emlaksahibisay, (select COUNT(id) FROM dbo.emlaklar WHERE ilangonderen=k.id) AS ilangonderensay, (Select isNULL(MAX(id),0) FROM dbo.emlakcibilgileri WHERE yonetici_kisi=k.id) AS yoneticiid FROM dbo.kisiler k total execution time 4 my tables are emlaklar: id int, ilangonderen int,iletisimbilgisi int,emlaksahibi int kisiler: id int,kisiadi emlakcibilgileri: id int,yonetici_kisi int,firma and ilangonderen,iletisimbilgisi,emlaksahibi,yonetici_kisi => kisiler.id

    Read the article

  • Do invisible controls and their children on an ASP.NET page contribute to viewstate?

    - by Mr. Jefferson
    I have an ASP.NET page that has about 40 custom controls embedded in it. The controls vary in size; in their .ascx files, the biggest is about 1,500 lines and the smaller ones are between 100 and 200 lines (markup, script, etc). Each control is contained in a Panel. Only one of these panels is ever visible at any one time, which means only one control is ever visible at one time. My question is this: do the controls that are invisible still send ViewState for themselves and all their children to the client? It makes sense that they might have to serialize the fact that they're invisible, but not all the state info for their children...

    Read the article

  • JQuery cookie access has stopped working for GAE app

    - by Greg
    I have a google app engine app that has been running for some time, and some javascript code that checks for a login cookie has suddenly stopped working. As far as I can tell, NO code has changed. The relevant code uses the jquery cookies plugin (jquery.cookies.2.2.0.min.js)... // control the default screen depending // if someone is logged in if( $.cookies.get('dev_appserver_login') != null || $.cookies.get('ACSID') != null ) { alert("valid cookie!") $("#inventory-container").show(); } else { alert("INvalid cookie!") $("#welcome-container").show(); } The reason for the two checks is that in the GAE SDK, the cookies are named differently. The production system uses 'ACSID'. This if statement works in the SDK and now fails 100% of the time in production. I have verified that the cookie is, in fact, present when I inspect the page. Thoughts?

    Read the article

  • What is the Software Development Lifecycle?

    - by j-t-s
    Our investor wants a SDLC. I've never written one before, and I don't have enough time to go and buy a book, or spend much time learning about them. From what I've been told about them, they consist of requirements (what needs to be done), and a list is done. Is this correct? Update: I have found this article which really helps to explain things in simple terms and very quickly. Not that I think an SDLC should be done quickly. In my case, I have no other option.

    Read the article

  • Learning to think in the Object Oriented Way

    - by SpikETidE
    Hi Everyone.... I am a programmer trying to learn to code in the object oriented paradigm... I mainly work with PHP and i thought of learning the zend framework... So, felt I need to learn to code in OO PHP.... The problem is, having done code using functions for quite a long time, i just can't get my head to think in the OO way.... Also felt that probably I am not the only one facing this problem since the beginning of time... So, how did you people learn object oriented programming... especially how did you succeed in "unlearning" to code using functions... and learn to see you code as objects...? Is there any good resource books or sites where one could find help...?? Thanks for sharing your knowledge and experiences...

    Read the article

  • How to Create VBA Add-In with Shared Codes for All Excels?

    - by StanFish
    I'm writing VBA codes for multiple Excel spreadsheets, which will be shared with others from time to time. At some point I find there are lots of duplications in my works. So I want to find a way to share codes in a sort of Excel add-in, like the .xla file. But when I tried to save the Excel file containing shared codes as .xla file, I got some problems: The file cannot be edit anymore after I save it in the default add-in folder If I move the .xls file to a folder other than the add-in folder, and open it directly - I cannot use its classes - which creates problems for sharing the codes Any ideas to create add-ins in a flexible and powerful way please? Thanks a lot for the help

    Read the article

  • ASP.Net: Is it possible to cache the js-proxies generated by scriptmanager?

    - by AndreasKnudsen
    We have the following code: <asp:ScriptManager runat="server"> ... <Services> <asp:ServiceReference Path="~/JSONServices/ProfileService.svc" /> </Services> ... This results in a Javascript proxy found in /JSONServices/ProfileService.svc/js. This Javascript has content expiry set to the same time it was called (so it is never cached on the client). Is it possible to have the clients cache these proxies for some time?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Linq to SQL Azure generating Error "Specified cast is not valid."

    - by Rabbi
    B"H I have an application that has been working for months using Linq to SQL connecting to a SQLExpress. I tried migrating it to SQL Azure. I copied the structure and data using the Sync Framework. I viewed the data in SQL Azure using SSMS 2008 R2 and it seams to be exactly what I have in my Sql Server. However when I try to use Linq to SQL against it I get an error "Specified cast is not valid." I seams to be happening any time I get child records. i.e. whenever I fill (the first time I access) an entity set. It seams to be happening after the data returns and when Linq tries to put it into the objects. Remember, the application is working perfectly against sqlexpress, even when accessed across the internet or vpn.

    Read the article

  • expand a varchar column very slowly , why?

    - by francs
    Hi We need to modify a column of a big product table , usually normall ddl statments will be excutely fast ,but the above ddl statmens takes about 10 minnutes?I wonder know the reason! I just want to expand a varchar column?The following is the detailsl --table size wapreader_log= select pg_size_pretty(pg_relation_size('log_foot_mark')); pg_size_pretty ---------------- 5441 MB (1 row) --table ddl wapreader_log= \d log_foot_mark Table "wapreader_log.log_foot_mark" Column | Type | Modifiers -------------+-----------------------------+----------- id | integer | not null create_time | timestamp without time zone | sky_id | integer | url | character varying(1000) | refer_url | character varying(1000) | source | character varying(64) | users | character varying(64) | userm | character varying(64) | usert | character varying(64) | ip | character varying(32) | module | character varying(64) | resource_id | character varying(100) | user_agent | character varying(128) | Indexes: "pk_log_footmark" PRIMARY KEY, btree (id) --alter column wapreader_log= \timing Timing is on. wapreader_log= ALTER TABLE wapreader_log.log_foot_mark ALTER column user_agent TYPE character varying(256); ALTER TABLE Time: 603504.835 ms

    Read the article

  • How do I make a class whose interface matches double, but upon which templates can be specialized?

    - by Neil G
    How do I make a class whose interface matches double, but whose templated types do not dynamic cast to double? The reason is that I have a run-time type system, and I want to be able to have a type that works just like double: template<int min_value, int max_value> class BoundedDouble: public double {}; And then inherit use template specialization to get run-time information about that type: template<typename T> class Type { etc. } template<int min_value, int max_value> class Type<BoundedDouble<min_value, max_value>> { int min() const { return min_value; } etc. } But, you can't inherit from double...

    Read the article

  • Scoping in embedded groovy scripts

    - by Aaron Digulla
    In my app, I use Groovy as a scripting language. To make things easier for my customers, I have a global scope where I define helper classes and constants. Currently, I need to run the script (which builds the global scope) every time a user script is executed: context = setupGroovy(); runScript( context, "global.groovy" ); // Can I avoid doing this step every time? runScript( context, "user.groovy" ); Is there a way to setup this global scope once and just tell the embedded script interpreter: "Look here if you can't find a variable"? That way, I could run the global script once. Note: Security is not an issue here but if you know a way to make sure the user can't modify the global scope, that's an additional plus.

    Read the article

  • iphone: repeating a transformation

    - by gonso
    Hi I'm trying to represent a view that rotates on the iphone screen. I have a button and when you press it, the view rotates 180 degrees. My problem is that this only works the first time. Here is the code: -(IBAction) flip:(id)sender{ CGAffineTransform transform; //the transform matrix to be used below //BEGIN ANIMATIONS [UIView beginAnimations:nil context:NULL]; [UIView setAnimationDuration:2.0]; //animate if (flag){ transform = CGAffineTransformMakeRotation( RADIANS(180) ); } else { transform = CGAffineTransformMakeRotation( RADIANS(-180) ); } flag = !flag; transform = CGAffineTransformTranslate(transform, 0, 0); self.mySuview.transform = transform; //COMMIT ANIMATIONS [UIView commitAnimations]; } The first time you click, the view spins alright, but when you click again NOTHING happens. No errors, no changes on the view. What am I missing? Thanks Gonso

    Read the article

  • How to solve High Load average issue in Linux systems?

    - by RoCkStUnNeRs
    The following is the different load with cpu time in different time limit . The below output has parsed from the top command. TIME LOAD US SY NICE ID WA HI SI ST 12:02:27 208.28 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 12:23:22 195.48 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 12:34:55 199.15 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 13:41:50 203.66 4.2%us 1.0%sy 0.2%ni 93.8%id 0.8%wa 0.0%hi 0.0%si 0.0%st 13:42:58 278.63 4.2%us 1.0%sy 0.2%ni 93.8%id 0.8%wa 0.0%hi 0.0%si 0.0%st Following is the additional Information of the system? cat /proc/cpuinfo processor : 0 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 0 cpu cores : 4 apicid : 0 initial apicid : 0 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4658.69 clflush size : 64 power management: processor : 1 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 1 cpu cores : 4 apicid : 1 initial apicid : 1 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4655.00 clflush size : 64 power management: processor : 2 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 2 cpu cores : 4 apicid : 2 initial apicid : 2 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4655.00 clflush size : 64 power management: processor : 3 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 3 cpu cores : 4 apicid : 3 initial apicid : 3 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4654.99 clflush size : 64 power management: Memory: total used free shared buffers cached Mem: 2 1 1 0 0 0 Swap: 5 0 5 let me know why the system is getting abnormally this much high load?

    Read the article

  • Getting Started with Fluent NHibernate

    - by Andy
    I'm trying to get into using Fluent NHibernate, and I have a couple questions. I'm finding the documentation to be lacking. I understand that Fluent NHibernate / NHibernate allows you to auto-generate a database schema. Do people usually only do this for Test/Dev databases? Or is that OK to do for a production database? If it's ok for production, how do you make sure that you're not blowing away production data every time you run your app? Once the database schema is already created, and you have production data, when new tables/columns/etc. need to be added to the Test and/or Production database, do people allow NHibernate to do this, or should this be done manually? Is there any REALLY GOOD documentation on Fluent NHibernate? (Please don't point me to the wiki because in following along with the "Your first project" code building it myself, I was getting run-time errors because they forget to tell you to add a reference. Not cool.) Thanks, Andy

    Read the article

  • How can I suspend \ resume the video caputre operation in v4l2 ?

    - by Ita
    Hi, I use the v4l2 api for video capture and image applying image processing algo' on each frame. I wish to be able to suspend the video capture. I see that there are 2 options for ioctling (new verb, its gonna catch) the stream. VIDIOC_STREAMON, VIDIOC_STREAMOFF will start and stop the stream. Is there a way to suspend \ resume it? Is this even necessary, or can I just use the start and stop controls with no extra processing time spent on creating the stream all over again ? Thank you for your time, Itamar

    Read the article

  • Where is the best place to run initialization code for a UITabBarController?

    - by bobobobo
    I have a UITabBarController in my application. I have to perform some customization to the NIB file using code the first time a view embedded in that UITabBarController gets loaded. When applicationDidFinishLaunching occurs, the UITabBarController's views apparently are not loaded -- if I try to modify the view controllers inside a tab bar that the tab bar is to load in applicationDidFinishLaunching, then those changes are ignored. I'm assuming this is because the tab bar didn't finish loading yet. So, I need a good place to put code that will run immediately after a tabbar is fully ready -- i.e. after it has loaded all the views from their respective nib files. I'm finding the only place I can do this is to track the first time viewDidAppear on each individual view controller. Note I can't use viewWillAppear because I need the value of tabBarController.selectedIndex to be accurate, and it is only actually updated after viewDidAppear gets fired, not when viewWillAppear gets fired.

    Read the article

  • Python json memory bloat

    - by Anoop
    import json import time from itertools import count def keygen(size): for i in count(1): s = str(i) yield '0' * (size - len(s)) + str(s) def jsontest(num): keys = keygen(20) kvjson = json.dumps(dict((keys.next(), '0' * 200) for i in range(num))) kvpairs = json.loads(kvjson) del kvpairs # Not required. Just to check if it makes any difference print 'load completed' jsontest(500000) while 1: time.sleep(1) Linux top indicates that the python process holds ~450Mb of RAM after completion of 'jsontest' function. If the call to 'json.loads' is omitted then this issue is not observed. A gc.collect after this function execution does releases the memory. Looks like the memory is not held in any caches or python's internal memory allocator as explicit call to gc.collect is releasing memory. Is this happening because the threshold for garbage collection (700, 10, 10) was never reached ? I did put some code after jsontest to simulate threshold. But it didn't help.

    Read the article

  • Is it possible to have Ant print out the classpath for a particular target? If so, how?

    - by Daryl Spitzer
    I'm trying to get a target to build that has quite a long list of <pathelement location="${xxx}"/> and <path refid="foo.class.path"/> elements in its <path id="bar.class.path"> element (in the build.xml file). I keep getting "package com.somecompany.somepackage does not exist" errors, and I'm having a hard time chasing down these packages and making sure I've synced them from our repository. I'm new to this team so I'm unfamiliar with the build, but I would prefer to figure this out myself if possible (so I don't bother the other very busy team members). I have very limited experience with Ant. I think it would save me quite a bit of time if I could have Ant print out the classpath for the target I'm trying to build.

    Read the article

  • Build Interactive Floor With Projection !?

    - by Synxmax
    Dear Guys I am somehow newbie and sometimes guru , but at this moment i don't have enough time to research My nightmare is , my boss ask me to create an interactive floor ( he just saw in an exhibition ) , he ask me to create one of them instead of buying , i am an actionscript crawler and developer with some skills in java and c# programming , i just made some track motion with a simple web cam , and this idea came to my mind if i can use an infrared or thermographic camera instead of simple camera so i can get better positioning if camera place at top of floor ! Now i just came here to ask you guys is there any resource , tip , help i can know before getting into this deal !? is there any lib or api out to deal with this ?! EVEN, if there is any resource , article from another language c++ , c , .... could help i just didn't have enough time to test lot of ways If you search interactive floors , or interactive floor projection you can find some companies who provide such a thing Thanks in advance ( and sorry for my damn poor english , français could be better :D )

    Read the article

  • Understanding the passing of data/life of a script in web development/CodeIgniter

    - by Pete Jodo
    I hope I worded the title accurately enough but I typically use Java and don't have much experience in Web Development/PHP/CodeIgniter. I have a difficult time understanding the life cycle of a script as I found out trying to implement a certain feature to a website I am developing (as a means of learning how to). I'll first describe the feature I tried implementing and then the problem I ran into that made me question my fundamental understanding of how scripts work since I'm used to typical OOP. Ok so here goes... I have a webpage that has 2 basic tasks a user can do, create and delete an entry. What I attempted to implement was a way to time a user how long it takes them to complete a certain task. The way I did this was have a homepage where there would be a list of tasks a user to choose from (in this case 2, create and delete). A user would click a task which would link to the 'true' homepage where the user then would be expected to complete the task. My script looks like this: <?php class Site extends CI_Controller { var $task1; var $tasks = array( "task1" => NULL, "date1" => 0, "date2" => 0, "diff" => 0); function __construct() { parent::__construct(); include 'timetask.php'; $this->task1 = new TimeTask("create"); } function index() { $this->tasks['task1'] = $this->task1->getTask(); $this->tasks['diff'] = $this->task1->getTimeDiff(); if($this->tasks['diff'] == NULL) { $this->tasks['diff'] = 0; } $this->load->view('usability_test', $this->tasks); } function origIndex() { $this->task1->setDate1(new DateTime()); $this->tasks['date1'] = $this->task1->getDate1()->getTimestamp(); $data = array(); if($q = $this->site_model->get_records()) { $data['records'] = $q; } $this->load->view('options_view', $data); } function create() { $this->task1->setDate2(new DateTime()); $this->tasks['date2'] = $this->task1->getDate2()->getTimestamp(); $data = array( 'author' => $this->input->post('author'), 'title' => $this->input->post('title'), 'contents' => $this->input->post('contents') ); $this->site_model->add_record($data); $this->index(); } I only included create to keep it short. Then I also have the TimeTask class, that actually another StackOverflow so kindly helped me with: <?php class TimeTask { private $task; /** * @var DateTime */ private $date1, $date2; function __construct($currTask) { $this->task = $currTask; } public function getTimeDiff() { $hasDiff = $this->date1 && $this->date2; if ($hasDiff) { return $this->date2->getTimestamp() - $this->date1->getTimestamp(); } else { return NULL; } } public function __toString() { return (string) $this->getTimeDiff(); } /** * @return \DateTime */ public function getDate1() { return $this->date1; } /** * @param \DateTime $date1 */ public function setDate1(DateTime $date1) { $this->date1 = $date1; } /** * @return \DateTime */ public function getDate2() { return $this->date2; } /** * @param \DateTime $date2 */ public function setDate2(DateTime $date2) { $this->date2 = $date2; } /** * @return get current task */ public function getTask() { return $this->task; } } ?> I don't think posting the views is necessary for the question but here is atleast how the links are made. ...and... id", $row-title); ? Now there's no error in the code but it doesn't do what I expect of it and the reason I assume why is because that each time a function of the script is called via a new page it is NOT the same instance of the script called previously so any previously created objects are no longer there. This confuses me and leaves me quite unsure of how to implement this gracefully. Some ways I would guess of how to do this is by passing the necessary data through the URL or have data saved in a database and retrieve it later to compare the times. What would be a recommended way to do, not just this, but anything that needs previously created data? Also, am I correct to think that a script is only 'alive' for one webpage at a time? Thanks!

    Read the article

  • Is there a standard format string in ASP.NET to convert 1/2/3/... to 1st/2nd/3rd...?

    - by Dr. Monkey
    I have an integer in an Access database, which is being displayed in ASP.NET. The integer represents the position achieved by a competitor in a sporting event (1st, 2nd, 3rd, etc.), and I'd like to display it with a standard suffix like 'st', 'nd', 'rd' as appropriate, rather than just a naked number. An important limitation is that this is for an assignment which specifies that no VB or C# code be written (in fact it instructs code behind files to be deleted entirely). Ideally I'd like to use a standard format string if available, otherwise perhaps a custom string (I haven't worked with format strings much, and this isn't high enough priority to dedicate significant time to*, but I am very curious about whether there's a standard string for this). (* The assignment is due tonight, and I've learned the hard way that I can't afford to spend time on things that don't get the marks, even if they irk me significantly.)

    Read the article

  • Can I Import an updated structure into a MySQL table without losing its current content?

    - by Udi Wertheimer
    We use MySQL tables to which we add new fields from time to time as our product evolves. I'm looking for a way to export the structure of the table from one copy of the db, to another, without erasing the contents of the table I'm importing to. For example say I have copies A and B of a table, and I add fields X,Y,Z to table A. Is there a way to copy the changed structure (fields X,Y,Z) to table B while keeping its content intact? I tried to use mysqldump, but it seems I can only copy the whole table with its content, overriding the old one, or I can use the "-d" flag to avoid copying data (dumping structure only), but this will create an empty table when imported, again overriding old data. Is there any way to do what I need with mysqldump, or some other tool?

    Read the article

< Previous Page | 562 563 564 565 566 567 568 569 570 571 572 573  | Next Page >