Search Results

Search found 28672 results on 1147 pages for 'best practise'.

Page 587/1147 | < Previous Page | 583 584 585 586 587 588 589 590 591 592 593 594  | Next Page >

  • Ipad - Display thumbnail from video

    - by ludo
    Hi, I have a video store in my bundle, how can I display a thumbnail of it with the new Media Player Framework from the Ipad (thumbnail + the white play button on it), I can also store my video online it will be better. Someone have an idea? best Regards,

    Read the article

  • How to design a command line program reusable for a future development of a GUI?

    - by systempuntoout
    What are some best practices to keep in mind when developing a script program that could be integrated with a GUI, probably by somebody else, in the future? Possible scenario: i develop a fancy python CLI program that scrapes every unicorn images from the web i decide to publish it on github a unicorn fan programmer decides to take the sources and build a GUI on them. he\she gives up because my code is not reusable How do i avoid step four and let unicorn fan programmer build his\her GUI without hassle?

    Read the article

  • UCA + Natural Sorting

    - by Alix Axel
    I recently learnt that PHP already supports the Unicode Collation Algorithm via the intl extension: $array = array ( 'al', 'be', 'Alpha', 'Beta', 'Álpha', 'Àlpha', 'Älpha', '????', 'img10.png', 'img12.png', 'img1.png', 'img2.png', ); if (extension_loaded('intl') === true) { collator_asort(collator_create('root'), $array); } Array ( [0] => al [2] => Alpha [4] => Álpha [5] => Àlpha [6] => Älpha [1] => be [3] => Beta [11] => img1.png [9] => img10.png [8] => img12.png [10] => img2.png [7] => ???? ) As you can see this seems to work perfectly, even with mixed case strings! The only drawback I've encountered so far is that there is no support for natural sorting and I'm wondering what would be the best way to work around that, so that I can merge the best of the two worlds. I've tried to specify the Collator::SORT_NUMERIC sort flag but the result is way messier: collator_asort(collator_create('root'), $array, Collator::SORT_NUMERIC); Array ( [8] => img12.png [7] => ???? [9] => img10.png [10] => img2.png [11] => img1.png [6] => Älpha [5] => Àlpha [1] => be [2] => Alpha [3] => Beta [4] => Álpha [0] => al ) However, if I run the same test with only the img*.png values I get the ideal output: Array ( [3] => img1.png [2] => img2.png [1] => img10.png [0] => img12.png ) Can anyone think of a way to preserve the Unicode sorting while adding natural sorting capabilities?

    Read the article

  • Bad practice to have models made up of other models?

    - by mattruma
    I have a situation where I have Model A that has a variety of properties. I have discovered that some of the properties are similar across other models. My thought was I could create Model B and Model C and have Model A be a composite with a Model B property and a Model C property. Just trying to determine if this is the best way to handle this situation.

    Read the article

  • Setup filename convention? setup.exe vs install.exe vs others

    - by www.openidfrance.frfxkim
    Hi, I'm going to build an installer to deploy my application which is a Windows executable file(not a MSI file). I'm using NSIS. This application targets French people and "install" word is close to "installation" in French. Is there a filename convention? What is the best choice for you? It seems that "setup.exe" is the most popular name compare to "install.exe" What do you think? Thanks for your reply.

    Read the article

  • HTML - Which element to output text?

    - by Oliver Weiler
    I'm implementing a little chat application where I receive messages from a server, which I would like to display to a user. As I'm more of a backend guy, and lacking experience in frontend development, I don't know which element would be suited best to output the text. Two options come to my mind: Using a plain div Using a textarea (as far as I understand, this is intended to be used for input). (Would also be nice if I could somehow fade in the text using JQuery).

    Read the article

  • Finding process count in Linux via command line

    - by Moev4
    I was looking for the best way to find the number of running processes with the same name via the command line in Linux. For example if I wanted to find the number of bash processes running and get "5". Currently I have a script that does a 'pidof ' and then does a count on the tokenized string. This works fine but I was wondering if there was a better way that can be done entirely via the command line. Thanks in advance for your help.

    Read the article

  • How to localize ASP .Net MVC application?

    - by pirho
    What would be best practice to localize your ASP .Net MVC application ? I would like to cover two situations: one application deployment in IIS which would handle multiple languages one language / application deployment. In first situation should you go with somekind of view based thing like, ~/View/EN, ~/View/FI, ~/View/SWE or something different ? What about second case, just application based config via Web.config and point these different languages to different urls ?

    Read the article

  • Deployment with CakePhp

    - by Michael
    Hi all, I have a CakePhp Website that is currently live. I would like to keep working on the site, without impacting the deployed site. What is the best way to keep a production version separate from a deployed version, and then merging the two when appropriate? Thanks!

    Read the article

  • Facebook Application with .net Starting facebook toolkit

    - by AjmeraInfo
    i am new for facebook application please help me for how to start and what is basic steps for add application to facebook i have used facebook toolkit 3.1 beta version. but after authentication it will generated error... i want to create iFream application i want to craete gift send application. so which one is best iFream or FBML. Please it is urgent help me.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Getting RAW Soap Data from a Web Reference Client running in ASP.net

    - by Harry
    I'm trying to trouble shoot a web service client in my current project. I'm not sure of the platform of the Service Server (Most likely LAMP). I believe there is a fault on their side of the fence as i have eliminated the potential issues with my client. The client is a standard ASMX type web reference proxy auto generated from the service WSDL. What I need to get to is the RAW SOAP Messages (Request and Responses) What is the best way to go about this?

    Read the article

  • How do you get the host address and port from a System.Net.EndPoint?

    - by cyclotis04
    I'm using a TcpClient passed to me from a TcpListener, and for the life of me I can't figure out a simple way to get the address and port it's connected to. The best I have so far is _client.Client.RemoteEndPoint.ToString(); which returns a string in the form FFFF::FFFF:FFFF:FFF:FFFF%00:0000. I've managed to extract the address and port using Regular Expressions, but this seems like overkill. What am I missing?

    Read the article

  • Delete all characters in a multline string up to a given pattern

    - by biffabacon
    Using Python I need to delete all charaters in a multiline string up to the first occurrence of a given pattern. In Perl this can be done using regular expressions with something like: #remove all chars up to first occurrence of cat or dog or rat $pattern = 'cat|dog|rat' $pagetext =~ s/(.*?)($pattern)/$2/xms; What's the best way to do it in Python?

    Read the article

  • Open Source Text Editor

    - by user355451
    Which is the best open source text editor and why? I have used the YUI editor before, but I am looking for something more extensible and manageable and that will ultimately prove more stable.

    Read the article

  • jQuery find text and replace (or BBcode hack)

    - by Harvengure
    Basically I am attempting to use jQuery so that it will search out text on the page and replace it with something else. For example [x]text[/x] will be converted to text which then gets converted from text to the actual html...a round about way of it I am sure but it seems to be the best way to do it given that the forum seems to understand html as plain texst anyway...but ultimately the goal is to use this jQuery to in a way create new bbcode on the forum.

    Read the article

  • unit testing of installer

    - by Alien01
    What is the best process where code is checkedin by developers, installer is created by build engineer and release to QA to test the installer. Should the installer be release to QA without unit testing by Dev. If dev do some changes then they should wait until QA to report bugs.Or if installer first given to dev for unit testing and once they signoff then only it should be release to QA?

    Read the article

< Previous Page | 583 584 585 586 587 588 589 590 591 592 593 594  | Next Page >