Search Results

Search found 28707 results on 1149 pages for 'writing your own'.

Page 582/1149 | < Previous Page | 578 579 580 581 582 583 584 585 586 587 588 589  | Next Page >

• Trying to use tcl threads on windows 7 results in access violation.

  - by Juan

  I'm trying to get this simple program to work on windows, but it crashes: unsigned (__stdcall testfoo)(ClientData x) { return 0; } int main() { Tcl_ThreadId testid = 0; Tcl_CreateThread(&testid, testfoo, (ClientData) NULL, TCL_THREAD_STACK_DEFAULT, TCL_THREAD_NOFLAGS); } I am using a makefile generated by cmake and linking against a version of Tcl 8.5.7 I compiled myself using Visual C++ 2008 express. It was compiled using msvcrt,static,threads and the name of the resulting library is tcl85tsx.lib. The error is: Unhandled exception at 0x77448c39 in main.exe: 0xC0000005: Access violation writing location 0x00000014. The Tcl library works fine, and I can even run a threading script example by loading the Thread extension into it. My assumption is that there is something horribly wrong with a memory violation, but I have no idea what. Any help appreciated.

  Read the article

• Get the URL(s) from Firefox using C# .NET 3.5

  - by ghawkes

  I am writing a .NET 3.5 WPF application in C#. This application needs to be able to get the URL(s) out of the browser window when it is in the foreground. I already have the code working that handles a global Windows hotkey and then checks to see if the foreground IntPtr is from a browser. If so, I am able to obtain the System.Diagnostics.Process objects that maps to the browser. At this point, I would like to obtain the URL(s) from the browser. Thank you, G

  Read the article

• How to setup custom CSS based on account settings in a Django site?

  - by sdolan

  So I'm writing a Django based website that allows users select a color scheme through an administration interface. I already have middleware/context processors that links the current request (based on domain) to the account. My question is how to dynamically serve the CSS with the account's custom color scheme. I see two options: Add a CSS block to the base template that overrides the styles w/variables passed in through a context processors. Use a custom URL (e.g. "/static/dynamic/css//styles.css") that gets routed to a view that grabs all the necessary values and creates the css file. I'm content with either option, but was wondering if anyone else out there has dealt with similar problems and could give some insight as to "Best Practices".

  Read the article

• Ternary operator or chosing from two arrays with the boolean as index

  - by ajax333221

  Which of these lines is more understandable, faster jsPerf, easier to maintain?: arr = bol ? [[-2,1],[-1,2]] : [[-1,0],[-1,1]]; //or arr = [[[-1,0],[-1,1]], [[-2,1],[-1,2]]][bol*1]; I usually write code for computers (not for humans), but this is starting to be a problem when I am not the only one maintaining the code and work for a team. I am unsure, the first example looks neat but are two different arrays, and the second is a single array and seem to transmit what is being done easier. I also considered using an if-else, but I don't like the idea of writing two arr = .... Or are there better options? I need serious guidance, I have never worried about others seeing my code.

  Read the article

• How to trigger Mouse-Over on iPhone?

  - by Andrew

  This might seem like a really dumb question, but I am writing an application and I have come across where my mouse-over, mouse-click and mouse-hover need different events bound to them. Now on Internet Explorer, Firefox, and Safari. It all works as expected. However, on my iPhone the actions will not trigger. Now my question is are their any specific ways I can have the Mouse-Over essentially be fired when I hold my finger down and trigger an event? An example where this doesn't work is right on this website when you hover over a comment it is supposed to display the +1 or flag icon. I am using jquery.

  Read the article

• Python: How to use code.InteractiveConsole?

  - by Rosarch

  I'm trying to use InteractiveConsole to create a new front-end for a Python interpreter. These code fragments are from me playing around with InteractiveConsole in IDLE: >>> ses = code.InteractiveConsole() >>> ses.runsource("def foo():") True >>> ses.runsource(" return 2") File "<input>", line 1 SyntaxError: 'return' outside function (<input>, line 1) False Why does it raise a syntax error? How else can I finish writing the function? Also, for something like this: >>> ses.runsource("x = 1") False >>> ses.runsource("x") 1 False How can I capture the 1 value from above? False is the return value, but 1 is written to some stream.

  Read the article

• does anyone see any issues with this thread pattern?

  - by prmatta

  Here is a simple thread pattern that I use when writing a class that needs just one thread, and needs to a specific task. The usual requirements for such a class are that it should be startable, stopable and restartable. Does anyone see any issues with this pattern that I use? public class MyThread implements Runnable { private boolean _exit = false; private Thread _thread = null; public void start () { if (_thread == null) { _thread = new Thread(this, "MyThread"); _thread.start(); } } public void run () { while (_exit) { //do something } } public void stop () { _exit = true; if (_thread != null) { _thread.interrupt(); _thread = null; } } } I am looking for comments around if I am missing something, or if there is a better way to write this.

  Read the article

• looping and arrays

  - by user1838418

  Hi I'm trying to construct a loop to execute 16 states of the 8 4 2 1 code in (C++) while( condition) { double Bubble[16], Bubble1[16]; Bubble[0] = ( a-2 - (b-2) ) + ( c-2 - (d-2)); // represents 0000 Bubble[1] = ( a-2 - (b-2) ) + ( c-2 - (d+2)); // represents 0001 Bubble[2] = ( a-2 - (b-2) ) + ( c+2 - (d-2)); // represents 0010 Bubble[3] = ( a-2 - (b-2) ) + ( c+2 - (d+2)); //represents 0011 ....... Bubble[15] =(a+2 - (b+2) ) + ( c+2 - (d+2)); //represents 1111 } Is there an easy way of coding using for loops? instead of writing bubble[] every time? 0 stands for -2 and 1 stands for +2. So I have 4 variables and each one need to be incremented and/or decremented. Can this be done using for loop? Appreciate your help

  Read the article

• How to read, edit and write xls files, and then export to SQL Server

  - by tuanvt

  I have an excel file that have the list of contacts( about 10 k of them) that I need to push into my SQL Server database. So, I am writing an .net windows program using visual studio 2008 to read the files, generate random password for each contact, and then push these information in to my SQL Server database. It was easy to handle excel file in 2003 but now my computer have office 2007 in it and things seem to changed. I am digging on Microsoft.Office.Interop.Excel but it is seem to be a lot more complicated than before.

  Read the article

• Extension methods on a static object

  - by Max Malygin

  I know (or so I hear) that writing extension methods for a single stand alone .net class (not an implementation of IEnumerable) is potential code smell. However, for the sake of making the life easier I need to attach a method to the ConfigurationManager class in asp.net. It's a static object so this won't work: public static List<string> GetSupportedDomains(this ConfigurationManager manager) { //the manager needs to be static. } So the question is - is it possible to write an extension method for a static class in .net?

  Read the article

• In web project can we write core services layer without knowledge of UI ?

  - by Silent Warrior

  I am working on web project. We are using flex as UI layer. My question is often we are writing core service layer separately from web/UI layer so we can reuse same services for different UI layer/technology. So practically is it possible to reuse same core layer services without any changes/addition in API with different kind of UI technologies/layers. For e.g. same core service layer with UI technology which supports synchronized request response (e.g. jsp etc.) and non synchronize or event driven UI technology (e.g Ajax, Flex, GWT etc.) or with multiple devices like (computers, mobiles, pdas etc.). Personally I feel its very tough to write core service layer without any knowledge of UI. Looking for thoughts from other people.

  Read the article

• JQuery: After adding some AJAX, some of the jquery code no longer works

  - by fwaokda

  Here's a pastebin link to my entire jQuery code. [ http://pastebin.com/w57ma5Gx ] The "Thumbnails" section was working fine before I added the ajax sections. Anyone can help me with why it quit working? And if I need to I can post another question but figured I'd try it here first. Whats a better way of writing the ajax code where it executes once upon loading the page and then every time I click the $("a#next") link afterwards? Right now I just repasted the code outside of the next link and that works, but seems silly to have the same code in two different places like that. Thanks!

  Read the article

• What's the advantage of an Adobe AIR app over a traditional desktop app?

  - by John

  I'm pretty familiar with using Adobe Flex & AS3, and compared with writing apps in JS/HTML I think it's very cool. However, since AIR is essentially a non-browser version of Flex with benefits like local storage, it seems to be competing as a cross-platform desktop application platform... and in that space it's much less mature than more established desktop technologies. So what's the advantage of creating a desktop application using AIR compared to something like Java (or C++ using a cross-platform GUI library like wxWidgets)? Java's equally capable of communicating with the server for instance, I'm not quite sure what AIR adds when competing head-to-head in the desktop development world?

  Read the article

• Selenium testing with checksums (md5)

  - by Peter

  I am new at selenium testing and am writing a bunch of tests for a webpage that relies heavily on javascript user interaction. At first I wrote a lot of assertions of the style If I press button A" then assert number of visible rows = x, assert checkboxes checked are such assert title = bar .... [20 more] and so on. Then I switched to checksumming the HTML using MD5: If I press button A" then assert md5(html) = 8548bccac94e35d9836f1fec0da8115c. And it made my life a whole lot easier... But is this a bad practice in any way?

  Read the article

• finding the numbers in a given range?

  - by Jamis

  Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

  Read the article

• networkstream always empty!

  - by ALEX

  hey I'm writing on an Server-Client program but when my client sends something, it never reaches my server! I'm sending like this: public void Send(string s) { char[] chars = s.ToCharArray(); byte[] bytes = chars.CharToByte(); nstream.Write(bytes, 0, bytes.Length); nstream.Flush(); } and Receiving in a background thread like this void CheckIncoming(object dd) { RecievedDelegate d = (RecievedDelegate)dd; try { while (true) { List<byte> bytelist = new List<byte>(); System.Threading.Thread.Sleep(1000); int ssss; ssss = nstream.ReadByte(); if (ssss > 1) { System.Diagnostics.Debugger.Break(); } if (bytelist.Count != 0) { d.Invoke(bytelist.ToArray()); } } } catch (Exception exp) { MSGBOX("ERROR:\n" + exp.Message); } } the ssss int is never 1 whats happening here???

  Read the article

• .NET Regular Expressions - Shorter match

  - by Xavier

  Hi Guys, I have a question regarding .NET regular expressions and how it defines matches. I am writing: var regex = new Regex("<tr><td>1</td><td>(.+)</td><td>(.+)</td>"); if (regex.IsMatch(str)) { var groups = regex.Match(str).Groups; var matches = new List<string>(); for (int i = 1; i < groups.Count; i++) matches.Add(groups[i].Value); return matches; } What I want is get the content of the two following tags. Instead it returns: [0]: Cell 1</td><td>Cell 2</td>... [1]: Last row of the table Why is the first match taking </td> and the rest of the string instead of stopping at </td>?

  Read the article

• How do I compare vectors in C++?

  - by Sam Phelps

  I am trying to compare two vector objects, and return a single vector containing all the chars which appear in both vectors. How would I go about this without writing some horribly complex manual method which compares every char in the first vector to every char in the second vector and using an if to add it to a third vector (which would be returned) if they match. Maybe my lack of real experience with vectors is making me imagine this will be harder than it really is, but I suspect there is some simplier way which I have been unable to find through searching.

  Read the article

• Language restrictions on iPhone lifted?

  - by John Smith

  Apparently Apple has changed some term in the agreement again. From http://www.appleoutsider.com/2010/06/10/hello-lua/ section 3.3.2 is now Unless otherwise approved by Apple in writing, no interpreted code may be downloaded or used in an Application except for code that is interpreted and run by Apple’s Documented APIs and built-in interpreter(s). Notwithstanding the foregoing, with Apple’s prior written consent, an Application may use embedded interpreted code in a limited way if such use is solely for providing minor features or functionality that are consistent with the intended and advertised purpose of the Application. instead of the original No interpreted code may be downloaded or used in an Application except for code that is interpreted and run by Apple’s Documented APIs and built-in interpreter(s). I am more interested in embedding Lua, but other people have other embeddings they want to make. I am wondering how you ask for permission, and what they mean by the terms "minor features" and "consistent" and how will Apple interpret this section? It seems to have enough loopholes to drive a real firetruck through.

  Read the article

• PHP preg_match Math Function

  - by Matt

  I'm writing a script that will allow a user to input a string that is a math statement, to then be evaluated. I however have hit a roadblock. I cannot figure out how, using preg_match, to dissallow statements that have variables in them. Using this, $calc = create_function("", "return (" . $string . ");" ); $calc();, allows users to input a string that will be evaluated, but it crashes whenever something like echo 'foo'; is put in place of the variable $string.

  Read the article

• Are breakpoints introduce delay?

  - by kamilo

  How is that setting a breakpoint in my code allows the following code to complete which would fail otherwise. Here is the problem. I'm writing an add-on for SAP B1 and encountered following problem. When I load a form I would like to enter some values into the form' matrix. But without a breakpoint (set on a method in which loading a form takes place) the part of code that is executed afterwards will fail. That part of code is referencing a matrix that is not yet displayed which results in an exception. This is all clear. But why setting a breakpoint "solves" the problem. What is going on? I suspect that my breakpoint introduces some delay between loading and displaying my form and part of code that references element of that form but I could be wrong. Thanks in advance

  Read the article

• Strings - Filling In Leading Zeros Wtih A Zero

  - by headscratch

  I'm reading an array of hard-coded strings of numeric characters - all positions are filled with a character, even for the leading zeros. Thus, can confidently parse it using substring(start, end) to convert to numeric. Example: "0123 0456 0789" However, a string coming from a database does not fill in the leading zero with a 'zero character', it simply fetches the '123 456 789', which is correct for an arithmetic number but not for my needs and makes for parsing trouble. Before writing conditionals to check for leading zeros and adding them to the string if needed, is there a simple way of specifying they be filled with a character ? I'm not finding this in my Java book... I could have done the three conditionals in the time it took to post this but, this is more about 'education'... Thanks

  Read the article

• How to track conversion rate (clicks to sales) from an internal advertising system?

  - by Ed Woodcock

  I am currently writing an interal advertising system for a company client's website, where the adverts will only be seen by internal users, and all transactions take place internally to the site (i.e. the adverts are for member-only content available on the site). Does anyone have any recommendations as to the best way to track the conversion rate of these adverts (i.e. views:clicks:sales)? EDIT I'm not looking for a 'Why don't you use google analystics'-type answer, I'm looking into possible architecture outlines, i.e. a 'why don't use store a guid in a cache temporarily and see if it ties to the advert' kind of answer. /EDIT In a previous job I did something based on an internal cache, which simply did view:click tracking, however the addition of the sales rate makes this task more complex, especially if we take into account the idea that someone may click through to an advert and not purchase immediately. Cheers, Ed (N.B. I'm leaving this purposely vague in order to (hopefully) get some answers that provide ideas I've yet to have thought of by coming at the problem from a different angle)

  Read the article

• How to properly design a simple favorites and blocked table?

  - by Nils Riedemann

  Hey, i am currently writing a webapp in rails where users can mark items as favorites and also block them. I came up two ways and wondered which one is more common/better way. 1. Separate join tables Would it be wise to have 2 tables for this? Like: users_favorites - user_id - item_id users_blocked - user_id - item_id 2. single table users_marks (or so) - users_id - item_id - type (["fav", "blk"]) Both ways seem to have advantages. Which one would you use and why?

  Read the article

• Performance when accessing class members

  - by Dr. Acula

  I'm writing something performance-critical and wanted to know if it could make a difference if I use: int test( int a, int b, int c ) { // Do millions of calculations with a, b, c } or class myStorage { public: int a, b, c; }; int test( myStorage values ) { // Do millions of calculations with values.a, values.b, values.c } Does this basically result in similar code? Is there an extra overhead of accessing the class members? I'm sure that this is clear to an expert in C++ so I won't try and write an unrealistic benchmark for it right now

  Read the article

< Previous Page | 578 579 580 581 582 583 584 585 586 587 588 589  | Next Page >