Search Results

Search found 37647 results on 1506 pages for 'sql performance'.

Page 588/1506 | < Previous Page | 584 585 586 587 588 589 590 591 592 593 594 595  | Next Page >

  • How to test my GAE site for performance

    - by Sergey Basharov
    I am building a GAE site that uses AJAX/JSON for almost all its tasks including building the UI elements, all interactions and client-server requests. What is a good way to test it for highloads so that I could have some statistics about how much resources 1000 average users per some period of time would take. I think I can create some Python functions for this purpose. What can you advise? Thanks.

    Read the article

  • Full-text search locks up database - error 0x8001010e

    - by Stewart May
    Hi We have a full-text catalog that is populated via a job every 15 minutes like so: ALTER FULLTEXT INDEX ON [dbo].[WorkItemLongTexts] START INCREMENTAL POPULATION We have encountered a problem where the database containing this catalog locks up. There are a couple of scenarios, we either see the job execute and the process hang with with a wait type of UNKNOWN TOKEN, or we see another process hang with a wait type of MSSEARCH. Once this happens the job continues to run but informs us that the request to start a full-text index population is ignored because a population is currently active. Looking in the full text log files we see the following error each time these problems occur: 2010-04-21 08:15:00.76 spid21s The full-text catalog health monitor reported a failure for full-text catalog "XXXFullTextCatalog" (5) in database "YYY" (14). Reason code: 0. Error: 0x8001010e(The application called an interface that was marshalled for a different thread.). The system will restart any in-progress population from the previous checkpoint. If this message occurs frequently, consult SQL Server Books Online for troubleshooting assistance. This is an informational message only. No user action is required."'' The only solution is to restart the SQL Server service and then the full text service. This is now occuring on a daily basis now so any help would be appreciated.

    Read the article

  • Problem running “Central Administration” website after windows update at Windows 2003 Server Standar

    - by Magdy Roshdy
    I was have WSS 2.0 and then I upgraded to WSS 3.0 and the old instalation database was SQL 2000, now I have another SQL Server instance called:server_name\MICROSOFT##SSEE . After upgrade every thing works fine and our team started to use the portal and we sent lot of documents and make lot of activities on it. The problem started after installing Windows updates the website suddenly stopped and giving me an error "Cannot connect to the configuration database" If I tried to open SharePoint Products and Technologies Configuration Wizard it is gives me a strange error says: "An exception of type Microsoft.SharePoint.PostSetupConfiguration.PostSetupConfigurationTaskException was thrown. Additional exception information: SharePoint Products and Technologies cannot be configured. The current installation mode does not support SKU to SKU upgrades because there exists an older version of Windows SharePoint Services that must be upgraded first " At this post:http://stackoverflow.com/questions/114398/iis-error-cannot-connect-to-the-configuration-database/249494#249494 the guy of the second answer have the same problem and he suggested a solution but I don't understand well. I tried as he suggested to make the identity of the app pool of the SharePoint web site as "IWAM_server_name " after that the error changed as he said and I web site give me "Server Application Unavailable " and when checked the Event Viewer at the server I found that ASP.NET 2.0 give this exception: "Could not load file or assembly 'System.Web, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b03f5f7f11d50a3a' or one of its dependencies. Access is denied ." and I don't know how to solve this problem. I'm really want to make my web site working because our team really need these documents and its stuff. I hope I will find some one to help me.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Performance implications of finalizers on JVM

    - by Alexey Romanov
    According to this post, in .Net, Finalizers are actually even worse than that. Besides that they run late (which is indeed a serious problem for many kinds of resources), they are also less powerful because they can only perform a subset of the operations allowed in a destructor (e.g., a finalizer cannot reliably use other objects, whereas a destructor can), and even when writing in that subset finalizers are extremely difficult to write correctly. And collecting finalizable objects is expensive: Each finalizable object, and the potentially huge graph of objects reachable from it, is promoted to the next GC generation, which makes it more expensive to collect by some large multiple. Does this also apply to JVMs in general and to HotSpot in particular?

    Read the article

  • Does a Postgresql dump create sequences that start with - or after - the last key?

    - by bennylope
    I recently created a SQL dump of a database behind a Django project, and after cleaning the SQL up a little bit was able to restore the DB and all of the data. The problem was the sequences were all mucked up. I tried adding a new user and generated the Python error IntegrityError: duplicate key violates unique constraint. Naturally I figured my SQL dump didn't restart the sequence. But it did: DROP SEQUENCE "auth_user_id_seq" CASCADE; CREATE SEQUENCE "auth_user_id_seq" INCREMENT 1 START 446 MAXVALUE 9223372036854775807 MINVALUE 1 CACHE 1; ALTER TABLE "auth_user_id_seq" OWNER TO "db_user"; I figured out that a repeated attempt at creating a user (or any new row in any table with existing data and such a sequence) allowed for successful object/row creation. That solved the pressing problem. But given that the last user ID in that table was 446 - the same start value in the sequence creation above - it looks like Postgresql was simply trying to start creating rows with that key. Does the SQL dump provide the wrong start key by 1? Or should I invoke some other command to start sequences after the given start ID? Keenly curious.

    Read the article

  • Entity Sql Group By problem, please help

    - by Zviadi
    Hello, help me please with this simple E-sql query: var qStr = "SELECT SqlServer.Month(o.DatePaid) as month, SqlServer.Sum(o.PaidMoney) as PaidMoney FROM XACCModel.OrdersIncomes as o group by SqlServer.Month(o.DatePaid)"; heres what I have. I have simple Entity called OrdersIncomes with ID,PaidMoney,DatePaid,Order_ID properties I want to select Month and Summed PaidMoney like this: month Paidmoney 1 500 2 700 3 1200 T-SQL looks like this and works fine: select MONTH(o.DatePaid), SUM(o.PaidMoney) from OrdersIncomes as o group by MONTH(o.DatePaid) results: 3 31.0000 4 127.0000 5 20.0000 (3 row(s) affected) but E-SQL doesnot work and I dont know what to do. here my E-SQL which needs refactoring: var qStr = "SELECT SqlServer.Month(o.DatePaid) as month, SqlServer.Sum(o.PaidMoney) as PaidMoney FROM XACCModel.OrdersIncomes as o group by SqlServer.Month(o.DatePaid)"; theres exception: ErrorDescription = "The identifier 'o' is not valid because it is not contained either in an aggregate function or in the GROUP BY clause." if I include o in group by clause, like: FROM XACCModel.OrdersIncomes as o group by o then I dont get summed and agregated results. is this some bug? or what Im doing wrong. heres Linq to Entities query and it works too: var incomeResult = from ic in _context.OrdersIncomes group ic by ic.DatePaid.Month into gr select new { Month = gr.Key, PaidMoney = gr.Sum(i = i.PaidMoney) };

    Read the article

  • Performance improvement of client server system

    - by Tanuj
    I have a legacy client server system where the server maintains a record of some data stored in a sqlite database. The data is related to monitoring access patterns of files stored on the server. The client application is basically a remote viewer of the data. When the client is launched, it connects to the server and gets the data from the server to display in a grid view. The data gets updated in real time on the server and the view in the client automatically gets refreshed. There are two problems with the current implementation: When the database gets too big, it takes a lot of time to load the client. What are the best ways to deal with this. One option is to maintain a cache at the client side. How to best implement a cache ? How can the server maintain a diff so that it only sends the diff during the refresh cycle. There can be multiple clients and each client needs to display the latest data available on the server. The server is a windows service daemon. Both the client and the server are implemented in C#

    Read the article

  • querying huge database table takes too much of time in mysql

    - by Vijay
    Hi all, I am running sql queries on a mysql db table that has 110Mn+ unique records for whole day. Problem: Whenever I run any query with "where" clause it takes at least 30-40 mins. Since I want to generate most of data on the next day, I need access to whole db table. Could you please guide me to optimize / restructure the deployment model? Site description: mysql Ver 14.12 Distrib 5.0.24, for pc-linux-gnu (i686) using readline 5.0 4 GB RAM, Dual Core dual CPU 3GHz RHEL 3 my.cnf contents : [root@reports root]# cat /etc/my.cnf [mysqld] datadir=/data/mysql/data/ socket=/tmp/mysql.sock sort_buffer_size = 2000000 table_cache = 1024 key_buffer = 128M myisam_sort_buffer_size = 64M # Default to using old password format for compatibility with mysql 3.x # clients (those using the mysqlclient10 compatibility package). old_passwords=1 [mysql.server] user=mysql basedir=/data/mysql/data/ [mysqld_safe] err-log=/data/mysql/data/mysqld.log pid-file=/data/mysql/data/mysqld.pid [root@reports root]# DB table details: CREATE TABLE `RAW_LOG_20100504` ( `DT` date default NULL, `GATEWAY` varchar(15) default NULL, `USER` bigint(12) default NULL, `CACHE` varchar(12) default NULL, `TIMESTAMP` varchar(30) default NULL, `URL` varchar(60) default NULL, `VERSION` varchar(6) default NULL, `PROTOCOL` varchar(6) default NULL, `WEB_STATUS` int(5) default NULL, `BYTES_RETURNED` int(10) default NULL, `RTT` int(5) default NULL, `UA` varchar(100) default NULL, `REQ_SIZE` int(6) default NULL, `CONTENT_TYPE` varchar(50) default NULL, `CUST_TYPE` int(1) default NULL, `DEL_STATUS_DEVICE` int(1) default NULL, `IP` varchar(16) default NULL, `CP_FLAG` int(1) default NULL, `USER_LOCATE` bigint(15) default NULL ) ENGINE=MyISAM DEFAULT CHARSET=latin1 MAX_ROWS=200000000; Thanks in advance! Regards,

    Read the article

  • UITableView performance degrading after adding subviews on cell iphone sdk

    - by neha
    Hi all, In my application, I'm adding a label and two buttons on cell of UItableView [I have not created a separate cell class]. I'm adding these to cell and not cell.contentview. After I run my application on IPhone, the tableview cell rendering after I move the cells up-down, is very jerky. Is it because I'm not adding the views on cell.contentView or because I've not created a custom class for cell? Can anybody please help? Thanks in advance.

    Read the article

  • How to set up a load/stress test for a web site?

    - by Ryan
    I've been tasked with stress/load testing our company web site out of the blue and know nothing about doing so. Every search I make on google for "how to load test a web site" just comes back with various companies and software to physically do the load testing. For now I'm more interested in how to actually go about setting up a load test like what I should take into account prior to load testing, what pages within my site I should be testing load against and what things I'm going to want to monitor when doing the test. Our web site is on a multi-tier system complete with a separate database server (IIS 7 Web Server, SQL Server 2000 db). I imagine I'd want to monitor both the web server and the database server for testing load however when setting up scenarios to load test the web server I'd have to use pages that query the database to see any load on the database server at the same time. Are web servers and database servers generally tested simultaneously or are they done as separate tests? As you can see I'm pretty clueless as to the whole operation so any incite as to how to go about this would be very helpful. FYI I have been tinkering with Pylot and was able to create and run a scenario against our site but I'm not sure what I should be looking for in the results or if the scenario I created is even a scenario worth measuring for our site. Thanks in advance.

    Read the article

  • Help with interesting VS2010 and SQL2008 bug

    - by user355770
    Hey So im using Visual Studio 2010 to create a webpage. im calling some tabels from sql server 2008 here is where im confused... The code runs fine no errors. The pages works except im missing my rows in my 3rd column from the table. Everything else shows up. Ive checked to make sure the names are matching everywhere and that in sql the joins and such worked. Its just very weird that i'd be missing my 2 rows from the 3rd column. anyone have any ideas to help?? the error is in the tab called research material else if (tabTagId == "tpArlington_ProjectInformation") { repArlington_ProjectInformation.DataSource = ds; repArlington_ProjectInformation.DataBind(); } else if (tabTagId == "tpArlington_Plan") { repArlington_Plan.DataSource = ds; repArlington_Plan.DataBind(); } else if (tabTagId == "tpArlington_ResearchMaterial") { repArlington_ResearchMaterial.DataSource = ds; repArlington_ResearchMaterial.DataBind(); } else if (Session["projectAbbreviation"].ToString() == "ARLING") { tpArlington_ProjectInformation.HeaderText = "Project Information"; tpArlington_ProjectInformation.Visible = true; tpArlington_Plan.HeaderText = "Plan"; tpArlington_Plan.Visible = true; tpArlington_ResearchMaterial.HeaderText = "ResearchMaterial"; tpArlington_ResearchMaterial.Visible = true; getTabData("tpArlington_ProjectInformation"); getTabData("tpArlington_Plan"); getTabData("tpArlington_ReasearchMaterial"); } the 2 other tabs work perfect. the research material is where the problem is. the stuff in the tab doesn't come up. the text in the tab DOES come up but not the stuff from sql. the stuff in sql looks good, the ids match and everything is joined properly otherwise the other 2 tabs wouldnt work. that is what is confusing me. any suggestions or specific info you need just ask. thanks!

    Read the article

  • LINQ to Entites - Left Outer Join - SQL 2000

    - by user255234
    Hi! I'm using Linq to Entities. I have the following query in my code, it includes left outer Join: var surgeonList = (from item in context.T1_STM_Surgeon.Include("T1_STM_SurgeonTitle") .Include("OTER").Include("OSLP") join reptable in context.OSLP on item.Rep equals reptable.SlpCode into surgRepresentative where item.ID == surgeonId select new { ID = item.ID, First = item.First, Last = item.Last, Rep = (surgRepresentative.FirstOrDefault() != null) ? surgRepresentative.FirstOrDefault().SlpName : "N/A", Reg = item.OTER.descript, PrimClinic = item.T1_STM_ClinicalCenter.Name, Titles = item.T1_STM_SurgeonTitle, Phone = item.Phone, Email = item.Email, Address1 = item.Address1, Address2 = item.Address2, City = item.City, State = item.State, Zip = item.Zip, Comments = item.Comments, Active = item.Active, DateEntered = item.DateEntered }) .ToList(); My DEV server has SQL 2008, so the code works just fine. When I moved this code to client's production server - they use SQL 2000, I started getting "Incorrect syntax near '(' ". I've tried changing the ProviderManifestToken to 2000 in my .edmx file, then I started getting "The execution of this query requires the APPLY operator, which is not supported in versions of SQL Server earlier than SQL Server 2005." I tied changing the token to 2005, the "Incorrect syntax near '(' " is back. Can anybody help me to find a workaround for this? Thank you very much in advance!

    Read the article

  • Ant build script executing <sql> task using java code

    - by Jay
    Any idea, why none of the debugging comments are printed once after executing the ANT build script's SQL task via java code? The java class to execute the sql in build scirpt is public class AntRunnerTest { private Project project; public void executeTask(String taskName) { try { project = new Project(); project.init(); project.setBasedir(new String(".")); ProjectHelper helper = ProjectHelper.getProjectHelper(); project.addReference("ant.projectHelper", helper); helper.parse(project, new File("build-copy.xml")); System.out.println("Before"); project.executeTarget(taskName); System.out.println("After"); } catch(Exception ex) { System.out.println(ex.getMessage()); } } public static void main(String args[]) { try { AntRunnerTest newInst = new AntRunnerTest(); newInst.executeTask("sql"); } catch(Exception e) { System.out.println(""+e); } } } I dont see the debug String "After" getting printed in the console. I noticed this issue only when i try to execute a sql task using java code. The ant script has the following simple transaction tag in it. <transaction> <![CDATA[ select now() ]]> </transaction> Any thoughts? Thanks in advance.

    Read the article

  • Performance problems when loading local JSON via <script> elements in IE8

    - by Jens Bannmann
    I have a web page with some JS scripts that needs to work locally, e.g. from hard disk or a CD-ROM. The scripts load JSON data from files by inserting <script> tags. This worked fine in IE6, but now in IE8 it takes an enormous amount of time: it went from "instantly" to 3-10 seconds. The main data file is 45KB large. How can I solve this? I would switch from <script> tags to another method of loading JSON (ideally involving the new native JSON parser), but it seems locally loaded content cannot access the XMLHttpRequest object. Any ideas?

    Read the article

  • Dynamically generating high performance functions in clojure

    - by mikera
    I'm trying to use Clojure to dynamically generate functions that can be applied to large volumes of data - i.e. a requirement is that the functions be compiled to bytecode in order to execute fast, but their specification is not known until run time. e.g. suppose I specify functions with a simple DSL like: (def my-spec [:add [:multiply 2 :param0] 3]) I would like to create a function compile-spec such that: (compile-spec my-spec) Would return a compiled function of one parameter x that returns 2x+3. What is the best way to do this in Clojure?

    Read the article

  • How large is the performance loss for a 64-bit VirtualBox guest running on a 32-bit host?

    - by IllvilJa
    I have a 64-bit Virtualbox guest running Gentoo Linux (amd64) and it is currently hosted on a 32-bit Gentoo laptop. I've noticed that the performance of the VM is very slow compared to the performance of the 32-bit host itself. Also when I compare with another 32-bit Linux VM running on the same host, performance is significantly less on the 64-bit VM. I know that running a 64-bit VM on a 32-bit host does incur some performance penalties for the VM, but does anyone have any deeper knowledge of how large a penalty one might expect in this scenario, roughly speaking? Is a 10% slowdown something to expect, or should it be a slowdown in the 90% range (running at 1/10 the normal speed)? Or to phrase it in another way: would it be reasonable to expect that the performance improvement for the 64-bit VM increases so much that it is worth reinstalling the host machine to run 64-bit Gentoo instead? I'm currently seriously considering that upgrade, but am curious about other peoples experience of the current scenario. I am aware that the host OS will require more RAM when running in 64-bit, but that's OK for me. Also, I do know that one usually don't run a 64-bit VM on a 32-bit server (I'm surprised I even got the VM started in the first place) but things turned out that way when I tried to future proof the VM I was setting up and decided to make it 64-bit anyway.

    Read the article

  • Help Optimizing MySQL Table (~ 500,000 records) and PHP Code.

    - by Pyrite
    I have a MySQL table that collects player data from various game servers (Urban Terror). The bot that collects the data runs 24/7, and currently the table is up to about 475,000+ records. Because of this, querying this table from PHP has become quite slow. I wonder what I can do on the database side of things to make it as optomized as possible, then I can focus on the application to query the database. The table is as follows: CREATE TABLE IF NOT EXISTS `people` ( `id` bigint(20) unsigned NOT NULL AUTO_INCREMENT, `name` varchar(40) NOT NULL, `ip` int(4) unsigned NOT NULL, `guid` varchar(32) NOT NULL, `server` int(4) unsigned NOT NULL, `date` int(11) NOT NULL, PRIMARY KEY (`id`), UNIQUE KEY `Person` (`name`,`ip`,`guid`), KEY `server` (`server`), KEY `date` (`date`), KEY `PlayerName` (`name`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 COMMENT='People that Play on Servers' AUTO_INCREMENT=475843 ; I'm storying the IPv4 (ip and server) as 4 byte integers, and using the MySQL functions NTOA(), etc to encode and decode, I heard that this way is faster, rather than varchar(15). The guid is a md5sum, 32 char hex. Date is stored as unix timestamp. I have a unique key on name, ip and guid, as to avoid duplicates of the same player. Do I have my keys setup right? Is the way I'm storing data efficient? Here is the code to query this table. You search for a name, ip, or guid, and it grabs the results of the query and cross references other records that match the name, ip, or guid from the results of the first query, and does it for each field. This is kind of hard to explain. But basically, if I search for one player by name, I'll see every other name he has used, every IP he has used and every GUID he has used. <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> Search: <input type="text" name="query" id="query" /><input type="submit" name="btnSubmit" value="Submit" /> </form> <?php if (!empty($_POST['query'])) { ?> <table cellspacing="1" id="1up_people" class="tablesorter" width="300"> <thead> <tr> <th>ID</th> <th>Player Name</th> <th>Player IP</th> <th>Player GUID</th> <th>Server</th> <th>Date</th> </tr> </thead> <tbody> <?php function super_unique($array) { $result = array_map("unserialize", array_unique(array_map("serialize", $array))); foreach ($result as $key => $value) { if ( is_array($value) ) { $result[$key] = super_unique($value); } } return $result; } if (!empty($_POST['query'])) { $query = trim($_POST['query']); $count = 0; $people = array(); $link = mysql_connect('localhost', 'mysqluser', 'yea right!'); if (!$link) { die('Could not connect: ' . mysql_error()); } mysql_select_db("1up"); $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (name LIKE \"%$query%\" OR INET_NTOA(ip) LIKE \"%$query%\" OR guid LIKE \"%$query%\")"; $result = mysql_query($sql, $link); if (!$result) { die(mysql_error()); } // Now take the initial results and parse each column into its own array while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } // now for each name, ip, guid in results, find additonal records $people2 = array(); foreach ($people AS $person) { $ip = $person['ip']; $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (ip = \"$ip\")"; $result = mysql_query($sql, $link); while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people2[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } } $people3 = array(); foreach ($people AS $person) { $guid = $person['guid']; $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (guid = \"$guid\")"; $result = mysql_query($sql, $link); while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people3[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } } $people4 = array(); foreach ($people AS $person) { $name = $person['name']; $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (name = \"$name\")"; $result = mysql_query($sql, $link); while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people4[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } } // Combine people and people2 into just people $people = array_merge($people, $people2); $people = array_merge($people, $people3); $people = array_merge($people, $people4); $people = super_unique($people); foreach ($people AS $person) { $date = ($person['date']) ? date("M d, Y", $person['date']) : 'Before 8/1/10'; echo "<tr>\n"; echo "<td>".$person['id']."</td>"; echo "<td>".$person['name']."</td>"; echo "<td>".$person['ip']."</td>"; echo "<td>".$person['guid']."</td>"; echo "<td>".$person['server']."</td>"; echo "<td>".$date."</td>"; echo "</tr>\n"; $count++; } // Find Total Records //$result = mysql_query("SELECT id FROM 1up_people", $link); //$total = mysql_num_rows($result); mysql_close($link); } ?> </tbody> </table> <p> <?php echo $count." Records Found for \"".$_POST['query']."\" out of $total"; ?> </p> <?php } $time_stop = microtime(true); print("Done (ran for ".round($time_stop-$time_start)." seconds)."); ?> Any help at all is appreciated! Thank you.

    Read the article

  • glibc regexp performance

    - by Jack
    Anyone has experience measuring glibc regexp functions? Are there any generic tests I need to run to make such a measurements (in addition to testing the exact patterns I intend to search)? Thanks.

    Read the article

< Previous Page | 584 585 586 587 588 589 590 591 592 593 594 595  | Next Page >