Search Results

Search found 27655 results on 1107 pages for 'visual python'.

Page 568/1107 | < Previous Page | 564 565 566 567 568 569 570 571 572 573 574 575  | Next Page >

  • Web2py controllers with parameters?

    - by nickfranceschina
    I am building an app using Web2py framework... I don't want to have to use the request object to get all of the querystring parameters, instead I'd like to build my controller with named parameters and have the router unpack the querystring (or form data) dictionary into the named parameters and call my controller. so instead of a controller method of create_user(): where I would use the global request() object and look through the vars list... I would prefer instead to have create_user(first_name, last_name, email): like I see in other MVC platforms. is this possible in Web2py already? or is there a plugin for it? or do I need to add that myself?

    Read the article

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • setup related qus..

    - by Ashwin
    i have one qus related to add-in installation.......... qus is: i want to combine shared addin for msword created in visual studio 2005, to my project that means if i install my product then addin is also install with this........ and if i uninstall my product add-in is also uninstall........... and i also have another qus other than addin i want to give language choosen option at installation time that means if user want to select hindi then our product install in hindi language and if select english than install in english... how this facility give in setup creation plzzz discribe in detail

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • how to make my method running on the template of google-app-engine..

    - by zjm1126
    the model is : class someModel(db.Model): name = db.StringProperty() def name_is_sss(self): return self.name=='sss' the view is : a=someModel() a.name='sss' path = os.path.join(os.path.dirname(__file__), os.path.join('templates', 'blog/a.html')) self.response.out.write(template.render(path, {'a':a})) and the html is : {{ a.name_is_sss }} the page shows : True so i want to make it more useful, and like this: the model: class someModel(db.Model): name = db.StringProperty() def name_is_x(self,x): return self.name==x the html is : {% a.name_is_x 'www'%} or {{ a.name_is_x 'www'}} but the error is : TemplateSyntaxError: Invalid block tag: 'a.name_is_x' or TemplateSyntaxError: Could not parse the remainder: 'www' so how to make my method running thanks

    Read the article

  • basic unique ModelForm field for Google App Engine

    - by Alexander Vasiljev
    I do not care about concurrency issues. It is relatively easy to build unique form field: from django import forms class UniqueUserEmailField(forms.CharField): def clean(self, value): self.check_uniqueness(super(UniqueUserEmailField, self).clean(value)) def check_uniqueness(self, value): same_user = users.User.all().filter('email', value).get() if same_user: raise forms.ValidationError('%s already_registered' % value) so one could add users on-the-fly. Editing existing user is tricky. This field would not allow to save user having other user email. At the same time it would not allow to save a user with the same email. What code do you use to put a field with uniqueness check into ModelForm?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • How do you add folder level documentation to C# assemblies?

    - by Elijah
    Me: I'm a relative new-comer to the .NET platform. Problem In Java, you can add package level documentation to your project by creating a package-info.java or package.html file and storing in the package folder. How do I add equivalent documentation to my project in C# using Visual Studio 2010? Background I like to write documentation describing my motivations in the package/folder level context of the source code projects that I am working on. I have become very accustomed to this workflow in a variety of languages (specifically Java) and I believe that it is a good way to document my project.

    Read the article

  • How to retrieve view of MultiIndex DataFrame

    - by Henry S. Harrison
    This question was inspired by this question. I had the same problem, updating a MultiIndex DataFrame by selection. The drop_level=False solution in Pandas 0.13 will allow me to achieve the same result, but I am still wondering why I cannot get a view from the MultiIndex DataFrame. In other words, why does this not work?: >>> sat = d.xs('sat', level='day', copy=False) Traceback (most recent call last): File "<stdin>", line 1, in <module> File "C:\Python27\lib\site-packages\pandas\core\frame.py", line 2248, in xs raise ValueError('Cannot retrieve view (copy=False)') ValueError: Cannot retrieve view (copy=False) Of course it could be only because it is not implemented, but is there a reason? Is it somehow ambiguous or impossible to implement? Returning a view is more intuitive to me than returning a copy then later updating the original. I looked through the source and it seems this situation is checked explicitly to raise an error. Alternatively, is it possible to get the same sort of view from any of the other indexing methods? I've experimented but have not been successful. [edit] Some potential implementations are discussed here. I guess with the last question above I'm wondering what the current best solution is to index into arbitrary multiindex slices and cross-sections.

    Read the article

  • Locating file path from a <InMemoryUploadedFile> Djnago object

    - by PirosB3
    Hi all I have a Django app which, submitting a package, should return values that are inside it.. Submitted the form to a view called "insert": request.FILES['file'] returns the file objects, but it is of kind < InMemoryUploadedFile. What i need is a way to get the absolute path of the uploaded file, so that i can feed it to a method that will return the values needed Anyone know how i can accomplish this? Thanks

    Read the article

  • Google App Engine with local Django 1.1 gets Intermittent Failures

    - by Jon Watte
    I'm using the Windows Launcher development environment for Google App Engine. I have downloaded Django 1.1.2 source, and un-tarrred the "django" subdirectory to live within my application directory (a peer of app.yaml) At the top of each .py source file, I do this: import settings import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' In my file settings.py (which lives at the root of the app directory, as well), I do this: DEBUG = True TEMPLATE_DIRS = ('html') INSTALLED_APPS = ('filters') import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' from google.appengine.dist import use_library use_library('django', '1.1') from django.template import loader Yes, this looks a bit like overkill, doesn't it? I only use django.template. I don't explicitly use any other part of django. However, intermittently I get one of two errors: 1) Django complains that DJANGO_SETTINGS_MODULE is not defined. 2) Django complains that common.html (a template I'm extending in other templates) doesn't exist. 95% of the time, these errors are not encountered, and they randomly just start happening. Once in that state, the local server seems "wedged" and re-booting it generally fixes it. What's causing this to happen, and what can I do about it? How can I even debug it? Here is the traceback from the error: Traceback (most recent call last): File "C:\code\kwbudget\edit_budget.py", line 34, in get self.response.out.write(t.render(template.Context(values))) File "C:\code\kwbudget\django\template\__init__.py", line 165, in render return self.nodelist.render(context) File "C:\code\kwbudget\django\template\__init__.py", line 784, in render bits.append(self.render_node(node, context)) File "C:\code\kwbudget\django\template\__init__.py", line 797, in render_node return node.render(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 71, in render compiled_parent = self.get_parent(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 66, in get_parent raise TemplateSyntaxError, "Template %r cannot be extended, because it doesn't exist" % parent TemplateSyntaxError: Template u'common.html' cannot be extended, because it doesn't exist And edit_budget.py starts with exactly the lines that I included up top. All templates live in a directory named "html" in my root directory, and "html/common.html" exists. I know the template engine finds them, because I start out with "html/edit_budget.html" which extends common.html. It looks as if the settings module somehow isn't applied (because that's what adds html to the search path for templates).

    Read the article

  • django-uni-form helpers and CSRF tags over POST

    - by linked
    Hi, I'm using django-uni-forms to display my fields, with a rather rudimentary example straight out of their book. When I render the form fields using <form>{%csrf_tag%} {%form|as_uni_form%}</form>, everything works as expected. However, django-uni-form Helpers allow you to generate the form tag (and other helper-related content) using the following syntax -- {% with form.helper as helper %}{% uni_form form helper%}{%endwith%} -- This creates the <form> tag for me, so there's nowhere to embed my own CSRF_token. When I try to use this syntax, the form renders perfectly, but without a CSRF token, and so submitting the form fails every time. Does anyone have experience with this? Is there an established way to add the token? I much prefer the second syntax, for re-use reasons. Thanks!

    Read the article

  • Is there a efficient way to do multiple test cases in c?

    - by Ahmed Abdelaal
    I use MS Visual Studio and I am new to C++, so I am just wondering if there is an faster more efficient way to do multiple test cases instead of keep clicking CTRL+F5 and re-opening the console many times. Like for example if I have this code #include <iostream> using namespace std; void main () { int x; cout<<"Enter a number"<<endl; cin>>x; cout<<x*2<<endl; } Is there a way I could try different values of x at once and getting the results together? Thanks

    Read the article

  • How to reset Scrapy parameters? (always running under same parameters)

    - by Jean Ventura
    I've been running my Scrapy project with a couple of accounts (the project scrapes a especific site that requieres login credentials), but no matter the parameters I set, it always runs with the same ones (same credentials). I'm running under virtualenv. Is there a variable or setting I'm missing? Edit: It seems that this problem is Twisted related. Even when I run: scrapy crawl -a user='user' -a password='pass' -o items.json -t json SpiderName I still get an error saying: ERROR: twisted.internet.error.ReactorNotRestartable And all the information I get, is the last 'succesful' run of the spider.

    Read the article

  • Conditional operator in Mako using Pylons

    - by Antoine Leclair
    In PHP, I often use the conditional operator to add an attribute to an html element if it applies to the element in question. For example: <select name="blah"> <option value="1"<?= $blah == 1 ? ' selected="selected"' : '' ?>> One </option> <option value="2"<?= $blah == 2 ? ' selected="selected"' : '' ?>> Two </option> </select> I'm starting a project with Pylons using Mako for the templating. How can I achieve something similar? Right now, I see two possibilities that are not ideal. Solution 1: <select name="blah"> % if blah == 1: <option value="1" selected="selected">One</option> % else: <option value="1">One</option> % endif % if blah == 2: <option value="2" selected="selected">Two</option> % else: <option value="2">Two</option> % endif </select> Solution 2: <select name="blah"> <option value="1" % if blah == 1: selected="selected" % endif >One</option> <option value="2" % if blah == 2: selected="selected" % endif >Two</option> </select> In this particular case, the value is equal to the variable tested (value="1" = blah == 1), but I use the same pattern in other situations, like <?= isset($variable) ? ' value="$variable" : '' ?>. I am looking for a clean way to achieve this using Mako.

    Read the article

  • What is a good method to use with multithreading to simulate this?

    - by user1504257
    I am writing a program in c++ in visual studio to be able to handle a line at a park. I have all of my customers in a line at the park and I want to be able to service them using multithreading with openmp. When I put the pragma and such in, I have multiple threads servicing the same customer at the same time for each and every customer I create, not what I want. I want for example, if I had two threads and four customers, that thread one to do customer one while thread 2 does customer 2. Then I would like thread 1 to do customer 3 and thread 2 customer 4 at the same time. I don't know if its possible or if there is a better way, but I need to use openmp. Thanks for your input.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Error handling in the RequestHandler without embedding in URI

    - by hyn
    When a user sends a filled form, I want to print an error message in case there is an input error. One of the GAE sample codes does this by embedding the error message in the URI. Inside the form handler (get): self.redirect('/compose?error_message=%s' % message) and in the handler (get) of redirected URI, gets the message from request: values = { 'error_message': self.request.get('error_message'), ... Is there a way to accomplish the same without embedding the message in the URI?

    Read the article

< Previous Page | 564 565 566 567 568 569 570 571 572 573 574 575  | Next Page >