Search Results

Search found 37647 results on 1506 pages for 'sql performance'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 587/1506 | < Previous Page | 583 584 585 586 587 588 589 590 591 592 593 594  | Next Page >

  • High performance querying - Sugestions please

    - by Alex Takitani
    Supposing that I have millions of user profiles, with hundreds of fields (name, gender, preferred pet and so on...). With database would You choose? Suppose that You have a Facebook like load. Speed is a must. Open Source preferred. I've read a lot about Cassandra, HBase, Mongo, Mysql... I just can't decide.....

    Read the article

  • How to improve performance of map that loads new overlay images

    - by anthonysomerset
    I have inherited a website to maintain that uses a html map overlaying a real map to link specific countries to specific pages. previously it loaded the default map image, then with some javascript it would change the image src to an image with that particular country in a different colour on mouseover and reset the image source back to the original image on mouse out to make maintenance (adding new countries) easier i made the initial map a background image by utilising some CSS for the div tag, and then created new images for each country which only had that countries hightlight so that the images remain fairly small. this works great but theres one issue which is particularly noticeable on slower internet connections when you hover over a country if you dont have the image file in your browser cache or downloaded it wont load the image unless you hover over another country and then back onto the first country - i guess this is due to the image having to manually be downloaded on first hover. My question: is it possible to force the load of these extra images AFTER the page and all the other assets have finished loading so that this behaviour is all but eliminated? the html code for the MAP is as follows: <div class="gtmap"><img id="Image-Maps_6200909211657061" src="<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png" usemap="#Image-Maps_6200909211657061" alt="We offer Guided Motorcycle Tours all around the world" width="615" height="296" /> <map id="_Image-Maps_6200909211657061" name="Image-Maps_6200909211657061"> <area shape="poly" coords="511,134,532,107,542,113,520,141" href="/guided-motorcycle-tours-japan/" alt="Guided Japan Motorcycle Tours" title="Japan" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-japan.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="252,61,266,58,275,64,262,68" href="/guided-motorcycle-tour.php?iceland-motorcycle-adventure-39" alt="Guided Iceland Motorcycle Tours" title="Iceland" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-iceland.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="587,246,597,256,577,279,568,270" href="/guided-motorcycle-tour.php?new-zealand-south-island-adventure-10" alt="New Zealand Guided Motorcycle Tours" title="New Zealand" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-nz.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="418,133,412,145,412,154,421,178,430,180,430,166,443,154,443,145,438,144,433,142,430,138,431,130,430,129,425,128" href="/guided-motorcycle-tours-india/" alt="India Guided Motorcycle Tours" title="India" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-india.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="460,152,466,149,474,165,470,171,466,161" href="/guided-motorcycle-tours-laos/" alt="Laos Guided Motorcycle Tours" title="Laos" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-laos.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="468,179,475,166,468,152,475,152,482,169" href="/guided-motorcycle-tour.php?indochina-motorcycle-adventure-tour-32" onClick="javascript: pageTracker._trackPageview('/internal-links/guided-tours/map/vietnam');" alt="Vietnam Guided Motorcycle Tours" title="Vietnam" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-viet.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="330,239,337,235,347,226,352,233,351,243,344,250,335,253,327,255,323,249,322,242,323,241" href="/guided-motorcycle-tours-southafrica/" alt="South Africa Guided Motorcycle Tours" title="South Africa" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-sa.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="290,77,293,86,298,96,286,102,285,97,285,89,282,84,282,79" href="/guided-motorcycle-tour.php?great-britain-isle-of-man-scotland-wales-uk-18" alt="United Kingdom" title="United Kingdom Guided Motorcycle Tours" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-uk.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="357,118,368,118,369,126,345,129,338,125,338,117,342,115,348,116" href="/guided-motorcycle-tour.php?explore-turkey-adventure-45" alt="Turkey" title="Turkey Guided Motorcycle Tours" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-turkey.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="206,95,193,101,185,101,178,106,165,111,157,109,147,105,134,103,121,103,107,103,96,103,86,104,81,99,77,91,70,83,62,79,60,72,61,64,59,57,60,51,71,50,83,49,95,50,107,54,117,53,129,47,137,36,148,37,163,38,177,44,187,54,195,60,184,72,191,80,200,87" href="/guided-motorcycle-tours-canada/" alt="Guided Canada Motorcycle Tours" title="Canada" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-canada.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="61,75,60,62,60,55,59,44,51,44,43,43,36,42,28,43,23,48,17,51,15,62,19,74,27,79,19,83,16,93,35,83,43,77,50,75,55,75" href="/guided-motorcycle-tours-alaska/" alt="Guided Alaska Motorcycle Tours" title="Alaska" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-alaska.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="82,101,99,101,133,101,148,105,161,110,172,106,187,100,180,113,171,122,165,131,159,149,147,141,137,140,129,147,120,141,112,138,103,137,93,132,86,122,86,112,86,106" href="/guided-motorcycle-tours-usa/" alt="USA Guided Motorcycle Tours" title="USA" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-usa.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="178,225,180,214,175,208,174,204,178,198,174,193,167,192,157,199,158,204,164,211,167,218" href="/guided-motorcycle-tour.php?peru-machu-picchu-adventure-25" alt="Peru Guided Motorcycle Tours" title="Peru" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-peru.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="172,226,169,239,166,256,166,267,164,279,171,277,174,262,175,250,179,234,180,225,176,224" href="/guided-motorcycle-tours-chile/" alt="Guided Chile Motorcycle Tours" title="Chile" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-chile.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="199,260,194,261,187,265,184,276,183,296,170,292,168,282,174,270,174,257,177,245,180,230,190,228,205,237,199,245" href="/guided-motorcycle-tours-argentina/" alt="Guided Argentina Motorcycle Tours" title="Argentina" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-arg.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> </map> </div> The <?php echo cdnhttpsCheck(); ?> is just a site specific function that gets the correct web domain/url from a config file to load resources from CDN where possible (eg all non HTTPS requests) We are loading Jquery at the bottom of the HTML if anybody wonders why it is missing from the code snippet for reference, the page with the map in question is found here: http://www.motoquest.com/guided-motorcycle-tours/

    Read the article

  • Compressing and copying large files on Windows Server?

    - by Aaron
    I've been having a hard time copying large database backups from the database server to a test box at another site. I'm open to any ideas that would help me get this database moved without having to resort to a USB hard drive and the mail. The database server is running Windows Server 2003 R2 Enterprise, 16 GB of RAM and two quad-core 3.0 GHz Xeon X5450s. Files are SQL Server 2005 backup files between 100 GB and 250 GB. The pipe is not the fastest and SQL Server backup files typically compress down to 10-40% of the original, so it made sense to me to compress the files first. I've tried a number of methods, including: gzip 1.2.4 (UnxUtils) and 1.3.12 (GnuWin) bzip2 1.0.1 (UnxUtils) and 1.0.5 (Cygwin) WinRAR 3.90 7-Zip 4.65 (7za.exe) I've attempted to use WinRAR and 7-Zip options for splitting into multiple segments. 7za.exe has worked well for me for database backups on another server, which has ~50 GB backups. I've also tried splitting the .BAK file first with various utilities and compressing the resulting segments. No joy with that approach either- no matter the tool I've tried, it ends up butting against the size of the file. Especially frustrating is that I've transferred files of similar size on Unix boxes without problems using rsync+ssh. Installing an SSH server is not an option for the situation I'm in, unfortunately. For example, this is how 7-Zip dies: H:\dbatmp>7za.exe a -t7z -v250m -mx3 h:\dbatmp\zip\db-20100419_1228.7z h:\dbatmp\db-20100419_1228.bak 7-Zip (A) 4.65 Copyright (c) 1999-2009 Igor Pavlov 2009-02-03 Scanning Creating archive h:\dbatmp\zip\db-20100419_1228.7z Compressing db-20100419_1228.bak System error: Unspecified error

    Read the article

  • MonoTouch - foreach vs for loops (performance)

    - by ifwdev
    Normally I'm well aware that a consideration like this is premature optimization. Right now I have some event handlers being attached inside a foreach loop. I am wondering if this style might be prone to leaks or inefficient memory use due to closures being created. Is there any validity to this thinking?

    Read the article

  • Missing drive space in Server 2003

    - by Tim Brigham
    I have two drives used for SQL backups which for the last week have been acting strange - the free space indicated by windows is far off from what windirstat, etc indicates. There should only be about 60 GB of drive space used and there is about 160. This would match the utilization if the two last backup files were still residing on disk. SQL server is 2000, OS Server 2003 x64. Running on a VMware 5.0 cluster. OSSEC and McAfee for this system shows clean. My current plan is to temporarily attach one of these drives this drive to another VM for analysis. Is there anything more I should be looking at? There were a lot of pages on the net when I was looking for documentation on this issue but I haven't found this case described. EDIT: Unfortunately even a full reboot did not clear this behavior. I also used process explorer to look for open file handles. No dice.

    Read the article

  • Horrible eclipse performance on macbook pro running 10.5.8

    - by user246114
    Hi I am using eclipse galileo on my macbook pro. After a few minutes it starts dragging really badly, like it takes 8 seconds to open a file. I don't have many files open at all. I already modified the config file to increase ram and all that stuff. Is there something wrong with this version of eclipse, never had it run so poorly on here, Thanks

    Read the article

  • Horrible eclipse performance on macbook pro running 10.5.8

    - by user246114
    Hi I am using eclipse galileo on my macbook pro. After a few minutes it starts dragging really badly, like it takes 8 seconds to open a file. I don't have many files open at all. I already modified the config file to increase ram and all that stuff. Is there something wrong with this version of eclipse, never had it run so poorly on here, Thanks

    Read the article

  • Performance issues with testing on an ADP2

    - by Stuart
    I have an Android Developer Phone with Android 1.6 installed, sometimes it will take 30 seconds for the home screen to appear after a call or exiting from an application. Why is my phone so slow? Should I replace the memory card? Also, when is the 2.0 coming out for the ADP2? How do I install it?

    Read the article

  • Are Dynamic Prepared Statements Bad? (with php + mysqli)

    - by John
    I like the flexibility of Dynamic SQL and I like the security + improved performance of Prepared Statements. So what I really want is Dynamic Prepared Statements, which is troublesome to make because bind_param and bind_result accept "fixed" number of arguments. So I made use of an eval() statement to get around this problem. But I get the feeling this is a bad idea. Here's example code of what I mean // array of WHERE conditions $param = array('customer_id'=>1, 'qty'=>'2'); $stmt = $mysqli->stmt_init(); $types = ''; $bindParam = array(); $where = ''; $count = 0; // build the dynamic sql and param bind conditions foreach($param as $key=>$val) { $types .= 'i'; $bindParam[] = '$p'.$count.'=$param["'.$key.'"]'; $where .= "$key = ? AND "; $count++; } // prepare the query -- SELECT * FROM t1 WHERE customer_id = ? AND qty = ? $sql = "SELECT * FROM t1 WHERE ".substr($where, 0, strlen($where)-4); $stmt->prepare($sql); // assemble the bind_param command $command = '$stmt->bind_param($types, '.implode(', ', $bindParam).');'; // evaluate the command -- $stmt->bind_param($types,$p0=$param["customer_id"],$p1=$param["qty"]); eval($command); Is that last eval() statement a bad idea? I tried to avoid code injection by encapsulating values behind the variable name $param. Does anyone have an opinion or other suggestions? Are there issues I need to be aware of?

    Read the article

  • Vb.exe performance time

    - by vinodacharyabva
    Hi I am running a vb.exe through automation. In exe I have return a code which takes a data from database and saves that data into file. I ran that .exe for the first time. It took 1 mins. For testing baseline I called same .exe 5 times one after the other. But it took nearly 10 mins to generate. My question is if it takes 1 min for 1 report to generate then it should take 5 mins to generate 5 report but why it is taking 10 mins (more than the double). Is there any problem while calling a exe one after the other?

    Read the article

  • TransactionScope and Transactions

    - by Mike
    In my C# code I am using TransactionScope because I was told not to rely that my sql programmers will always use transactions and we are responsible and yada yada. Having said that It looks like TransactionScope object Rolls back before the SqlTransaction? Is that possible and if so what is the correct methodology for wrapping a TransactionScope in a transaction. Here is the sql test CREATE PROC ThrowError AS BEGIN TRANSACTION --SqlTransaction SELECT 1/0 IF @@ERROR<> 0 BEGIN ROLLBACK TRANSACTION --SqlTransaction RETURN -1 END ELSE BEGIN COMMIT TRANSACTION --SqlTransaction RETURN 0 END go DECLARE @RESULT INT EXEC @RESULT = ThrowError SELECT @RESULT And if I run this I get just the divide by 0 and return -1 Call from the C# code I get an extra error message Divide by zero error encountered. Transaction count after EXECUTE indicates that a COMMIT or ROLLBACK TRANSACTION tatement is missing. Previous count = 1, current count = 0. If I give the sql transaction a name then Cannot roll back SqlTransaction. No transaction or savepoint of that name was found. Transaction count after EXECUTE indicates that a COMMIT or ROLLBACK TRANSACTION statement is missing. Previous count = 1, current count = 2. some times it seems the count goes up, until the app completely exits The c# is just using (TransactionScope scope = new TransactionScope()) { ... Execute Sql scope.Commit() }

    Read the article

  • optimizing any OS for maximum informix client/server performance

    - by Frank Developer
    Is there any Informix documentation for optimizing any operating system where an ifx engine is running? For example, in Linux, strip-down to a bare minimum all unnecessary binaries, daemons, utilities, tune kernel parameters, optimize raw and cooked devices (hdparm), place swap space on beginning tracks of a disk, etc. Someday, maybe, Informix can create its own proprietary and dedicated PICK-like O/S to provide the most optimized environment for a standalone ifx server? The general idea is for the OS where ifx sits on have the smallest footprint and lowest overhead impact.

    Read the article

  • vectorizing loops in Matlab - performance issues

    - by Gacek
    This question is related to these two: http://stackoverflow.com/questions/2867901/introduction-to-vectorizing-in-matlab-any-good-tutorials http://stackoverflow.com/questions/2561617/filter-that-uses-elements-from-two-arrays-at-the-same-time Basing on the tutorials I read, I was trying to vectorize some procedure that takes really a lot of time. I've rewritten this: function B = bfltGray(A,w,sigma_r) dim = size(A); B = zeros(dim); for i = 1:dim(1) for j = 1:dim(2) % Extract local region. iMin = max(i-w,1); iMax = min(i+w,dim(1)); jMin = max(j-w,1); jMax = min(j+w,dim(2)); I = A(iMin:iMax,jMin:jMax); % Compute Gaussian intensity weights. F = exp(-0.5*(abs(I-A(i,j))/sigma_r).^2); B(i,j) = sum(F(:).*I(:))/sum(F(:)); end end into this: function B = rngVect(A, w, sigma) W = 2*w+1; I = padarray(A, [w,w],'symmetric'); I = im2col(I, [W,W]); H = exp(-0.5*(abs(I-repmat(A(:)', size(I,1),1))/sigma).^2); B = reshape(sum(H.*I,1)./sum(H,1), size(A, 1), []); But this version seems to be as slow as the first one, but in addition it uses a lot of memory and sometimes causes memory problems. I suppose I've made something wrong. Probably some logic mistake regarding vectorizing. Well, in fact I'm not surprised - this method creates really big matrices and probably the computations are proportionally longer. I have also tried to write it using nlfilter (similar to the second solution given by Jonas) but it seems to be hard since I use Matlab 6.5 (R13) (there are no sophisticated function handles available). So once again, I'm asking not for ready solution, but for some ideas that would help me to solve this in reasonable time. Maybe you will point me what I did wrong.

    Read the article

  • Which are the RDBMS that minimize the server roundtrips? Which RDBMS are better (in this area) than

    - by user193655
    When the latency is high ("when pinging the server takes time") the server roundtrips make the difference. Now I don't want to focus on the roundtrips created in programming, but the roundtrips that occur "under the hood" in the DB engine, so the roundtrips that are 100% dependant on how the RDBMS is written itself. I have been told that FireBird has more roundtrips than MySQL. But this is the only information I know. I am currently supporting MS SQL but I'd like to change RDBMS (because I use Express Editions and in my scenario they are quite limiting from the performance point of view), so to make a wise choice I would like to include also this point into "my RDBMS comparison feature matrix" to understand which is the best RDBMS to choose as an alternative to MS SQL. So the bold sentence above would make me prefer MySQL to Firebird (for the roundtrips concept, not in general), but can anyone add informations? And MS SQL where is it located? Is someone able to "rank" the roundtrip performance of the main RDBMS, or at least: MS SQL, MySql, Postegresql, Firebird (I am not interested in Oracle since it is not free, and if I have to change I would change to a free RDBMS). Anyway MySql (as mentioned several times on stackoverflow) has a not clear future and a not 100% free license. So my final choice will probably dall on PostgreSQL or Firebird. Additional info: somehow you can answer my question by making a simple list like: MSSQL:3; MySQL:1; Firebird:2; Postgresql:2 (where 1 is good, 2 average, 3 bad). Of course if you can post some links where the roundtrips per RDBMSs are compared it would be great

    Read the article

  • Improve performance of sorting files by extension

    - by DxCK
    With a given array of file names, the most simpliest way to sort it by file extension is like this: Array.Sort(fileNames, (x, y) => Path.GetExtension(x).CompareTo(Path.GetExtension(y))); The problem is that on very long list (~800k) it takes very long to sort, while sorting by the whole file name is faster for a couple of seconds! Theoretical, there is a way to optimize it: instead of using Path.GetExtension() and compare the newly created extension-only-strings, we can provide a Comparison than compares starting from the LastIndexOf('.') without creating new strings. Now, suppose i found the LastIndexOf('.'), i want to reuse native .NET's StringComparer and apply it only to the part on string after the LastIndexOf('.'). Didn't found a way to do that. Any ideas?

    Read the article

  • Converting ntext to nvcharmax(max) - Getting around size limitation

    - by Overflew
    Hi all, I'm trying to change an existing SQL NText column to nvcharmax(max), and encountering an error on the size limit. There's a large amount of existing data, some of which is more than the 8k limit, I believe. We're looking to convert this, so that the field is searchable in LINQ. The 2x SQL statements I've tried are: update Table set dataNVarChar = convert(nvarchar(max), dataNtext) where dataNtext is not null update Table set dataNVarChar = cast(dataNtext as nvarchar(max)) where dataNtext is not null And the error I get is: Cannot create a row of size 8086 which is greater than the allowable maximum row size of 8060. This is using SQL Server 2008. Any help appreciated, Thanks. Update / Solution: The marked answer below is correct, and SQL 2008 can change the column to the correct data type in my situation, and there are no dramas with the LINQ-utilising application we use on top of it: alter table [TBL] alter column [COL] nvarchar(max) I've also been advised to follow it up with: update [TBL] set [COL] = [COL] Which completes the conversion by moving the data from the lob structure to the table (if the length in less than 8k), which improves performance / keeps things proper.

    Read the article

  • Perfectly reproducable select statement default ordering issue....

    - by Dave
    Hi, I've recently been chasing an issue with a client's db... solution found, but impossible to recreate. Essentially, we're doing a Select * from mytable where ArbitraryColumn = 75 Where MyTable has an Identity column, called 'MyIndentityColumn' - incremented by one in each insert. Naturally, and normally I would assume that the order returned would be the order in which they are inserted (bad assumption, but one which was forced onto me, through an inherited application - which has been patched). Essentially, I would like suggestions as to why the database, when restored to my local machine (same OS, same SQL server version - 200 sp3) same collation, and same backup instance restored on it, as a test DB on the client site. When I perform the above select, I get them in order of insert (i.e. identity column ordered ascending). On the client, it seems random (but the same 'random' order each time)... A few other points: I have the same collation on my test server as client Same DB backup restored to a test only I can access Same SQL server version and service pack Same OS Test DB is a new DB - new log and MDF... I have the problem 'solved' by adding an explicit order by clause but I want to undertand the cause of the issue, given the exact nature of my attempts to recreate it beuing futile, and perfectly recreatable on the client server... Thanks in advance, Dave

    Read the article

  • real time stock quotes, StreamReader performance optimization

    - by sean717
    I am working on a program that extracts real time quote for 900+ stocks from a website. I use HttpWebRequest to send HTTP request to the site and store the response to a stream and open a stream using the following code: HttpWebResponse response = (HttpWebResponse)request.GetResponse(); Stream stream = response.GetResponseStream (); StreamReader reader = new StreamReader( stream ) the size of the received HTML is large (5000+ lines), so it takes a long time to parse it and extract the price. For 900 files, It takes about 6 mins for parsing and extracting. Which my boss isn't happy with, he told me he'd want the whole process to be done in TWO mins. I've identified the part of the program that takes most of time to finish is parsing and extracting. I've tried to optimize the code to make it faster, the following is what I have now after some optimization: // skip lines at the top for(int i=0;i<1500;++i) reader.ReadLine(); // read the line that contains the price string theLine = reader.ReadLine(); // ... extract the price from the line now it takes about 4 mins to process all the files, there is still a significant gap to what my boss's expecting. So I am wondering, is there other way that I can further speed up the parsing and extracting and have everything done within 2 mins?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • JavaScript tags, performance and W3C

    - by Thomas
    Today I was looking for website optimization content and I found an article talking about move JavaScript scripts to the bottom of the HTML page. Is this valid with W3C's recommendations? I learned that all JavaScript must be inside of head tag... Thank you.

    Read the article

  • Mysql regexp performance question

    - by Tim
    Rumour has it that this; SELECT * FROM lineage_string where lineage like '%179%' and lineage regexp '(^|/)179(/|$)' Would be faster than this; SELECT * FROM lineage_string where lineage regexp '(^|/)179(/|$)' Can anyone confirm ? Or know a decent way to test the speed of such queries. Thanks

    Read the article

  • list or container O(1)-ish insertion/deletion performance, with array semantics

    - by Chris Kaminski
    I'm looking for a collection that offers list semantics, but also allows array semantics. Say I have a list with the following items: apple orange carrot pear then my container array would: container[0] == apple container[1] == orangle container[2] == carrot Then say I delete the orange element: container[0] == apple container[1] == carrot I don't particularly care if sort order is maintained, I'd just like the array values to function as accelerators to the list items, and I want to collapse gaps in the array without having to do an explicit resizing.

    Read the article

  • Stopping cookies being set from a domain (aka "cookieless domain") to increase site performance

    - by Django Reinhardt
    I was reading in Google's documentation about improving site speed. One of their recommendations is serving static content (images, css, js, etc.) from a "cookieless domain": Static content, such as images, JS and CSS files, don't need to be accompanied by cookies, as there is no user interaction with these resources. You can decrease request latency by serving static resources from a domain that doesn't serve cookies. Google then says that the best way to do this is to buy a new domain and set it to point to your current one: To reserve a cookieless domain for serving static content, register a new domain name and configure your DNS database with a CNAME record that points the new domain to your existing domain A record. Configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain. In your web pages, reference the domain name in the URLs for the static resources. This is pretty straight forward stuff, except for the bit where it says to "configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain". From what I've read, there's no setting in IIS that allows you to say "serve static resources", so how do I prevent ASP.NET from setting cookies on this new domain? At present, even if I'm just requesting a .jpg from the new domain, it sets a cookie on my browser, even though our application's cookies are set to our old domain. For example, ASP.NET sets an ".ASPXANONYMOUS" cookie that (as far as I'm aware) we're not telling it to do. Apologies if this is a real newb question, I'm new at this! Thanks.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 583 584 585 586 587 588 589 590 591 592 593 594  | Next Page >