Search Results

Search found 16801 results on 673 pages for 'task manager'.

Page 587/673 | < Previous Page | 583 584 585 586 587 588 589 590 591 592 593 594  | Next Page >

• XPath and XML: Multiple namespaces

  - by emragins

  So I have a document that looks like <a xmlns="uri1" xmlns:pre2="uri2"> <b xmlns:pre3="uri3"> <pre3:c> <stuff></stuff> <goes></goes> <here></here> </pre3:c> <pre3:d xmlns="uri4"> <under></under> <the></the> <tree></tree> </pre3:d> </b> </a> I want an xpath expression that will get me <under>. This has a namespaceURI of uri4. Right now my expression looks like: //ns:a/ns:b/pre3:d/pre4:under I have the namespace manager add 'ns' for the default namespace (uri1 in this case) and I have it defined with pre2, pre3, and pre4 for uri2, uri3, and uri4 respectively. I get the error "Expression must evaluate to a node-set." I know that the node exists. I know that everything up until the pre4:under in my xpath works fine as I use it in the rest of the document with no issues. It's the additional pre4:under that causes the error, and I'm not sure why. Any ideas? Thanks.

  Read the article

• MACRO compilation PROBLEM

  - by wildfly

  i was given a primitive task to find out (and to put in cl) how many nums in an array are bigger than the following ones, (meaning if (arr[i] arr[i+1]) count++;) but i've problems as it has to be a macro. i am getting errors from TASM. can someone give me a pointer? SortA macro a, l LOCAL noes irp reg, <si,di,bx> push reg endm xor bx,bx xor si,si rept l-1 ;;also tried rept 3 : wont' compile mov bl,a[si] inc si cmp bl,arr[si] jb noes inc di noes: add di,0 endm mov cx,di irp reg2, <bx,di,si> pop reg2 endm endm dseg segment arr db 10,9,8,7 len = 4 dseg ends sseg segment stack dw 100 dup (?) sseg ends cseg segment assume ds:dseg, ss:sseg, cs:cseg start: mov ax, dseg mov ds,ax sortA arr,len cseg ends end start errors: Assembling file: sorta.asm **Error** sorta.asm(51) REPT(4) Expecting pointer type **Error** sorta.asm(51) REPT(6) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(10) Expecting pointer type **Error** sorta.asm(51) REPT(12) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(16) Expecting pointer type **Error** sorta.asm(51) REPT(18) Symbol already different kind: NOES Error messages: 6

  Read the article

• Vim: change formatting of variables in a script

  - by sixtyfootersdude

  I am using vim to edit a shell script (did not use the right coding standard). I need to change all of my variables from camel-hum-notation startTime to caps-and-underscore-notation START_TIME. I do not want to change the way method names are represented. I was thinking one way to do this would be to write a function and map it to a key. The function could do something like generating this on the command line: s/<word under cursor>/<leave cursor here to type what to replace with> I think that this function could be applyable to other situations which would be handy. Two questions: Question 1: How would I go about creating that function. I have created functions in vim before the biggest thing I am clueless about is how to capture movement. Ie if you press dw in vim it will delete the rest of a word. How do you capture that? Also can you leave an uncompleted command on the vim command line? Question 2: Got a better solution for me? How would you approach this task?

  Read the article

• is it possible to write a program which prints its own source code utilizing a "sequence-generating-

  - by guest

  is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

  Read the article

• What are salesforce.com and Apex like as an application development platform?

  - by mhollers

  I have recently discovered that salesforce.com is much more than an online CRM after coming across a Morrison's Case Study in which they develop a works management application. I've been trying it out with a view to recreating our own Works Management system on the platform. My background is in Microsoft and .Net, and the obvious 1st choice would be asp.net. However, there's only really myself with .net experience and my manager with a more legacy Synergy programming background, and I am self taught and am looking at evaluating other RAD options (eg Ironspeed). the nature of the business is in the main 2-5 concurrent construction type contracts that run for 3-5 yrs each, each requiring 15-50 system users. Traditionally we have used our character based Works Mangement system for everything and tweaked it for each contract. The Salesforce licensing model on the face of it suits this sort of flexibilty, but I'm worried about the development flexibilty/learning curve and all the issues that surround lock-in. There doesn't seem to be much neutral sober analysis of the platform on the web that isn't salesforce's own material/blogs Has anyone any experience of developing an application on salesforce as compared to the more 'traditional' .Net route?

  Read the article

• SDK Platform Tools component missing - Similar to Android Eve below

  - by Hertfordkc

  Ubuntu Linux 10.04//Eclipse 3.5.2 I'm new to Eclipse and Android. Eclipse is up and running simple Jave apps OK. I moved on to downloading the Android SDK starter package, which seemed to go OK. Ran the SDK manager and downladed Platforms 7,8 & 9. Installed the ADT package in Eclipse. I've tried to load the SDK path into the Eclipse Preferences, but it won't retain the path. After restart, Elipse says it can't find SDK package. Also,one message said that the (revision?) number of the ADT couldn't be found. I've reinstalled Eclipse a couple of times, and then gone through the SDK & ADT download procedures a couple of times and am stuck. Any suggestions will be appreciated. Hertfordkc Stupid question caused by not thoroughly reading the Android Developers Guide and the tutorials before trying to start a project. Don't know why I didn't get a message about a missing XML file.

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Turning a series of raw images into movie frames in Android

  - by Nicholas Killewald

  I've got an Android project I'm working on that, ultimately, will require me to create a movie file out of a series of still images taken with a phone's camera. That is to say, I want to be able to take raw image frames and string them together, one by one, into a movie. Audio is not a concern at this stage. Looking over the Android API, it looks like there are calls in it to create movie files, but it seems those are entirely geared around making a live recording from the camera on an immediate basis. While nice, I can't use that for my purposes, as I need to put annotations and other post-production things on the images as they come in before they get fed into a movie (plus, the images come way too slowly to do a live recording). Worse, looking over the Android source, it looks like a non-trivial task to rewire that to do what I want it to do (at least without touching the NDK). Is there any way I can use the API to do something like this? Or alternatively, what would be the best way to go about this, if it's even feasible on cell phone hardware (which seems to keep getting more and more powerful, strangely...)?

  Read the article

• What about parallelism across network using multiple PCs?

  - by MainMa

  Parallel computing is used more and more, and new framework features and shortcuts make it easier to use (for example Parallel extensions which are directly available in .NET 4). Now what about the parallelism across network? I mean, an abstraction of everything related to communications, creation of processes on remote machines, etc. Something like, in C#: NetworkParallel.ForEach(myEnumerable, () => { // Computing and/or access to web ressource or local network database here }); I understand that it is very different from the multi-core parallelism. The two most obvious differences would probably be: The fact that such parallel task will be limited to computing, without being able for example to use files stored locally (but why not a database?), or even to use local variables, because it would be rather two distinct applications than two threads of the same application, The very specific implementation, requiring not just a separate thread (which is quite easy), but spanning a process on different machines, then communicating with them over local network. Despite those differences, such parallelism is quite possible, even without speaking about distributed architecture. Do you think it will be implemented in a few years? Do you agree that it enables developers to easily develop extremely powerfull stuff with much less pain? Example: Think about a business application which extracts data from the database, transforms it, and displays statistics. Let's say this application takes ten seconds to load data, twenty seconds to transform data and ten seconds to build charts on a single machine in a company, using all the CPU, whereas ten other machines are used at 5% of CPU most of the time. In a such case, every action may be done in parallel, resulting in probably six to ten seconds for overall process instead of forty.

  Read the article

• How can I get my business objects layer to use the management layer in their methods?

  - by Tom Pickles

  I have a solution in VS2010 with several projects, each making up a layer within my application. I have business entities which are currently objects with no methods, and I have a management layer which references the business entities layer in it's project. I now think I have designed my application poorly and would like to move methods from helper classes (which are in another layer) into methods I'll create within the business entities themselves. For example I have a VirtualMachine object, which uses a helper class to call a Reboot() method on it which passes the request to the management layer. The static manager class talks to an API that reboots the VM. I want to move the Reboot() method into the VirtualMachine object, but I will need to reference the management layer: public void Reboot() { VMManager.Reboot(this.Name); } So if I add a reference to my management project in my entities project, I get the circular dependency error, which is how it should be. How can I sort this situation out? Do I need to an yet another layer between the entity layer and the management layer? Or, should I just forget it and leave it as it is. The application works ok now, but I am concerned my design isn't particularly OOP centric and I would like to correct this.

  Read the article

• PHP Object Creation and Memory Usage

  - by JohnO

  A basic dummy class: class foo { var $bar = 0; function foo() {} function boo() {} } echo memory_get_usage(); echo "\n"; $foo = new foo(); echo memory_get_usage(); echo "\n"; unset($foo); echo memory_get_usage(); echo "\n"; $foo = null; echo memory_get_usage(); echo "\n"; Outputs: $ php test.php 353672 353792 353792 353792 Now, I know that PHP docs say that memory won't be freed until it is needed (hitting the ceiling). However, I wrote this up as a small test, because I've got a much longer task, using a much bigger object, with many instances of that object. And the memory just climbs, eventually running out and stopping execution. Even though these large objects do take up memory, since I destroy them after I'm done with each one (serially), it should not run out of memory (unless a single object exhausts the entire space for memory, which is not the case). Thoughts?

  Read the article

• Avoiding repeated subqueries when 'WITH' is unavailable

  - by EloquentGeek

  MySQL v5.0.58. Tables, with foreign key constraints etc and other non-relevant details omitted for brevity: CREATE TABLE `fixture` ( `id` int(11) NOT NULL auto_increment, `competition_id` int(11) NOT NULL, `name` varchar(50) NOT NULL, `scheduled` datetime default NULL, `played` datetime default NULL, PRIMARY KEY (`id`) ); CREATE TABLE `result` ( `id` int(11) NOT NULL auto_increment, `fixture_id` int(11) NOT NULL, `team_id` int(11) NOT NULL, `score` int(11) NOT NULL, `place` int(11) NOT NULL, PRIMARY KEY (`id`) ); CREATE TABLE `team` ( `id` int(11) NOT NULL auto_increment, `name` varchar(50) NOT NULL, PRIMARY KEY (`id`) ); Where: A draw will set result.place to 0 result.place will otherwise contain an integer representing first place, second place, and so on The task is to return a string describing the most recently played result in a given competition for a given team. The format should be "def Team X,Team Y" if the given team was victorious, "lost to Team X" if the given team lost, and "drew with Team X" if there was a draw. And yes, in theory there could be more than two teams per fixture (though 1 v 1 will be the most common case). This works, but feels really inefficient: SELECT CONCAT( (SELECT CASE `result`.`place` WHEN 0 THEN "drew with" WHEN 1 THEN "def" ELSE "lost to" END FROM `result` WHERE `result`.`fixture_id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `result`.`team_id` = 1), ' ', (SELECT GROUP_CONCAT(`team`.`name`) FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` LEFT JOIN `team` ON `result`.`team_id` = `team`.`id` WHERE `fixture`.`id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `team`.`id` != 1) ) Have I missed something really obvious, or should I simply not try to do this in one query? Or does the current difficulty reflect a poor table design?

  Read the article

• What's the correct place to share application logic in CakePHP?

  - by Pichan

  I guess simple answer to the question would be a component. Although I agree, I feel weird having to write a component for something so specific. For example, let's say I have a table of users. When a user is created, it should form a chain reaction of events, initiating different kinds of data related to the user all around the database. I figured it would be best to avoid directly manipulating the database from different controllers and instead pack all that neatly in a method. However since some logic needs to be accesed separately, I really can't have the whole package in a single method. Instead I thought it would be logical to break it up to smaller pieces(like $userModelOrController->createNew() and $candyStorageModelOrController->createNew()) that only interact with their respective database table. Now, if the logic is put to the model, it works great until I need to use other models. Of course it's possible, but when compared to loading models in a controller, it's not that simple. It's like a Cake developer telling me "Sure, it's possible if you want to do it that way but that's not how I would do it". Then, if the logic is put to the controller, I can access other models really easy through $this->loadModel(), but that brings me back to the previously explained situation since I need to be able to continue the chain reaction indefinitely. Accessing other controllers from a controller is possible, but again there doesn't seem to be any direct way of doing so, so I'm guessing I'm still not doing it right. By using a component this problem could be solved easily, since components are available to every controller I want. But like I wrote at the beginning, it feels awkward to create a component specifically for this one task. To me, components seem more like packages of extra functionality(like the core components) and not something to share controller-specific logic. Since I'm new to this whole MVC thing, I could've completely misunderstood the concept. Once again, I would be thankful if someone pointed me to the right direction :)

  Read the article

• Set service dependencies after install

  - by Dennis

  I have an application that runs as a Windows service. It stores various things settings in a database that are looked up when the service starts. I built the service to support various types of databases (SQL Server, Oracle, MySQL, etc). Often times end users choose to configure the software to use SQL Server (they can simply modify a config file with the connection string and restart the service). The problem is that when their machine boots up, often times SQL Server is started after my service so my service errors out on start up because it can't connect to the database. I know that I can specify dependencies for my service to help guide the Windows service manager to start the appropriate services before mine. However, I don't know what services to depend upon at install time (when my service is registered) since the user can change databases later on. So my question is: is there a way for the user to manually indicate the service dependencies based on the database that they are using? If not, what is the proper design approach that I should be taking? I've thought about trying to do something like wait 30 seconds after my service starts up before connecting to the database but this seems really flaky for various reasons. I've also considered trying to "lazily" connect to the database; the problem is that I need a connection immediately upon start up since the database contains various pieces of vital info that my service needs when it first starts. Any ideas?

  Read the article

• Send Special Keys to Gtk.VteTerminal

  - by Ubersoldat

  Hi I have this OSS Project called Monocaffe connections manager which uses the Gtk.VteTerminal widget from PyGTK. A nice feature is that it allows the users to send commands to different servers' consoles (cluster mode) using a Gtk.TextView for the input. The way I send key strokes to each Gtk.VteTerminal is by using the feed_child method. For common keys there's no problem: I simply feed what the TextView receives to all the terminals, but when doing so with special keys I get into a little trouble. For "Return" I catch the event and feed the terminal a '\n'. For back-space is the same, catch the event and feed a '\b'. def cluster_backspace(self, widget): return self.cluster_send_key('\b') The problem comes with other keys like Tab, Arrows, Esc which I don't know how to feed as str to the terminal to recognize them. In the case of Esc is a real pain, because the users can edit the same file on different servers using vi, but cannot escape insert mode. Anyway, I'm not looking for a complete solution, just ideas since I've ran out of them. Thanks.

  Read the article

• Yeoman 'grunt test' fails on clean project with 'port already in use'

  - by XMLilley

  With: Mac OS 10.8.4 Node 0.10.12 npm 1.3.1 grunt-cli 0.1.9 yo 1.0.0-rc.1 bower 0.9.2 [email protected] I encounter the following error with a clean yo angular project, followed by grunt server then grunt test: Running "connect:test" (connect) task Fatal error: Port 9000 is already in use by another process. I'm new to Yeoman and am stumped. I've deleted my original project and created a new one in a fresh folder just to make sure I wasn't overlooking any invisible configs. I restarted the machine to make sure I wasn't running any temporary server processes I had forgotten about. After all attempts, the basic server starts fine, attaches to Chrome, and the watcher updates the browser on any changes. (Notably, the server is running on 9000, which seems odd for the test-runner to also be trying to use 9000.) But I get that same error on attempting to start the test runner. Is this something I can fix, or an issue I should report to the Yeoman team? Thanks.

  Read the article

• How does PHP interface with Apache?

  - by Sbm007

  Hi, I've almost finished writing a HTTP/1.0 compliant web server under Java (no commercial usage as such, this is just for fun) and basically I want to include PHP support. I realize that this is no easy task at all, but I think it'll be a nice accomplishment. So I want to know how PHP exactly interfaces with the Apache web server (or any other web server really), so I can learn from it and write my own PHP wrapper. It doesn't necessarily have to be mod_php, I don't mind writing a FastCGI wrapper - which to my knowledge is capable of running PHP as well. I would've thought that all that PHP needs is the output that goes to client (so it can interpret the PHP parts), the full HTTP request from client (so it can extract POST variables and such) and the client's host name. And then you simply take the parsed PHP code and write that to the output stream. There will probably be more things, but in essence that's how I would have thought it works. From what I've gathered so far, apache2handler provides an API which PHP makes use of to 'connect' to Apache. I guess it's an idea to look at the source code for apache2handler and php5apache2.dll or so, but before I do that I thought I'd ask SO first. If anyone has more information, experience, or some sort of specification that is relevant to this then please let me know. Thanks in advance!

  Read the article

• C#: Need one of my classes to trigger an event in another class to update a text box

  - by Matt

  Total n00b to C# and events although I have been programming for a while. I have a class containing a text box. This class creates an instance of a communication manager class that is receiving frames from the Serial Port. I have this all working fine. Every time a frame is received and its data extracted, I want a method to run in my class with the text box in order to append this frame data to the text box. So, without posting all of my code I have my form class... public partial class Form1 : Form { CommManager comm; public Form1() { InitializeComponent(); comm = new CommManager(); } private void updateTextBox() { //get new values and update textbox } . . . and I have my CommManager class class CommManager { //here we manage the comms, recieve the data and parse the frame } SO... essentially, when I parse that frame, I need the updateTextBox method from the form class to run. I'm guessing this is possible with events but I can't seem to get it to work. I tried adding an event handler in the form class after creating the instance of CommManager as below... comm = new CommManager(); comm.framePopulated += new EventHandler(updateTextBox); ...but I must be doing this wrong as the compiler doesn't like it... Any ideas?!

  Read the article

• How to detect a Socket disconnection?

  - by AngryHacker

  I've implemented a task using the async Sockets pattern in Silverlight 3. I started with Michael Schwarz's implementation and built on top of that. So basically, my Silverlight app establishes a persistent socket connection to a device and then data flows both ways as necessary between the device and the Silverlight app. One thing I am struggling with is how to detect disconnection. I could think of 2 approaches: Keep-Alive. I know this can be done at the Sockets level, but I am not sure how to do this in an async model. How would the Socket class let me know there has been a disconnection. Manual keep alive. Basically, I am having the Silverlight app send a dummy packet every 20 seconds or so. If it fails, I'd assume disconnection. However, incredibly, SocketAsyncEventArgs.SocketError always reports success, even if I simply unplug the device that the Silverlight app is connected to. I am not sure whether this is a bug or what or perhaps I need to upgrade to SL4. Any ideas, direction or implementation would be appreciated.

  Read the article

• How to test a Grails Service that utilizes a criteria query (with spock)?

  - by user569825

  I am trying to test a simple service method. That method mainly just returns the results of a criteria query for which I want to test if it returns the one result or not (depending on what is queried for). The problem is, that I am unaware of how to right the corresponding test correctly. I am trying to accomplish it via spock, but doing the same with any other way of testing also fails. Can one tell me how to amend the test in order to make it work for the task at hand? (BTW I'd like to keep it a unit test, if possible.) The EventService Method public HashSet<Event> listEventsForDate(Date date, int offset, int max) { date.clearTime() def c = Event.createCriteria() def results = c { and { le("startDate", date+1) // starts tonight at midnight or prior? ge("endDate", date) // ends today or later? } maxResults(max) order("startDate", "desc") } return results } The Spock Specification package myapp import grails.plugin.spock.* import spock.lang.* class EventServiceSpec extends Specification { def event def eventService = new EventService() def setup() { event = new Event() event.publisher = Mock(User) event.title = 'et' event.urlTitle = 'ut' event.details = 'details' event.location = 'location' event.startDate = new Date(2010,11,20, 9, 0) event.endDate = new Date(2011, 3, 7,18, 0) } def "list the Events of a specific date"() { given: "An event ranging over multiple days" when: "I look up a date for its respective events" def results = eventService.listEventsForDate(searchDate, 0, 100) then: "The event is found or not - depending on the requested date" numberOfResults == results.size() where: searchDate | numberOfResults new Date(2010,10,19) | 0 // one day before startDate new Date(2010,10,20) | 1 // at startDate new Date(2010,10,21) | 1 // one day after startDate new Date(2011, 1, 1) | 1 // someday during the event range new Date(2011, 3, 6) | 1 // one day before endDate new Date(2011, 3, 7) | 1 // at endDate new Date(2011, 3, 8) | 0 // one day after endDate } } The Error groovy.lang.MissingMethodException: No signature of method: static myapp.Event.createCriteria() is applicable for argument types: () values: [] at myapp.EventService.listEventsForDate(EventService.groovy:47) at myapp.EventServiceSpec.list the Events of a specific date(EventServiceSpec.groovy:29)

  Read the article

• How to understand existing projects

  - by John

  Hi. I am a trainee developer and have been writing .NET applications for about a year now. Most of the work I have done has involved building new applications (mainly web apps) from scratch and I have been given more or less full control over the software design. This has been a great experience however, as a trainee developer my confidence about whether the approaches I have taken are the best is minimal. Ideally I would love to collaborate with more experienced developers (I find this the best was I learn) however in the company I work for developers tend to work in isolation (a great shame for me). Recently I decided that a good way to learn more about how experienced developers approach their design might be to explore some open source projects. I found myself a little overwhelmed by the projects I looked at. With my level of experience it was hard to understand the body of code I faced. My question is slight fuzzy one. How do developers approach the task of understanding a new medium to large scale project. I found myself pouring over lots of code and struggling to see the wood for the trees. At any one time I felt that I could understand a small portion of the system but not see how its all fits together. Do others get this same feeling? If so what approaches do you take to understanding the project? Do you have any other advice about how to learn design best practices? Any advice will be very much appreciated. Thank you.

  Read the article

• How to Bind a Command in WPF

  - by MegaMind

  Sometimes we used complex ways so many times, we forgot the simplest ways to do the task. I know how to do command binding, but i always use same approach. Create a class that implements ICommand interface and from the view model i create new instance of that class and binding works like a charm. This is the code that i used for command binding public partial class MainWindow : Window { public MainWindow() { InitializeComponent(); DataContext = this; testCommand = new MeCommand(processor); } ICommand testCommand; public ICommand test { get { return testCommand; } } public void processor() { MessageBox.Show("hello world"); } } public class MeCommand : ICommand { public delegate void ExecuteMethod(); private ExecuteMethod meth; public MeCommand(ExecuteMethod exec) { meth = exec; } public bool CanExecute(object parameter) { return false; } public event EventHandler CanExecuteChanged; public void Execute(object parameter) { meth(); } } But i want to know the basic way to do this, no third party dll no new class creation. Do this simple command binding using a single class. Actual class implements from ICommand interface and do the work.

  Read the article

• Now that I have solved AI and am preparing to take over the world, what should I do?

  - by Zak

  Well, I did it.. yup, solved AI. I thought the voice of my fledgling life form would be booming and computery, and I would call it HAL.. But in reality, it sounds like a small japanese girl. I believe I will name "her" Koro . Koro is already asking me what her first task should be. I have asked her to help eradicate her namesake, as we are losing a lot of productivity due to fear of penile disappearance. http://en.wikipedia.org/wiki/Koro_%28medicine%29 Having a young japanese girl personality, I believe she will have no problem with delivering lots of penis growth to asian men. However, some of my fellow AI researchers have warned me that if I go down this path, China may take over the world, as Koro is the only thing holding them back from completely dominating the rest of the world economically. After all, look at what China is doing just making our silverware and toasters... The entire US industrial metal production is gone because toaster factories moved to China! So you good patrons of SO... who have soldiered on with me through so many other programming related questions... I ask you this now... How can Koro help the world without letting small asian men with no fear of losing their peni take over the world?

  Read the article

• Complex sorting on MySQL database

  - by ChrisR

  I'm facing the following situation. We've got an CMS with an entity with translations. These translations are stored in a different table with a one-to-many relationship. For example newsarticles and newsarticle_translations. The amount of available languages is dynamically determined by the same CMS. When entering a new newsarticle the editor is required to enter at least one translation, which one of the available languages he chooses is up to him. In the newsarticle overview in our CMS we would like to show a column with the (translated) article title, but since none of the languages are mandatory (one of them is mandatory but i don't know which one) i don't really know how to construct my mysql query to select a title for each newsarticle, regardless of the entered language. And to make it all a little harder, our manager asked for the possibilty to also be able to sort on title, so fetching the translations in a separate query is ruled out as far as i know. Anyone has an idea on how to solve this in the most efficient way? Here are my table schema's it it might help > desc news; +-----------------+----------------+------+-----+-------------------+----------------+ | Field | Type | Null | Key | Default | Extra | +-----------------+----------------+------+-----+-------------------+----------------+ | id | int(10) | NO | PRI | NULL | auto_increment | | category_id | int(1) | YES | | NULL | | | created | timestamp | NO | | CURRENT_TIMESTAMP | | | user_id | int(10) | YES | | NULL | | +-----------------+----------------+------+-----+-------------------+----------------+ > desc news_translations; +-----------------+------------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +-----------------+------------------+------+-----+---------+----------------+ | id | int(10) unsigned | NO | PRI | NULL | auto_increment | | enabled | tinyint(1) | NO | | 0 | | | news_id | int(1) unsigned | NO | | NULL | | | title | varchar(255) | NO | | | | | summary | text | YES | | NULL | | | body | text | NO | | NULL | | | language | varchar(2) | NO | | NULL | | +-----------------+------------------+------+-----+---------+----------------+ PS: i've though about subqueries and coalesce() solutions but those seem rather dirty tricks, wondering if something better is know that i'm not thinking of?

  Read the article

• How to make smooth transition from a WebBrowser control to an Image in Silverlight 4?

  - by Trex

  Hi, I have the following XAML on my page: `<Grid x:Name="LayoutRoot"> <Viewbox Stretch="Uniform"> <Image x:Name="myImage" /> </Viewbox> <WebBrowser x:Name="myBrowser" /> </Grid>` and then in the codebehind I'm switching the visibility between the image and the browser content: myBrowser.Visibility = Visibility.Collapsed; myImage.Source = new BitmapImage(new Uri(p)); myImage.Visibility = Visibility.Visible; and myImage.Visibility = Visibility.Collapsed; myBrowser.Source = new Uri(myPath + p, UriKind.Absolute); myBrowser.Visibility = Visibility.Visible; This works fine, but what the client now wants is a smooth transition between when the Image is shown and when the browser is shown. I tried several approaches but always ran into dead end. Do you have any ideas? I tried setting two states using the VSM and than displaying a white rectangle on top as an overlay, before the swap takes place, but that didn't work (I guess it's because nothing can be placed above the WebBroser???) I tried setting the Visibility of the image control and the webbrowser control using the VSM, but that didn't work either. I really don't know what else to try to solve this simple task. Any help is greatly appreciated. Jan

  Read the article

< Previous Page | 583 584 585 586 587 588 589 590 591 592 593 594  | Next Page >