Search Results

Search found 28707 results on 1149 pages for 'writing your own'.

Page 582/1149 | < Previous Page | 578 579 580 581 582 583 584 585 586 587 588 589  | Next Page >

  • Is there a way in C# 4.0 to have a method take a delegate with the parameters baked in?

    - by Rob Packwood
    I have this code for reporting on a simple demo app I am writing: private static void ReportOnTimedProcess(Action process) { var stopwatch = new Stopwatch(); stopwatch.Start(); process(); stopwatch.Stop(); Console.WriteLine("Process took {0} seconds", stopwatch.ElapsedMilliseconds*1000); } I basically want to track the time of any process. I am trying to have this method take a delegate as a parameter that can have any number of varying parameters. Is there some way an Expression can do this?

    Read the article

  • How to prevent inputting Russian characters in Word with a Word addin?

    - by Edwin
    Hi, Sorry for this vaguely described problem, but please look at the problem from the Win32 API's perspective. I'm writing a Word addin using Addin Express with Delphi, and I use some other 3rd party VCL's also, including virtual stringtree, TNT controls, etc. Now I cannot input Russian characters in Word anymore, but I can input English and Chinese.... Since it's a large project I don't know where to start finding the problem, would you give me some generic tips, I'll be appreciated that! Thank you, and have a nice day!

    Read the article

  • PHP preg_match Math Function

    - by Matt
    I'm writing a script that will allow a user to input a string that is a math statement, to then be evaluated. I however have hit a roadblock. I cannot figure out how, using preg_match, to dissallow statements that have variables in them. Using this, $calc = create_function("", "return (" . $string . ");" ); $calc();, allows users to input a string that will be evaluated, but it crashes whenever something like echo 'foo'; is put in place of the variable $string.

    Read the article

  • Rails 3 - raw/html_safe not working in some cases?

    - by Frexuz
    I'm having difficulties with output not being encoded even though I'm using raw or html_safe. This one is writing out the &nbsp in my final HTLM page. def build_tag_cloud(tag_cloud, style_list) tag_cloud.sort!{ |x,y| x.permalink <=> y.permalink } max, min = 0, 0 tag_cloud.each do |tag| max = tag.followers.to_i if tag.followers.to_i > max min = tag.followers.to_i if tag.followers.to_i < min end divisor = ((max - min) / style_list.size) + 1 html = "" tag_cloud.each do |tag| name = raw(tag.name.gsub('&','&amp;').gsub(' ','&nbsp;')) link = raw(link_to "#{name}", {:controller => "/shows", :action => "show", :permalink => tag.permalink}, :class => "#{style_list[(tag.followers.to_i - min) / divisor]}") html += raw("<li>#{link}</li> ") end return raw(html.to_s) end What is allowed in using raw and html_safe? And how should my example above be fixed?

    Read the article

  • compromised site

    - by pinniger
    So, I have a web site that has been compromised twice in two weeks. every index.php and .js file gets a script injecting into the source code of the file. The problem is that I have no idea how they're doing it. I've seen this done via sql injection before, but I don't know how they are actually writing to the file. I've dug through the Apache logs but didn't find anything interesting. The site is built using the cakephp framework on a godaddy shared server. Anybody know what secturity settings or log files to check to see how they are doing this?

    Read the article

  • Wildcard App IDs for iPhone/iPod Touch Apps

    - by Can Berk Güder
    I'm writing my third app, and I already have an app in the App Store, but I still don't get this App ID business. I created the App IDs for my first two applications like this: XXXXXXXXXX.me.cbg.FirstApp YYYYYYYYYY.me.cbg.SecondApp but then Apple introduced the App ID wizard, which I used to create the App ID and provisioning profiles for my third application: ZZZZZZZZZZ.* So my question is: What is the "proper" way of creating App IDs for three completely independent apps? Should I use the XXXXXXXXXX.* format or XXXXXXXXXX.me.cbg.*? Should I create three different App IDs, or just one wildcard ID?

    Read the article

  • I need a very simple PHP database front-end admin panel; a simple records editor for a specified tab

    - by Lansen Q
    Hi there, I am looking to add some dynamics to our corporate website. This is a secondary role so I'd rather not be spending a ton of time on it. At this point, all I need is a simple PHP script where a non-technical user can pull up and manage the records in a MySQL table. There's only one table of data to be managed; it's just that it will be accessed and updated quite frequently. I recall that Grails' default scaffolding feature has precisely this: list of entries with the ability to add, edit and delete, with no nonsense. What would be the best tool to use for this? I would rather not be writing it from scratch, as this will take me quite some time. It seems like the kind of thing that ought to exist somewhere. Thanks!

    Read the article

  • dealing with IO vs pure code in haskell

    - by Drakosha
    I'm writing a shell script (my 1st non-example in haskell) which is supposed to list a directory, get every file size, do some string manipulation (pure code) and then rename some files. I'm not sure what i'm doing wrong, so 2 questions: How should i arrange the code in such program? I have a specific issue, i get the following error, what am i doing wrong? error: Couldn't match expected type [FilePath]' against inferred typeIO [FilePath]' In the second argument of mapM', namelyfileNames' In a stmt of a 'do' expression: files <- (mapM getFileNameAndSize fileNames) In the expression: do { fileNames <- getDirectoryContents; files <- (mapM getFileNameAndSize fileNames); sortBy cmpFilesBySize files } code: getFileNameAndSize fname = do (fname, (withFile fname ReadMode hFileSize)) getFilesWithSizes = do fileNames <- getDirectoryContents files <- (mapM getFileNameAndSize fileNames) sortBy cmpFilesBySize files

    Read the article

  • Highlighting current and previous stars on mouseover

    - by mpet
    I'm trying to make simple five star rating system using Twitter Bootstrap 3 i jQuery. For now, I'm trying to set .hover() and .mouseout() events using counter by writing this code that doesn't work: var i; for (i = 1; i <= 5; i++) { $('#overall_rating_' + i).hover(function(){ $('#overall_rating_' + i).removeClass("glyphicon-star-empty").addClass("glyphicon-star"); }); $('#overall_rating_' + i).mouseout(function(){ $('#overall_rating_' + i).removeClass("glyphicon-star").addClass("glyphicon-star-empty"); }); } Trying to highlight current and previous stars on mouseover. The code is not complete, it would be accompanied by additional sub-counters, but this part doesn't work for now. Any better methods are welcome. What's broken here?

    Read the article

  • What's the advantage of an Adobe AIR app over a traditional desktop app?

    - by John
    I'm pretty familiar with using Adobe Flex & AS3, and compared with writing apps in JS/HTML I think it's very cool. However, since AIR is essentially a non-browser version of Flex with benefits like local storage, it seems to be competing as a cross-platform desktop application platform... and in that space it's much less mature than more established desktop technologies. So what's the advantage of creating a desktop application using AIR compared to something like Java (or C++ using a cross-platform GUI library like wxWidgets)? Java's equally capable of communicating with the server for instance, I'm not quite sure what AIR adds when competing head-to-head in the desktop development world?

    Read the article

  • Is 'bool' a basic datatype in C++ ?

    - by Naveen
    I got this doubt while writing some code. Is 'bool' a basic datatype defined in the C++ standard or is it some sort of extension provided by the compiler ? I got this doubt because Win32 has 'BOOL' which is nothing but a typedef of long. Also what happens if I do something like this: int i = true; Is it "always" guaranteed that variable i will have value 1 or is it again depends on the compiler I am using ? Further for some Win32 APIs which accept BOOL as the parameter what happens if I pass bool variable?

    Read the article

  • Extension methods on a static object

    - by Max Malygin
    I know (or so I hear) that writing extension methods for a single stand alone .net class (not an implementation of IEnumerable) is potential code smell. However, for the sake of making the life easier I need to attach a method to the ConfigurationManager class in asp.net. It's a static object so this won't work: public static List<string> GetSupportedDomains(this ConfigurationManager manager) { //the manager needs to be static. } So the question is - is it possible to write an extension method for a static class in .net?

    Read the article

  • Likelihood of IOError during print vs. write

    - by jkasnicki
    I recently encountered an IOError writing to a file on NFS. There wasn't a disk space or permission issue, so I assume this was just a network hiccup. The obvious solution is to wrap the write in a try-except, but I was curious whether the implementation of print and write in Python make either of the following more or less likely to raise IOError: f_print = open('print.txt', 'w') print >>f_print, 'test_print' f_print.close() vs. f_write = open('write.txt', 'w') f_write.write('test_write\n') f_write.close() (If it matters, specifically in Python 2.4 on Linux).

    Read the article

  • Boost ASIO read X bytes synchroniously into a vector

    - by xeross
    Hey, I've been attempting to write a client/server app with boost now, so far it sends and receives but I can't seem to just read X bytes into a vector. If I use the following code vector<uint8_t> buf; for (;;) { buf.resize(4); boost::system::error_code error; size_t len = socket.read_some(boost::asio::buffer(buf), error); if (error == boost::asio::error::eof) break; // Connection closed cleanly by peer. else if (error) throw boost::system::system_error(error); // Some other error. } And the packet is bigger then 4 bytes then it seems it keeps writing into those 4 bytes until the entire packet has been received, however I want it to fetch 4 bytes, then allow me to parse them, and then get the rest of the packet. Can anyone provide me with a working example, or at least a pointer on how to make it work properly ? Regards, Xeross

    Read the article

  • Test Driven Development (TDD) with Rails

    - by macek
    I am looking for TDD resources that are specific to Rails. I've seen the Rails Guide: The Basics of Creating a Rails Plugin which really spurred my interest in the topic. I have the Agile Development with Rails book and I see there's some testing-related information there. However, it seems like the author takes you through the steps of building the app, then adds testing afterward. This isn't really Test Driven Development. Ideally, I'd like a book on this, but a collection of other tutorials or articles would be great if such a book doesn't exist. Things I'd like to learn: Primary goal: Best Practices Unit testing How to utilize Fixtures Possibly using existing development data in place of fixtures What's the community standard here? Writing tests for plugins Testing with session data User is logged in User can access URL /foo/bar Testing success of sending email Thanks for any help!

    Read the article

  • What format is your documentation in?

    - by Ek0nomik
    I am going to be writing documentation for two web services that I developed, and I started wondering what people on here do for documentation. Do you create it in an HTML file so it can be viewed in the browser? Word document? Wiki? What do you guys/gals use? I was originally leaning towards creating an HTML page since it seems a little more open and friendly than a word document. Plus I can use the prettify javascript to make code samples look nice. Our company has a Sharepoint though, so an HTML file may not be the best choice given that most documentation is put up in spreadsheets and word documents.

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Python: How to use code.InteractiveConsole?

    - by Rosarch
    I'm trying to use InteractiveConsole to create a new front-end for a Python interpreter. These code fragments are from me playing around with InteractiveConsole in IDLE: >>> ses = code.InteractiveConsole() >>> ses.runsource("def foo():") True >>> ses.runsource(" return 2") File "<input>", line 1 SyntaxError: 'return' outside function (<input>, line 1) False Why does it raise a syntax error? How else can I finish writing the function? Also, for something like this: >>> ses.runsource("x = 1") False >>> ses.runsource("x") 1 False How can I capture the 1 value from above? False is the return value, but 1 is written to some stream.

    Read the article

  • How to write a xpath to match all elements except a particular element

    - by Unmesh Kondolikar
    I am writing an XSL transformation. I want to write a template which matches all the child elements of the document except one particular node. My xml looks like this - <Document> <NodeA><\NodeA> <NodeB><\NodeB> <ServiceNode><\ServiceNode> <NodeX><\NodeX> </Document> I want to write a template that matches all nodes except ServiceNode i.e. NodeA to NodeX. How to write this Xpath to get - <xsl:template match="ALL Nodex Except ServiceNode">

    Read the article

  • Singly-Linked Lists insert_back and isIncreasing

    - by rezivor
    I just finished writing a program that I can add, remove or print objects to a list, but I am having difficulty implementing two more functions that is insert_back, which inserts a value to the end of a list. Also,I have to modify the representation of a List and alter whatever methods are necessary to make insert_back run in constant time: O(1). This new operation should have the signature: void List::insert_back( const Object& data ); Also, isIncreasing, For example, for a list containing head-() (11) (8) (15) (3), isIncreasing() should return false. However, it would return true when working on a list containing head- () (7) (9) (15). This new operation should have the signature: bool List::isIncreasing() const; Thank you

    Read the article

  • Running commands though PHP/Perl scripts as a priviledged user on Linux.

    - by jtd
    Background: I am writing a script for a company that will allow users to create FTP accounts through a web interface. In the background, the script must run a bunch of commands: Add the user to the system (useradd) Open and edit various files mail the user via sendmail and a few other things... I'm basically looking for the most secure way of doing this. I've heard of the setuid method, the sudo method, and of course, running httpd as a priviledged user. There will be sanity checks on the data entered of course before any commands are executed (ie. only alphanumeric characters in usernames) What is the method used by the popular scripts out there (webmin for example), as it must be fairly secure?

    Read the article

  • Idea for doing almost same work in both catch & finally(C#3.0)

    - by Newbie
    I have a requirement. I am processing some files and after the processing are done I am archiving those files into an archive folder with timestamp appended. The file archiving and putting time stamp portion I am doing in the Finally block. Now a new requirement has come where I need to mail if something wrong goes in the original files and then I need to archive the same. Now this piece of code I need to handle in the catch block. But if I write the code entirely in the catch block, then it will fire only if there is an exception; otherwise not. So basically I am writing the same pice of code in both the catch and finally block. What is the standard and recommended approach you people think will be better in this case? I am using C#3.0 Thanks.

    Read the article

  • Increase a recive buffer in UDP socket

    - by unresolved_external
    I'wm writing an app, which transmits video and obviously uses UDP protocol fot this purpose. So I am wondering how can I increase a size of send/recieve buffer, cause currently the maximal size of data, which I can send is 65000 bytes. I already tried to do it in following way: int option = 262144; if(setsockopt(m_SocketHandle,SOL_SOCKET,SO_RCVBUF ,(char*)&option,sizeof(option)) < 0) { printf("setsockopt failed\n"); } But it did not work. So how can I do it?

    Read the article

  • TDD, Unit Test and architectural changes

    - by Leandro
    I'm writing an RPC middleware in C++. I have a class named RPCClientProxy that contains a socket client inside: class RPCClientProxy { ... private: Socket* pSocket; ... } The constructor: RPCClientProxy::RPCClientProxy(host, port) { pSocket = new Socket(host, port); } As you can see, I don't need to tell the user that I have a socket inside. Although, to make unit tests for my proxies it would be necessary to create mocks for sockets and pass them to the proxies, and to do so I must use a setter or pass a factory to the sockets in the proxies's constructors. My question: According to TDD, is it acceptable to do it ONLY because the tests? As you can see, these changes would change the way the library is used by a programmer.

    Read the article

  • JQuery: After adding some AJAX, some of the jquery code no longer works

    - by fwaokda
    Here's a pastebin link to my entire jQuery code. [ http://pastebin.com/w57ma5Gx ] The "Thumbnails" section was working fine before I added the ajax sections. Anyone can help me with why it quit working? And if I need to I can post another question but figured I'd try it here first. Whats a better way of writing the ajax code where it executes once upon loading the page and then every time I click the $("a#next") link afterwards? Right now I just repasted the code outside of the next link and that works, but seems silly to have the same code in two different places like that. Thanks!

    Read the article

< Previous Page | 578 579 580 581 582 583 584 585 586 587 588 589  | Next Page >