Search Results

Search found 16801 results on 673 pages for 'task manager'.

Page 587/673 | < Previous Page | 583 584 585 586 587 588 589 590 591 592 593 594  | Next Page >

  • Vim: change formatting of variables in a script

    - by sixtyfootersdude
    I am using vim to edit a shell script (did not use the right coding standard). I need to change all of my variables from camel-hum-notation startTime to caps-and-underscore-notation START_TIME. I do not want to change the way method names are represented. I was thinking one way to do this would be to write a function and map it to a key. The function could do something like generating this on the command line: s/<word under cursor>/<leave cursor here to type what to replace with> I think that this function could be applyable to other situations which would be handy. Two questions: Question 1: How would I go about creating that function. I have created functions in vim before the biggest thing I am clueless about is how to capture movement. Ie if you press dw in vim it will delete the rest of a word. How do you capture that? Also can you leave an uncompleted command on the vim command line? Question 2: Got a better solution for me? How would you approach this task?

    Read the article

  • unexpected behaviour of object stored in web service Session

    - by draconis
    Hi. I'm using Session variables inside a web service to maintain state between successive method calls by an external application called QBWC. I set this up by decorating my web service methods with this attribute: [WebMethod(EnableSession = true)] I'm using the Session variable to store an instance of a custom object called QueueManager. The QueueManager has a property called ChangeQueue which looks like this: [Serializable] public class QueueManager { ... public Queue<QBChange> ChangeQueue { get; set; } ... where QBChange is a custom business object belonging to my web service. Now, every time I get a call to a method in my web service, I use this code to retrieve my QueueManager object and access my queue: QueueManager qm = (QueueManager)Session[ticket]; then I remove an object from the queue, using qm.dequeue() and then I save the modified query manager object (modified because it contains one less object in the queue) back to the Session variable, like so: Session[ticket] = qm; ready for the next web service method call using the same ticket. Now here's the thing: if I comment out this last line //Session[ticket] = qm; , then the web service behaves exactly the same way, reducing the size of the queue between method calls. Now why is that? The web service seems to be updating a class contained in serialized form in a Session variable without being asked to. Why would it do that? When I deserialize my Queuemanager object, does the qm variable hold a reference to the serialized object inside the Session[ticket] variable?? This seems very unlikely.

    Read the article

  • Send Special Keys to Gtk.VteTerminal

    - by Ubersoldat
    Hi I have this OSS Project called Monocaffe connections manager which uses the Gtk.VteTerminal widget from PyGTK. A nice feature is that it allows the users to send commands to different servers' consoles (cluster mode) using a Gtk.TextView for the input. The way I send key strokes to each Gtk.VteTerminal is by using the feed_child method. For common keys there's no problem: I simply feed what the TextView receives to all the terminals, but when doing so with special keys I get into a little trouble. For "Return" I catch the event and feed the terminal a '\n'. For back-space is the same, catch the event and feed a '\b'. def cluster_backspace(self, widget): return self.cluster_send_key('\b') The problem comes with other keys like Tab, Arrows, Esc which I don't know how to feed as str to the terminal to recognize them. In the case of Esc is a real pain, because the users can edit the same file on different servers using vi, but cannot escape insert mode. Anyway, I'm not looking for a complete solution, just ideas since I've ran out of them. Thanks.

    Read the article

  • How to understand existing projects

    - by John
    Hi. I am a trainee developer and have been writing .NET applications for about a year now. Most of the work I have done has involved building new applications (mainly web apps) from scratch and I have been given more or less full control over the software design. This has been a great experience however, as a trainee developer my confidence about whether the approaches I have taken are the best is minimal. Ideally I would love to collaborate with more experienced developers (I find this the best was I learn) however in the company I work for developers tend to work in isolation (a great shame for me). Recently I decided that a good way to learn more about how experienced developers approach their design might be to explore some open source projects. I found myself a little overwhelmed by the projects I looked at. With my level of experience it was hard to understand the body of code I faced. My question is slight fuzzy one. How do developers approach the task of understanding a new medium to large scale project. I found myself pouring over lots of code and struggling to see the wood for the trees. At any one time I felt that I could understand a small portion of the system but not see how its all fits together. Do others get this same feeling? If so what approaches do you take to understanding the project? Do you have any other advice about how to learn design best practices? Any advice will be very much appreciated. Thank you.

    Read the article

  • user interface pattern for associating single or many objects to an entity

    - by Samuel
    Need suggestions on implementing associating single or many objects to an entity. All soccer team players are registered individually (e.g. they are part of 'players' table) A soccer team has many players. The click sequence is like this:- a] Soccer team owner provides a name and brief description of the soccer team. b] Now it wants to add players to this team. c] You have the following button 'Add players to team' which lets you navigate to the 'View Players' page and lets you multi select users from there. Assuming this is a paginated list of players, how do you handle the following:- Do you provide a check box against each player and let the manager do a multi selection. If you need to add more players, it doesn't make sense to show the players who have been already added to the team. Do you mark those entries as not selectable or you would adding showing these entries. If you need to filter, do you provide search filters at the top of this page. Am looking for ideas on how to implement this or sites which have already done something similar.

    Read the article

  • Avoiding repeated subqueries when 'WITH' is unavailable

    - by EloquentGeek
    MySQL v5.0.58. Tables, with foreign key constraints etc and other non-relevant details omitted for brevity: CREATE TABLE `fixture` ( `id` int(11) NOT NULL auto_increment, `competition_id` int(11) NOT NULL, `name` varchar(50) NOT NULL, `scheduled` datetime default NULL, `played` datetime default NULL, PRIMARY KEY (`id`) ); CREATE TABLE `result` ( `id` int(11) NOT NULL auto_increment, `fixture_id` int(11) NOT NULL, `team_id` int(11) NOT NULL, `score` int(11) NOT NULL, `place` int(11) NOT NULL, PRIMARY KEY (`id`) ); CREATE TABLE `team` ( `id` int(11) NOT NULL auto_increment, `name` varchar(50) NOT NULL, PRIMARY KEY (`id`) ); Where: A draw will set result.place to 0 result.place will otherwise contain an integer representing first place, second place, and so on The task is to return a string describing the most recently played result in a given competition for a given team. The format should be "def Team X,Team Y" if the given team was victorious, "lost to Team X" if the given team lost, and "drew with Team X" if there was a draw. And yes, in theory there could be more than two teams per fixture (though 1 v 1 will be the most common case). This works, but feels really inefficient: SELECT CONCAT( (SELECT CASE `result`.`place` WHEN 0 THEN "drew with" WHEN 1 THEN "def" ELSE "lost to" END FROM `result` WHERE `result`.`fixture_id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `result`.`team_id` = 1), ' ', (SELECT GROUP_CONCAT(`team`.`name`) FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` LEFT JOIN `team` ON `result`.`team_id` = `team`.`id` WHERE `fixture`.`id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `team`.`id` != 1) ) Have I missed something really obvious, or should I simply not try to do this in one query? Or does the current difficulty reflect a poor table design?

    Read the article

  • Get top 2 rows from each unique field in a column

    - by Sai
    I have a table named tblItemResources in which I want to get the only 2 rows from each unique field in a column named effectiveDate (order by: ascending): tblItemResources Table |   empID   |   effectiveDate    |    Company   |    Description |   0-123    |    2014-01-23     |   DFD Comp  |   Analyst |   0-234    |    2014-01-23     |   ABC Comp   |  Manager |   0-222    |    2012-02-19     |   CDC Comp  |  Janitor |   0-213    |    2012-03-13     |   CBB Comp  |  Teller and so on. Any help would be much appreciated.

    Read the article

  • Is there a more efficient way to do this?

    - by garethdn
    I'm hoping there is a better way to the following. I'm creating a jigsaw-type application and this is the current code i'm using: -(void) touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [touches anyObject]; //location of current touch CGPoint location = [touch locationInView:self.view]; if ([touch view] == img1) { [self animateFirstTouch:img1 withLocation:location]; } else if ([touch view] == img2) { [self animateFirstTouch:img2 withLocation:location]; } else if ([touch view] == img3) { [self animateFirstTouch:img3 withLocation:location]; } else if ([touch view] == img4) { [self animateFirstTouch:img4 withLocation:location]; } else if { ...... ...... } else if ([touch view] == img40) { [self animateFirstTouch:img40 withLocation:location]; return; } } I'm hoping that there is a better, more efficieny way to do this, rather than naming every image. I'm thinking something like, if touch view is equal to a UIImageView, then perform some task. The same for touchesEnded: -(void) touchesEnded:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [touches anyObject]; //location of current touch CGPoint location = [touch locationInView:self.view]; if ([touch view] == image1) { [self animateReleaseTouch:image1 withLocation:location]; } else if ([touch view] == image2) { [self animateReleaseTouch:image2 withLocation:location]; } else if ([touch view] == image3) { [self animateReleaseTouch:image3 withLocation:location]; } else if ([touch view] == image4) { [self animateReleaseTouch:image4 withLocation:location]; } else if{ ...... ...... } else if ([touch view] == image40) { [self animateReleaseTouch:image40 withLocation:location]; } return; } Any help please?

    Read the article

  • Silverlight Image Data Binding

    - by Alexander
    I am new to Silverlight, and have an issue with binding. I have a class ItemsManager, that has inside its scope another class Item. class ItemsManager { ... class Item : INotifyPropertyChanged { ... private BitmapImage bitmapSource; public BitmapImage BitmapSource { get { return bitmapSource; } set { bitmapSource = value; if(PropertyChanged != null )PropertyChanged("BitmapSource") } } } } I do the following in code to test binding: { ItemsManager.Instance.AddItem("123"); //Items manager started downloading item visual //part (in my case bitmap image png) Binding b = new Binding("Source"); b.Source = ItemsManager.Instance.GetItem("123").BitmapSource; b.BindsDirectlyToSource = true; Image img = new Image(); img.SetBinding(Image.SourceProperty, b); img.Width = (double)100.0; img.Height = (double)100.0; LayoutRoot.Children.Add(img); } Once image is loaded, image doesn't appear. Though, if I set directly after image has been loaded its source, it displays well. I also noticed that PropertyChanged("BitmapSource") never fires, because PropertyChanged is null, like Image never binded to it. I am looking forward to hearing from you!

    Read the article

  • Database choices

    - by flobadob
    I have a prickly design issue regarding the choice of database technologies to use for a group of new applications. The final suite of applications would have the following database requirements... Central databases (more than one database) using mysql (myst be mysql due to justhost.com). An application to be written which accesses the multiple mysql databases on the web host. This application will also write to local serverless database (sqlite/firebird/vistadb/whatever). Different flavors of this application will be created for windows (.NET), windows mobile, android if possible, iphone if possible. So, the design task is to minimise the quantity of code to achieve this. This is going to be tricky since the languages used are already c# / java (android) and objc (iphone). Not too worried about that, but can the work required to implement the various database access layers be minimised? The serverless database will hold similar data to the mysql server, so some kind of inheritance in the DAL would be useful. Looking at hibernate/nhibernate and there is linq to whatever. So many choices!

    Read the article

  • How to make smooth transition from a WebBrowser control to an Image in Silverlight 4?

    - by Trex
    Hi, I have the following XAML on my page: `<Grid x:Name="LayoutRoot"> <Viewbox Stretch="Uniform"> <Image x:Name="myImage" /> </Viewbox> <WebBrowser x:Name="myBrowser" /> </Grid>` and then in the codebehind I'm switching the visibility between the image and the browser content: myBrowser.Visibility = Visibility.Collapsed; myImage.Source = new BitmapImage(new Uri(p)); myImage.Visibility = Visibility.Visible; and myImage.Visibility = Visibility.Collapsed; myBrowser.Source = new Uri(myPath + p, UriKind.Absolute); myBrowser.Visibility = Visibility.Visible; This works fine, but what the client now wants is a smooth transition between when the Image is shown and when the browser is shown. I tried several approaches but always ran into dead end. Do you have any ideas? I tried setting two states using the VSM and than displaying a white rectangle on top as an overlay, before the swap takes place, but that didn't work (I guess it's because nothing can be placed above the WebBroser???) I tried setting the Visibility of the image control and the webbrowser control using the VSM, but that didn't work either. I really don't know what else to try to solve this simple task. Any help is greatly appreciated. Jan

    Read the article

  • SQL problem - select accross multiple tables (user groups)

    - by morpheous
    I have a db schema which looks something like this: create table user (id int, name varchar(32)); create table group (id int, name varchar(32)); create table group_member (foobar_id int, user_id int, flag int); I want to write a query that allows me to so the following: Given a valid user id (UID), fetch the ids of all users that are in the same group as the specified user id (UID) AND have group_member.flag=3. Rather than just have the SQL. I want to learn how to think like a Db programmer. As a coder, SQL is my weakest link (since I am far more comfortable with imperative languages than declarative ones) - but I want to change that. Anyway here are the steps I have identified as necessary to break down the task. I would be grateful if some SQL guru can demonstrate the simple SQL statements - i.e. atomic SQL statements, one for each of the identified subtasks below, and then finally, how I can combine those statements to make the ONE statement that implements the required functionality. Here goes (assume specified user_id [UID] = 1): //Subtask #1. Fetch list of all groups of which I am a member Select group.id from user inner join group_member where user.id=group_member.user_id and user.id=1 //Subtask #2 Fetch a list of all members who are members of the groups I am a member of (i.e. groups in subtask #1) Not sure about this ... select user.id from user, group_member gm1, group_member gm2, ... [Stuck] //Subtask #3 Get list of users that satisfy criteria group_member.flag=3 Select user.id from user inner join group_member where user.id=group_member.user_id and user.id=1 and group_member.flag=3 Once I have the SQL for subtask2, I'd then like to see how the complete SQL statement is built from these subtasks (you dont have to use the SQL in the subtask, it just a way of explaining the steps involved - also, my SQL may be incorrect/inefficient, if so, please feel free to correct it, and point out what was wrong with it). Thanks

    Read the article

  • How does PHP interface with Apache?

    - by Sbm007
    Hi, I've almost finished writing a HTTP/1.0 compliant web server under Java (no commercial usage as such, this is just for fun) and basically I want to include PHP support. I realize that this is no easy task at all, but I think it'll be a nice accomplishment. So I want to know how PHP exactly interfaces with the Apache web server (or any other web server really), so I can learn from it and write my own PHP wrapper. It doesn't necessarily have to be mod_php, I don't mind writing a FastCGI wrapper - which to my knowledge is capable of running PHP as well. I would've thought that all that PHP needs is the output that goes to client (so it can interpret the PHP parts), the full HTTP request from client (so it can extract POST variables and such) and the client's host name. And then you simply take the parsed PHP code and write that to the output stream. There will probably be more things, but in essence that's how I would have thought it works. From what I've gathered so far, apache2handler provides an API which PHP makes use of to 'connect' to Apache. I guess it's an idea to look at the source code for apache2handler and php5apache2.dll or so, but before I do that I thought I'd ask SO first. If anyone has more information, experience, or some sort of specification that is relevant to this then please let me know. Thanks in advance!

    Read the article

  • Updating a field in a record dyanamically in extjs

    - by Daemon
    Scenario I want to update the column data of particular record in grid having store with static data. Here is my store: : : extend : 'Ext.data.Store', model : 'MyModel', autoLoad:true, proxy: { type: 'ajax', url:'app/data/data.json', reader: { type: 'json', root: 'users' } }, My data.json { 'users': [ { QMgrStatus:"active", QMgrName: 'R01QN00_LQYV', ChannelStatus:'active', ChannelName : 'LQYV.L.CLNT', MxConn: 50 } ] } What I am doing to update the record : var grid = Ext.getCmp('MyGrid'); var store = Ext.getStore('Mystore'); store.each(function(record,idx){ val = record.get('ChannelName'); if(val == "LQYV.L.CLNT"){ record.set('ChannelStatus','inactive'); record.commit(); } }); console.log(store); grid.getView().refresh(); MY PROBLEM I am getting the record updated over here.It is not getting reflected in my grid panel.The grid is using the same old store(static).Is the problem of static data? Or am I missing something or going somewhere wrong? Please help me out with this issue.Thanks a lot. MY EDIT I am tryng to color code the column based on the status.But here I am always getting the status="active" even though I am updating the store. What I am trying to do in my grid { xtype : 'grid', itemId : 'InterfaceQueueGrid', id :'MyGrid', store : 'Mytore', height : 216, width : 600, columns : [ { text: 'QueueMgr Status', dataIndex: 'QMgrStatus' , width:80 }, { text: 'Queue Manager \n Name', dataIndex: 'QMgrName' , width: 138}, { text: 'Channel Status',dataIndex: 'ChannelStatus' , width: 78,align:'center', renderer: function(value, meta, record) { var val = record.get('ChannelStatus'); console.log(val); // Here I am always getting status="active". if (val == 'inactive') { return '<img src="redIcon.png"/>'; }else if (val == 'active') { return '<img src="greenIcon.png"/>'; } } }, { text: 'Channel Name', align:'center', dataIndex: 'ChannelName', width: 80} { text: 'Max Connections', align:'center', dataIndex: 'MxConn', width: 80} ] }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Problem with ScriptManager when trying to email rendered contents of ASP.NET page

    - by pandojc
    I recently added a Telerik control to an ascx that is included in an aspx page. This page has a "Send email" button, which when clicked will email the user the rendered output of the page. The Telerik control I added requires a ScriptManager, so I added that to the ascx. However, now the email button won't work. I get the following error: The control with ID 'myIdHere' requires a ScriptManager on the page. The ScriptManager must appear before any controls that need it. I know the script manager exists because the page works fine when I go that url, it is only failing when it tries to email the rendered output. Here's a code snippet, any ideas as to whether there is a problem with scriptmanager when doing this sort of thing? Page EmailPage = new EmailBasePage(); System.Web.UI.HtmlControls.HtmlForm EmailForm = new System.Web.UI.HtmlControls.HtmlForm(); EmailPage.Controls.Add(EmailForm); EmailForm.Controls.Add(contentTable); //this is the container with all the controls I want to email StringBuilder SB = new StringBuilder(); StringWriter html = new StringWriter(SB); HtmlTextWriter mhtmlWriter = new HtmlTextWriter(html); EmailPage.DesignerInitialize(); EmailPage.RenderControl(mhtmlWriter); mhtmlWriter.Close();

    Read the article

  • Proper API Design for Version Independence?

    - by Justavian
    I've inherited an enormous .NET solution of about 200 projects. There are now some developers who wish to start adding their own components into our application, which will require that we begin exposing functionality via an API. The major problem with that, of course, is that the solution we've got on our hands contains such a spider web of dependencies that we have to be careful to avoid sabotaging the API every time there's a minor change somewhere in the app. We'd also like to be able to incrementally expose new functionality without destroying any previous third party apps. I have a way to solve this problem, but i'm not sure it's the ideal way - i was looking for other ideas. My plan would be to essentially have three dlls. APIServer_1_0.dll - this would be the dll with all of the dependencies. APIClient_1_0.dll - this would be the dll our developers would actual refer to. No references to any of the mess in our solution. APISupport_1_0.dll - this would contain the interfaces which would allow the client piece to dynamically load the "server" component and perform whatever functions are required. Both of the above dlls would depend upon this. It would be the only dll that the "client" piece refers to. I initially arrived at this design, because the way in which we do inter process communication between windows services is sort of similar (except that the client talks to the server via named pipes, rather than dynamically loading dlls). While i'm fairly certain i can make this work, i'm curious to know if there are better ways to accomplish the same task.

    Read the article

  • How to test a Grails Service that utilizes a criteria query (with spock)?

    - by user569825
    I am trying to test a simple service method. That method mainly just returns the results of a criteria query for which I want to test if it returns the one result or not (depending on what is queried for). The problem is, that I am unaware of how to right the corresponding test correctly. I am trying to accomplish it via spock, but doing the same with any other way of testing also fails. Can one tell me how to amend the test in order to make it work for the task at hand? (BTW I'd like to keep it a unit test, if possible.) The EventService Method public HashSet<Event> listEventsForDate(Date date, int offset, int max) { date.clearTime() def c = Event.createCriteria() def results = c { and { le("startDate", date+1) // starts tonight at midnight or prior? ge("endDate", date) // ends today or later? } maxResults(max) order("startDate", "desc") } return results } The Spock Specification package myapp import grails.plugin.spock.* import spock.lang.* class EventServiceSpec extends Specification { def event def eventService = new EventService() def setup() { event = new Event() event.publisher = Mock(User) event.title = 'et' event.urlTitle = 'ut' event.details = 'details' event.location = 'location' event.startDate = new Date(2010,11,20, 9, 0) event.endDate = new Date(2011, 3, 7,18, 0) } def "list the Events of a specific date"() { given: "An event ranging over multiple days" when: "I look up a date for its respective events" def results = eventService.listEventsForDate(searchDate, 0, 100) then: "The event is found or not - depending on the requested date" numberOfResults == results.size() where: searchDate | numberOfResults new Date(2010,10,19) | 0 // one day before startDate new Date(2010,10,20) | 1 // at startDate new Date(2010,10,21) | 1 // one day after startDate new Date(2011, 1, 1) | 1 // someday during the event range new Date(2011, 3, 6) | 1 // one day before endDate new Date(2011, 3, 7) | 1 // at endDate new Date(2011, 3, 8) | 0 // one day after endDate } } The Error groovy.lang.MissingMethodException: No signature of method: static myapp.Event.createCriteria() is applicable for argument types: () values: [] at myapp.EventService.listEventsForDate(EventService.groovy:47) at myapp.EventServiceSpec.list the Events of a specific date(EventServiceSpec.groovy:29)

    Read the article

  • Get active window title in X

    - by dutt
    I'm trying to get the title of the active window. The application is a background task so if the user has Eclipse open the function returns "Eclipse - blabla", so it's not getting the window title of my own window. I'm developing this in Python 2.6 using PyQt4. My current solution, borrowed and slightly modified from an old answer here at SO, looks like this: def get_active_window_title(): title = '' root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) for j in id_w.stdout: if 'WM_ICON_NAME(STRING)' in j: if title != j.split()[2]: return j.split("= ")[1].strip(' \n\"') It works for most windows, but not all. For example it can't find my kopete chat windows, or the name of the application i'm currently developing. My next try looks like this: def get_active_window_title(self): screen = wnck.screen_get_default() if screen == None: return "Could not get screen" window = screen.get_active_window() if window == None: return "Could not get window" title = window.get_name() return title; But for some reason window is always None. Does somebody have a better way of getting the current window title, or how to modify one of my ways, that works for all windows? Edit: In case anybody is wondering this is the way I found that seems to work for all windows. def get_active_window_title(self): root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) id_w.wait() buff = [] for j in id_w.stdout: buff.append(j) for line in buff: match = re.match("WM_NAME\((?P<type>.+)\) = (?P<name>.+)", line) if match != None: type = match.group("type") if type == "STRING" or type == "COMPOUND_TEXT": return match.group("name") return "Active window not found"

    Read the article

  • What about parallelism across network using multiple PCs?

    - by MainMa
    Parallel computing is used more and more, and new framework features and shortcuts make it easier to use (for example Parallel extensions which are directly available in .NET 4). Now what about the parallelism across network? I mean, an abstraction of everything related to communications, creation of processes on remote machines, etc. Something like, in C#: NetworkParallel.ForEach(myEnumerable, () => { // Computing and/or access to web ressource or local network database here }); I understand that it is very different from the multi-core parallelism. The two most obvious differences would probably be: The fact that such parallel task will be limited to computing, without being able for example to use files stored locally (but why not a database?), or even to use local variables, because it would be rather two distinct applications than two threads of the same application, The very specific implementation, requiring not just a separate thread (which is quite easy), but spanning a process on different machines, then communicating with them over local network. Despite those differences, such parallelism is quite possible, even without speaking about distributed architecture. Do you think it will be implemented in a few years? Do you agree that it enables developers to easily develop extremely powerfull stuff with much less pain? Example: Think about a business application which extracts data from the database, transforms it, and displays statistics. Let's say this application takes ten seconds to load data, twenty seconds to transform data and ten seconds to build charts on a single machine in a company, using all the CPU, whereas ten other machines are used at 5% of CPU most of the time. In a such case, every action may be done in parallel, resulting in probably six to ten seconds for overall process instead of forty.

    Read the article

  • XPath and XML: Multiple namespaces

    - by emragins
    So I have a document that looks like <a xmlns="uri1" xmlns:pre2="uri2"> <b xmlns:pre3="uri3"> <pre3:c> <stuff></stuff> <goes></goes> <here></here> </pre3:c> <pre3:d xmlns="uri4"> <under></under> <the></the> <tree></tree> </pre3:d> </b> </a> I want an xpath expression that will get me <under>. This has a namespaceURI of uri4. Right now my expression looks like: //ns:a/ns:b/pre3:d/pre4:under I have the namespace manager add 'ns' for the default namespace (uri1 in this case) and I have it defined with pre2, pre3, and pre4 for uri2, uri3, and uri4 respectively. I get the error "Expression must evaluate to a node-set." I know that the node exists. I know that everything up until the pre4:under in my xpath works fine as I use it in the rest of the document with no issues. It's the additional pre4:under that causes the error, and I'm not sure why. Any ideas? Thanks.

    Read the article

  • Deployment a web-site on IIS from another program

    - by slo2ols
    Hi, I developed a web-site on ASP.NET 3.5 SP1 platform. And additional I have 2 win services. My task is to build install package. I decided that Visual Studio install projects are not met my requirements. I design my own installer for this project, because I need to resolve many question and problem in install process. My problem: I need to deploy web-site into IIS, but I don't know how to do it easy. I found Microsoft tool as Web Deployment Tool, but I didn't find any documentation. And must I include this tool into my installer for deployment at destination customer? Another side I found SDC Tasks Library and it looks like a solution for me. But I saw many topics where people had problems and because the project was dead anybody couldn't help them. I know it is a long story... My question: how can I deploy the web-site from another program (I know that IIS versions have some differences and it is another headache), set a virtual directory, application pool (very important), a type of authentification and so forth ??? Thanks.

    Read the article

  • Turning a series of raw images into movie frames in Android

    - by Nicholas Killewald
    I've got an Android project I'm working on that, ultimately, will require me to create a movie file out of a series of still images taken with a phone's camera. That is to say, I want to be able to take raw image frames and string them together, one by one, into a movie. Audio is not a concern at this stage. Looking over the Android API, it looks like there are calls in it to create movie files, but it seems those are entirely geared around making a live recording from the camera on an immediate basis. While nice, I can't use that for my purposes, as I need to put annotations and other post-production things on the images as they come in before they get fed into a movie (plus, the images come way too slowly to do a live recording). Worse, looking over the Android source, it looks like a non-trivial task to rewire that to do what I want it to do (at least without touching the NDK). Is there any way I can use the API to do something like this? Or alternatively, what would be the best way to go about this, if it's even feasible on cell phone hardware (which seems to keep getting more and more powerful, strangely...)?

    Read the article

  • How to amend return value design in OO manner?

    - by FrontierPsycho
    Hello. I am no newb on OO programming, but I am faced with a puzzling situation. I have been given a program to work on and extend, but the previous developers didn't seem that comfortable with OO, it seems they either had a C background or an unclear understanding of OO. Now, I don't suggest I am a better developer, I just think that I can spot some common OO errors. The difficult task is how to amend them. In my case, I see a lot of this: if (ret == 1) { out.print("yadda yadda"); } else if (ret == 2) { out.print("yadda yadda"); } else if (ret == 3) { out.print("yadda yadda"); } else if (ret == 0) { out.print("yadda yadda"); } else if (ret == 5) { out.print("yadda yadda"); } else if (ret == 6) { out.print("yadda yadda"); } else if (ret == 7) { out.print("yadda yadda"); } ret is a value returned by a function, in which all Exceptions are swallowed, and in the catch blocks, the above values are returned explicitly. Oftentimes, the Exceptions are simply swallowed, with empty catch blocks. It's obvious that swalllowing exceptions is wrong OO design. My question concerns the use of return values. I believe that too is wrong, however I think that using Exceptions for control flow is equally wrong, and I can't think of anything to replace the above in a correct, OO manner. Your input, please?

    Read the article

  • Visual Studio 2012 won't start

    - by David Aleu
    I installed VS2012 Premium from our MSDN subscription and it was working fine the first couple of days but then I installed a few extensions I can't now start VS2012 and it gives the error: Faulting application name: devenv.exe, version: 11.0.50727.1, time stamp: 0x5011ecaa Faulting module name: ntdll.dll, version: 6.1.7601.17725, time stamp: 0x4ec49b8f Exception code: 0xc0000374 Fault offset: 0x000ce6c3 Faulting process id: 0xee8 Faulting application start time: 0x01cd89bb777fc1dd Faulting application path: C:\Program Files (x86)\Microsoft Visual Studio 11.0\Common7\IDE\devenv.exe Faulting module path: C:\Windows\SysWOW64\ntdll.dll I'm running it on Windows 7 64 bit. I've tried to repair, uninstall and install again and nothing. I tried to restore to a previous restore system point but nothing. The extensions I installed I can remember: VS10x Code Map VSCommands Visual SVN Nuget manager (all the above my colleagues have it too and it works fine for them) and: Web Essentials Visual Studio Color Theme Editor SlowCheetah Mobile Ready HTML5 Questions are: Anyone else has had this problem? Is there a way I can uninstall extensions from a command line or software? (I removed the extensions folder but that doesn't do anything) Can I repair the "C:\Windows\SysWOW64\ntdll.dll"? Is it really a problem with this dll? I haven't been able to find any similar issue in other versions and because VS2012 is new doesn't seem to be much information either.

    Read the article

< Previous Page | 583 584 585 586 587 588 589 590 591 592 593 594  | Next Page >