Search Results

Search found 27655 results on 1107 pages for 'visual python'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 566/1107 | < Previous Page | 562 563 564 565 566 567 568 569 570 571 572 573  | Next Page >

  • How to replace empty string with zero in comma-separated string?

    - by dsaccount1
    "8,5,,1,4,7,,,,7,,1,9,3,6,,,8,6,3,9,,2,5,4,,,,,3,2,,,7,4,1,1,,4,,6,9,,5,,,,5,,,1,,6,3,,,6,5,,,,7,4,,1,7,6,,,,8,,5,,,7,1,,3,9," I'm doing a programming challenge where i need to parse this sequence into my sudoku script. Need to get the above sequence into 8,5,0,1,4,7,0,0,0,7,0,1,9,3,6,0,0,8......... I tried re but without success, help is appreciated, thanks.

    Read the article

  • split twice in the same expression?

    - by UcanDoIt
    Imagine I have the following: inFile = "/adda/adas/sdas/hello.txt" # that instruction give me hello.txt Name = inFile.name.split("/") [-1] # that one give me the name I want - just hello Name1 = Name.split(".") [0] Is there any chance to simplify that doing the same job in just one expression?

    Read the article

  • Obtaining references to function objects on the execution stack from the frame object?

    - by Marcin
    Given the output of inspect.stack(), is it possible to get the function objects from anywhere from the stack frame and call these? If so, how? (I already know how to get the names of the functions.) Here is what I'm getting at: Let's say I'm a function and I'm trying to determine if my caller is a generator or a regular function? I need to call inspect.isgeneratorfunction() on the function object. And how do you figure out who called you? inspect.stack(), right? So if I can somehow put those together, I'll have the answer to my question. Perhaps there is an easier way to do this?

    Read the article

  • How to create instances of a class from a static method?

    - by Pierre
    Hello. Here is my problem. I have created a pretty heavy readonly class making many database calls with a static "factory" method. The goal of this method is to avoid killing the database by looking in a pool of already-created objects if an identical instance of the same object (same type, same init parameters) already exists. If something was found, the method will just return it. No problem. But if not, how may I create an instance of the object, in a way that works with inheritance? >>> class A(Object): >>> @classmethod >>> def get_cached_obj(self, some_identifier): >>> # Should do something like `return A(idenfier)`, but in a way that works >>> class B(A): >>> pass >>> A.get_cached_obj('foo') # Should do the same as A('foo') >>> A().get_cached_obj('foo') # Should do the same as A('foo') >>> B.get_cached_obj('bar') # Should do the same as B('bar') >>> B().get_cached_obj('bar') # Should do the same as B('bar') Thanks.

    Read the article

  • How to make scipy.interpolate give a an extrapolated result beyond the input range?

    - by Salim Fadhley
    I'm trying to port a program which uses a hand-rolled interpolator (developed by a mathematitian colleage) over to use the interpolators provided by scipy. I'd like to use or wrap the scipy interpolator so that it has as close as possible behavior to the old interpolator. A key difference between the two functions is that in our original interpolator - if the input value is above or below the input range, our original interpolator will extrapolate the result. If you try this with the scipy interpolator it raises a ValueError. Consider this program as an example: import numpy as np from scipy import interpolate x = np.arange(0,10) y = np.exp(-x/3.0) f = interpolate.interp1d(x, y) print f(9) print f(11) # Causes ValueError, because it's greater than max(x) Is there a sensible way to make it so that instead of crashing, the final line will simply do a linear extrapolate, continuing the gradients defined by the first and last two pouints to infinity. Note, that in the real software I'm not actually using the exp function - that's here for illustration only!

    Read the article

  • How can I draw a log-normalized imshow plot with a colorbar representing the raw data in matplotlib

    - by Adam Fraser
    I'm using matplotlib to plot log-normalized images but I would like the original raw image data to be represented in the colorbar rather than the [0-1] interval. I get the feeling there's a more matplotlib'y way of doing this by using some sort of normalization object and not transforming the data beforehand... in any case, there could be negative values in the raw image. import matplotlib.pyplot as plt import numpy as np def log_transform(im): '''returns log(image) scaled to the interval [0,1]''' try: (min, max) = (im[im > 0].min(), im.max()) if (max > min) and (max > 0): return (np.log(im.clip(min, max)) - np.log(min)) / (np.log(max) - np.log(min)) except: pass return im a = np.ones((100,100)) for i in range(100): a[i] = i f = plt.figure() ax = f.add_subplot(111) res = ax.imshow(log_transform(a)) # the colorbar drawn shows [0-1], but I want to see [0-99] cb = f.colorbar(res) I've tried using cb.set_array, but that didn't appear to do anything, and cb.set_clim, but that rescales the colors completely. Thanks in advance for any help :)

    Read the article

  • redefine __and__ operator

    - by wiso
    Why I can't redefine the __and__ operator? class Cut(object): def __init__(self, cut): self.cut = cut def __and__(self, other): return Cut("(" + self.cut + ") && (" + other.cut + ")") a = Cut("a>0") b = cut("b>0") c = a and b print c.cut() I want (a>0) && (b>0), but I got b, that the usual behaviour of and

    Read the article

  • How do I fix "error 1004, 0, Unable to find property" in an Entity Framework 4 WinForms application?

    - by Ivan
    I've designed an EF4 model (quite complex inheritance, lots of small tables incl. multiple self-referencing), generated (table-per-type) a database and inserted some basic data manually. It works fine in an ASP.Net Dynamic Data Entities web application with full automatic scaffolding. But when in a WinForms application using the same model (I share it as a part of a class library) I construct a query and bind a combo box to it (the way it's shown here), I get an InnerException {"Internal .NET Framework Data Provider error 1004, 0, Unable to find property... I've found a question about the same problem here (incl. a sample to reproduce the error) but no answer. I use final Visual Studio 2010, no beta.

    Read the article

  • Am I mocking this helper function right in my Django test?

    - by CppLearner
    lib.py from django.core.urlresolvers import reverse def render_reverse(f, kwargs): """ kwargs is a dictionary, usually of the form {'args': [cbid]} """ return reverse(f, **kwargs) tests.py from lib import render_reverse, print_ls class LibTest(unittest.TestCase): def test_render_reverse_is_correct(self): #with patch('webclient.apps.codebundles.lib.reverse') as mock_reverse: with patch('django.core.urlresolvers.reverse') as mock_reverse: from lib import render_reverse mock_f = MagicMock(name='f', return_value='dummy_views') mock_kwargs = MagicMock(name='kwargs',return_value={'args':['123']}) mock_reverse.return_value = '/natrium/cb/details/123' response = render_reverse(mock_f(), mock_kwargs()) self.assertTrue('/natrium/cb/details/' in response) But instead, I get File "/var/lib/graphyte-webclient/graphyte-webenv/lib/python2.6/site-packages/django/core/urlresolvers.py", line 296, in reverse "arguments '%s' not found." % (lookup_view_s, args, kwargs)) NoReverseMatch: Reverse for 'dummy_readfile' with arguments '('123',)' and keyword arguments '{}' not found. Why is it calling reverse instead of my mock_reverse (it is looking up my urls.py!!) The author of Mock library Michael Foord did a video cast here (around 9:17), and in the example he passed the mock object request to the view function index. Furthermore, he patched POll and assigned an expected return value. Isn't that what I am doing here? I patched reverse? Thanks.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • How to classify NN/NNP/NNS obtained from POS tagged document as a product feature

    - by Shweta .......
    I'm planning to perform sentiment analysis on reviews of product features (collected from Amazon dataset). I have extracted review text from the dataset and performed POS tagging on that. I'm able to extract NN/NNP as well. But my doubt is how do I come to know that extracted words classify as features of the products? I know there are classifiers in nltk but I don't know how I should use it for my project. I'm assuming there are 2 ways of finding whether the extracted word is a product feature or not. One is to compare with a bag of words and find out if my word exists in that. Doubt: How do I create/get bag of words? Second way is to implement some kind of apriori algorithm to find out frequently occurring words as features. I would like to know which method is good and how to go about implementing it. Some pointers to available softwares or code snippets would be helpful! Thanks!

    Read the article

  • How to set the size of a wx.aui.AuiManager Pane that is centered?

    - by aF
    Hello, I have three panes with the InfoPane center option. I want to know how to set their size. Using this code: import wx import wx.aui class MyFrame(wx.Frame): def __init__(self, parent, id=-1, title='wx.aui Test', pos=wx.DefaultPosition, size=(800, 600), style=wx.DEFAULT_FRAME_STYLE): wx.Frame.__init__(self, parent, id, title, pos, size, style) self._mgr = wx.aui.AuiManager(self) # create several text controls text1 = wx.TextCtrl(self, -1, 'Pane 1 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text2 = wx.TextCtrl(self, -1, 'Pane 2 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text3 = wx.TextCtrl(self, -1, 'Main content window', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) # add the panes to the manager self._mgr.AddPane(text1, wx.CENTER) self._mgr.AddPane(text2, wx.CENTER) self._mgr.AddPane(text3, wx.CENTER) # tell the manager to 'commit' all the changes just made self._mgr.Update() self.Bind(wx.EVT_CLOSE, self.OnClose) def OnClose(self, event): # deinitialize the frame manager self._mgr.UnInit() # delete the frame self.Destroy() app = wx.App() frame = MyFrame(None) frame.Show() app.MainLoop() I want to know what is called when we change the size of the panes. If you tell me that, I can do the rest by myself :)

    Read the article

  • setup related qus..

    - by Ashwin
    i have one qus related to add-in installation.......... qus is: i want to combine shared addin for msword created in visual studio 2005, to my project that means if i install my product then addin is also install with this........ and if i uninstall my product add-in is also uninstall........... and i also have another qus other than addin i want to give language choosen option at installation time that means if user want to select hindi then our product install in hindi language and if select english than install in english... how this facility give in setup creation plzzz discribe in detail

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • unit test for proxy checking

    - by zubin71
    Proxy configuration of a machine can be easily fetched using def check_proxy(): import urllib2 http_proxy = urllib2.getproxies().get('http') I need to write a test for the above written function. In order to do that I need to:- Set the system-wide proxy to an invalid URL during the test(sounds like a bad idea). Supply an invalid URL to http_proxy. How can I achieve either of the above?

    Read the article

  • Most efficient way to update attribute of one instance

    - by Begbie00
    Hi all - I'm creating an arbitrary number of instances (using for loops and ranges). At some event in the future, I need to change an attribute for only one of the instances. What's the best way to do this? Right now, I'm doing the following: 1) Manage the instances in a list. 2) Iterate through the list to find a key value. 3) Once I find the right object within the list (i.e. key value = value I'm looking for), change whatever attribute I need to change. for Instance within ListofInstances: if Instance.KeyValue == SearchValue: Instance.AttributeToChange = 10 This feels really inefficient: I'm basically iterating over the entire list of instances, even through I only need to change an attribute in one of them. Should I be storing the Instance references in a structure more suitable for random access (e.g. dictionary with KeyValue as the dictionary key?) Is a dictionary any more efficient in this case? Should I be using something else? Thanks, Mike

    Read the article

  • Qt/PyQt dialog with toggable fullscreen mode - problem on Windows

    - by Guard
    I have a dialog created in PyQt. It's purpose and functionality don't matter. The init is: class MyDialog(QWidget, ui_module.Ui_Dialog): def __init__(self, parent=None): super(MyDialog, self).__init__(parent) self.setupUi(self) self.installEventFilter(self) self.setWindowFlags(Qt.Dialog | Qt.WindowTitleHint) self.showMaximized() Then I have event filtering method: def eventFilter(self, obj, event): if event.type() == QEvent.KeyPress: key = event.key() if key == Qt.Key_F11: if self.isFullScreen(): self.setWindowFlags(self._flags) if self._state == 'm': self.showMaximized() else: self.showNormal() self.setGeometry(self._geometry) else: self._state = 'm' if self.isMaximized() else 'n' self._flags = self.windowFlags() self._geometry = self.geometry() self.setWindowFlags(Qt.Tool | Qt.FramelessWindowHint) self.showFullScreen() return True elif key == Qt.Key_Escape: self.close() return QWidget.eventFilter(self, obj, event) As can be seen, Esc is used for dialog hiding, and F11 is used for toggling full-screen. In addition, if the user changed the dialog mode from the initial maximized to normal and possibly moved the dialog, it's state and position are restored after exiting the full-screen. Finally, the dialog is created on the MainWindow action triggered: d = MyDialog(self) d.show() It works fine on Linux (Ubuntu Lucid), but quite strange on Windows 7: if I go to the full-screen from the maximized mode, I can't exit full-screen (on F11 dialog disappears and appears in full-screen mode again. If I change the dialog's mode to Normal (by double-clicking its title), then go to full-screen and then return back, the dialog is shown in the normal mode, in the correct position, but without the title line. Most probably the reason for both cases is the same - the setWindowFlags doesn't work. But why? Is it also possible that it is the bug in the recent PyQt version? On Ubuntu I have 4.6.x from apt, and on Windows - the latest installer from the riverbank site.

    Read the article

  • ClickOnce disallow publishing of Debug builds

    - by LnDCobra
    Is there anyway to disallow publishing Debug builds when publishing ClickOnce aplications using Visual Studio 2008? I know this was asked before, but i can't figure out how from the answer. THe Accepted answer for previous question was: One thing you can do is add a condition to the .csproj or .vbproj file that MSBuild will check when doing a build. The condition would check if a publish is occurring and check if the build is a debug build, then do something like run an external tool or otherwise interrupt the build process or cause it to fail. Could anyone elaborate on that answer or tell me where/or how I can add this condition. [Original Question][1] [1]: http://One thing you can do is add a condition to the .csproj or .vbproj file that MSBuild will check when doing a build. The condition would check if a publish is occurring and check if the build is a debug build, then do something like run an external tool or otherwise interrupt the build process or cause it to fail.

    Read the article

  • etree.findall: 'OR'-lookup?

    - by piquadrat
    I want to find all stylesheet definitions in a XHTML file with lxml.etree.findall. This could be as simple as elems = tree.findall('link[@rel="stylesheet"]') + tree.findall('style') But the problem with CSS style definitions is that the order matters, e.g. <link rel="stylesheet" type="text/css" href="/media/css/first.css" /> <style>body:{font-size: 10px;}</style> <link rel="stylesheet" type="text/css" href="/media/css/second.css" /> if the contents of the style tag is applied after the rules in the two link tags, the result may be completely different from the one where the rules are applied in order of definition. So, how would I do a lookup that inlcudes both link[@rel="stylesheet"] and style?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 562 563 564 565 566 567 568 569 570 571 572 573  | Next Page >