Search Results

Search found 16801 results on 673 pages for 'task manager'.

Page 589/673 | < Previous Page | 585 586 587 588 589 590 591 592 593 594 595 596  | Next Page >

  • What's the correct place to share application logic in CakePHP?

    - by Pichan
    I guess simple answer to the question would be a component. Although I agree, I feel weird having to write a component for something so specific. For example, let's say I have a table of users. When a user is created, it should form a chain reaction of events, initiating different kinds of data related to the user all around the database. I figured it would be best to avoid directly manipulating the database from different controllers and instead pack all that neatly in a method. However since some logic needs to be accesed separately, I really can't have the whole package in a single method. Instead I thought it would be logical to break it up to smaller pieces(like $userModelOrController->createNew() and $candyStorageModelOrController->createNew()) that only interact with their respective database table. Now, if the logic is put to the model, it works great until I need to use other models. Of course it's possible, but when compared to loading models in a controller, it's not that simple. It's like a Cake developer telling me "Sure, it's possible if you want to do it that way but that's not how I would do it". Then, if the logic is put to the controller, I can access other models really easy through $this->loadModel(), but that brings me back to the previously explained situation since I need to be able to continue the chain reaction indefinitely. Accessing other controllers from a controller is possible, but again there doesn't seem to be any direct way of doing so, so I'm guessing I'm still not doing it right. By using a component this problem could be solved easily, since components are available to every controller I want. But like I wrote at the beginning, it feels awkward to create a component specifically for this one task. To me, components seem more like packages of extra functionality(like the core components) and not something to share controller-specific logic. Since I'm new to this whole MVC thing, I could've completely misunderstood the concept. Once again, I would be thankful if someone pointed me to the right direction :)

    Read the article

  • Any Alternate way for writing to a file other than ofstream

    - by Aditya
    Hi All, I am performing file operations (writeToFile) which fetches the data from a xml and writes into a output file(a1.txt). I am using MS Visual C++ 2008 and in windows XP. currently i am using this method of writing to output file.. 01.ofstreamhdr OutputFile; 02./* few other stmts / 03.hdrOutputFile.open(fileName, std::ios::out); 04. 05.hdrOutputFile << "#include \"commondata.h\""<< endl ; 06.hdrOutputFile << "#include \"Commonconfig.h\"" << endl ; 07.hdrOutputFile << "#include \"commontable.h\"" << endl << endl ; 08. hdrOutputFile << "#pragma pack(push,1)" << endl ; 09.hdrOutputFile << "typedef struct \n {" << endl ; 10./ simliar hdrOutputFiles statements... */.. I have around 250 lines to write.. Is any better way to perform this task. I want to reduce this hdrOutputFile and use a buffer to do this. Please guide me how to do that action. I mean, buff = "#include \"commontable.h\"" + "typedef struct \n {" + ....... hdrOutputFile << buff. is this way possible? Thanks Ramm

    Read the article

  • Avoiding repeated subqueries when 'WITH' is unavailable

    - by EloquentGeek
    MySQL v5.0.58. Tables, with foreign key constraints etc and other non-relevant details omitted for brevity: CREATE TABLE `fixture` ( `id` int(11) NOT NULL auto_increment, `competition_id` int(11) NOT NULL, `name` varchar(50) NOT NULL, `scheduled` datetime default NULL, `played` datetime default NULL, PRIMARY KEY (`id`) ); CREATE TABLE `result` ( `id` int(11) NOT NULL auto_increment, `fixture_id` int(11) NOT NULL, `team_id` int(11) NOT NULL, `score` int(11) NOT NULL, `place` int(11) NOT NULL, PRIMARY KEY (`id`) ); CREATE TABLE `team` ( `id` int(11) NOT NULL auto_increment, `name` varchar(50) NOT NULL, PRIMARY KEY (`id`) ); Where: A draw will set result.place to 0 result.place will otherwise contain an integer representing first place, second place, and so on The task is to return a string describing the most recently played result in a given competition for a given team. The format should be "def Team X,Team Y" if the given team was victorious, "lost to Team X" if the given team lost, and "drew with Team X" if there was a draw. And yes, in theory there could be more than two teams per fixture (though 1 v 1 will be the most common case). This works, but feels really inefficient: SELECT CONCAT( (SELECT CASE `result`.`place` WHEN 0 THEN "drew with" WHEN 1 THEN "def" ELSE "lost to" END FROM `result` WHERE `result`.`fixture_id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `result`.`team_id` = 1), ' ', (SELECT GROUP_CONCAT(`team`.`name`) FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` LEFT JOIN `team` ON `result`.`team_id` = `team`.`id` WHERE `fixture`.`id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `team`.`id` != 1) ) Have I missed something really obvious, or should I simply not try to do this in one query? Or does the current difficulty reflect a poor table design?

    Read the article

  • How does PHP interface with Apache?

    - by Sbm007
    Hi, I've almost finished writing a HTTP/1.0 compliant web server under Java (no commercial usage as such, this is just for fun) and basically I want to include PHP support. I realize that this is no easy task at all, but I think it'll be a nice accomplishment. So I want to know how PHP exactly interfaces with the Apache web server (or any other web server really), so I can learn from it and write my own PHP wrapper. It doesn't necessarily have to be mod_php, I don't mind writing a FastCGI wrapper - which to my knowledge is capable of running PHP as well. I would've thought that all that PHP needs is the output that goes to client (so it can interpret the PHP parts), the full HTTP request from client (so it can extract POST variables and such) and the client's host name. And then you simply take the parsed PHP code and write that to the output stream. There will probably be more things, but in essence that's how I would have thought it works. From what I've gathered so far, apache2handler provides an API which PHP makes use of to 'connect' to Apache. I guess it's an idea to look at the source code for apache2handler and php5apache2.dll or so, but before I do that I thought I'd ask SO first. If anyone has more information, experience, or some sort of specification that is relevant to this then please let me know. Thanks in advance!

    Read the article

  • Problem with ScriptManager when trying to email rendered contents of ASP.NET page

    - by pandojc
    I recently added a Telerik control to an ascx that is included in an aspx page. This page has a "Send email" button, which when clicked will email the user the rendered output of the page. The Telerik control I added requires a ScriptManager, so I added that to the ascx. However, now the email button won't work. I get the following error: The control with ID 'myIdHere' requires a ScriptManager on the page. The ScriptManager must appear before any controls that need it. I know the script manager exists because the page works fine when I go that url, it is only failing when it tries to email the rendered output. Here's a code snippet, any ideas as to whether there is a problem with scriptmanager when doing this sort of thing? Page EmailPage = new EmailBasePage(); System.Web.UI.HtmlControls.HtmlForm EmailForm = new System.Web.UI.HtmlControls.HtmlForm(); EmailPage.Controls.Add(EmailForm); EmailForm.Controls.Add(contentTable); //this is the container with all the controls I want to email StringBuilder SB = new StringBuilder(); StringWriter html = new StringWriter(SB); HtmlTextWriter mhtmlWriter = new HtmlTextWriter(html); EmailPage.DesignerInitialize(); EmailPage.RenderControl(mhtmlWriter); mhtmlWriter.Close();

    Read the article

  • Using custom Qt subclasses in Python

    - by kwatford
    First off: I'm new to both Qt and SWIG. Currently reading documentation for both of these, but this is a time consuming task, so I'm looking for some spoilers. It's good to know up-front whether something just won't work. I'm attempting to formulate a modular architecture for some in-house software. The core components are in C++ and exposed via SWIG to Python for experimentation and rapid prototyping of new components. Qt seems like it has some classes I could use to avoid re-inventing the wheel too much here, but I'm concerned about how some of the bits will fit together. Specifically, if I create some C++ classes, I'll need to expose them via SWIG. Some of these classes likely subclass Qt classes or otherwise have Qt stuff exposed in their public interfaces. This seems like it could raise some complications. There are already two interfaces for Qt in Python, PyQt and PySide. Will probably use PySide for licensing reasons. About how painful should I expect it to be to get a SWIG-wrapped custom subclass of a Qt class to play nice with either of these? What complications should I know about upfront?

    Read the article

  • C++ AMP, for loops to parallel_for_each loop

    - by user1430335
    I'm converting an algorithm to make use of the massive acceleration that C++ AMP provides. The stage I'm at is putting the for loops into the known parallel_for_each loop. Normally this should be a straightforward task to do but it appears more complex then I first thought. It's a nested loop which I increment using steps of 4 per iterations: for(int j = 0; j < height; j += 4, data += width * 4 * 4) { for(int i = 0; i < width; i += 4) { The trouble I'm having is the use of the index. I can't seem to find a way to properly fit this into the parallel_for_each loop. Using an index of rank 2 is the way to go but manipulating it via branching will do harm to the performance gain. I found a similar post: Controlling the index variables in C++ AMP. It also deals about index manipulation but the increment aspect doesn't cover my issue. With kind regards, Forcecast

    Read the article

  • Mono Text Based Web Browser

    - by powerbox
    Hi guys, is there any public text based web browser implementation for C# or on mono base api that I can use to fill up web forms automatically? I'll be using it to automate some web task that does not require any image authentication. I'm currently using a web browser control available on .Net Framework and waits for the event WebBrowserDocumentCompletedEventHandler to fire after a page is successfully loaded and invoke some actions like Submit or simulating a mouse click on some links. It actually does the job but I can't process bulk transactions since I needed to wait for the whole page to be loaded together with the images and other stuff. It is easy to use HttpWebRequest to fill up some forms , provide some data and then submit. But on some occasions I only need to simulate a mouse click to a certain link which I don't know how to do with HttpWebRequest. By the way using HttpWebRequest will still download all the images of a web page that I see pointless since I only need to provide correct data back to the server. I hope someone can pinpoint me the correct way of doing this kind of automation and thanks in advance!

    Read the article

  • Remove php extension from URL on Windows hosting account using web.config

    - by asprin
    I've searched before asking this question. The answered ones were related to Linux hosting account and the ones with Windows hosting account didn't match what I was looking for. As you might have guessed, I've a Windows shared hosting account with godaddy. My aim was to remove the '.php' extension from the url. After researching I found that .htaccess would do exactly what I want. But I also found that .htaccess doesn't work in Windows environment and that I'll need a web.config file to do the same task. Now I know there are modules through which the code can be generated, but the problem is I don't know how to get them installed on my hosting account. I don't want to go through the process of contacting the people over at godaddy and hence I'm looking to solve this on my own. What I'm looking for is a web.config equivalent of .htaccess This is what I'm trying to achieve: Current URL : www.abcdef.com/contact.php Desired URL : www.abcdef.com/contact Any help would be greatly appreciated. Thanks, Nisar.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • File size monitoring in C#

    - by manemawanna
    Hello, I work in the Systems & admin team and have been given the task of creating a quota management application to try and encourage users to better manage there resources as we currently have issues with disc space and don't enforce hard quotas. At the moment I'm using the code below to go through all the files in a users homespace to retrieve the overall amount of space they are using. As from what I've seen else where theres no other way to do this in C#, the issue with it is theirs quite a high overhead while it retireves the size of each file then creates a total. try { long dirSize = 0; FileInfo[] FI = new DirectoryInfo("I:\\").GetFiles("*.*", SearchOption.AllDirectories); foreach (FileInfo F1 in FI) { dirSize += F1.Length; } return dirSize; } So I'm looking for a quicker way to do this or a quick way to monitor changes in the size of files while using the options avaliable through FileSystemWatcher. At the moment the only thing I can think of is creating a hashtable containing the file location and size of each file, so when a size changed event occurs I can compare the old size against the new one and update the total. Any suggestions would be greatly appreciated.

    Read the article

  • crash when using stl vector at instead of operator[]

    - by Jamie Cook
    I have a method as follows (from a class than implements TBB task interface - not currently multithreading though) My problem is that two ways of accessing a vector are causing quite different behaviour - one works and the other causes the entire program to bomb out quite spectacularly (this is a plugin and normally a crash will be caught by the host - but this one takes out the host program as well! As I said quite spectacular) void PtBranchAndBoundIterationOriginRunner::runOrigin(int origin, int time) const // NOTE: const method { BOOST_FOREACH(int accessMode, m_props->GetAccessModes()) { // get a const reference to appropriate vector from member variable // map<int, vector<double>> m_rowTotalsByAccessMode; const vector<double>& rowTotalsForAccessMode = m_rowTotalsByAccessMode.find(accessMode)->second; if (origin != 129) continue; // Additional debug constrain: I know that the vector only has one non-zero element at index 129 m_job->Write("size: " + ToString(rowTotalsForAccessMode.size())); try { // check for early return... i.e. nothing to do for this origin if (!rowTotalsForAccessMode[origin]) continue; // <- this works if (!rowTotalsForAccessMode.at(origin)) continue; // <- this crashes } catch (...) { m_job->Write("Caught an exception"); // but its not an exception } // do some other stuff } } I hate not putting in well defined questions but at the moment my best phrasing is : "WTF?" I'm compiling this with Intel C++ 11.0.074 [IA-32] using Microsoft (R) Visual Studio Version 9.0.21022.8 and my implementation of vector has const_reference operator[](size_type _Pos) const { // subscript nonmutable sequence #if _HAS_ITERATOR_DEBUGGING if (size() <= _Pos) { _DEBUG_ERROR("vector subscript out of range"); _SCL_SECURE_OUT_OF_RANGE; } #endif /* _HAS_ITERATOR_DEBUGGING */ _SCL_SECURE_VALIDATE_RANGE(_Pos < size()); return (*(_Myfirst + _Pos)); } (Iterator debugging is off - I'm pretty sure) and const_reference at(size_type _Pos) const { // subscript nonmutable sequence with checking if (size() <= _Pos) _Xran(); return (*(begin() + _Pos)); } So the only difference I can see is that at calls begin instead of simply using _Myfirst - but how could that possibly be causing such a huge difference in behaviour?

    Read the article

  • Creating Modules for VB Program (Similar to firefox add on)

    - by Assimilater
    Hi all. I have a contact manager program that I'd like to design for multiple network marketing companies. My desired structure would include a core program which covers basic contact management functions. After that one could purchase a module for their specific network marketing company. This module would contain a variety of controls that the original program would need to be able to manipulate. Here is an example of what it would have to have: A group box containing buttons that link to a genealogy view, and the option to import one's donwnline from the back office provided by a company. A panel which is displayed on the contact page allowing the user to input business information or which will be filled by importing a downline from the back office: ie business ID, qualification level, sponsor information etc. a panel displayed when one searches for contacts on the contact list page which allows the user to sort based on information such as when they joined, what their business id is and so forth. a panel which is displayed in a personal business overview page which presents to an individual how many people in their downline are at each qualification level and develop a mailing list for individuals of a certain qualification level. I have the code developed to perform all these functions, I just wanted to give you an example of what needed to be done. I'm thinking that what I'm trying to create is a library that one can download and the program will recognize, but I'm not really sure where to go. What I'm really trying to do is figure out what kind of file I can make that will contain all this code and the GUI information that the program will recognize. Any ideas? With thanks, John

    Read the article

  • Application process never terminates on each run

    - by rockyurock
    I am seeing an application always remains live even after closing the application using my Perl script below. Also, for the subsequent runs, it always says that "The process cannot access the file because it is being used by another process. iperf.exe -u -s -p 5001 successful. Output was:" So every time I have to change the file name $file used in script or I have to kill the iperf.exe process in the Task Manager. Could anybody please let me know the way to get rid of it? Here is the code I am using ... my @command_output; eval { my $file = "abc6.txt"; $command = "iperf.exe -u -s -p 5001"; alarm 10; system("$command > $file"); alarm 0; close $file; }; if ($@) { warn "$command timed out.\n"; } else { print "$command successful. Output was:\n", $file; } unlink $file;

    Read the article

  • Now that I have solved AI and am preparing to take over the world, what should I do?

    - by Zak
    Well, I did it.. yup, solved AI. I thought the voice of my fledgling life form would be booming and computery, and I would call it HAL.. But in reality, it sounds like a small japanese girl. I believe I will name "her" Koro . Koro is already asking me what her first task should be. I have asked her to help eradicate her namesake, as we are losing a lot of productivity due to fear of penile disappearance. http://en.wikipedia.org/wiki/Koro_%28medicine%29 Having a young japanese girl personality, I believe she will have no problem with delivering lots of penis growth to asian men. However, some of my fellow AI researchers have warned me that if I go down this path, China may take over the world, as Koro is the only thing holding them back from completely dominating the rest of the world economically. After all, look at what China is doing just making our silverware and toasters... The entire US industrial metal production is gone because toaster factories moved to China! So you good patrons of SO... who have soldiered on with me through so many other programming related questions... I ask you this now... How can Koro help the world without letting small asian men with no fear of losing their peni take over the world?

    Read the article

  • How to use javascript to get information from the content of another page (same domain)?

    - by hlovdal
    Let's say I have a web page (/index.html) that contains the following <li> <div>item1</div> <a href="/details/item1.html">details</a> </li> and I would like to have some javascript on /index.html to load that /details/item1.html page and extract some information from that page. The page /details/item1.html might contain things like <div id="some_id"> <a href="/images/item1_picture.png">picture</a> <a href="/images/item1_map.png">map</a> </div> My task is to write a greasemonkey script, so changing anything serverside is not an option. To summarize, javascript is running on /index.html and I would like to have the javascript code to add some information on /index.html extracted from both /index.html and /details/item1.html. My question is how to fetch information from /details/item1.html. I currently have written code to extract the link (e.g. /details/item1.html) and pass this on to a method that should extract the wanted information (at first just .innerHTML from the some_id div is ok, I can process futher later). The following is my current attempt, but it does not work. Any suggestions? function get_information(link) { var obj = document.createElement('object'); obj.data = link; document.getElementsByTagName('body')[0].appendChild(obj) var some_id = document.getElementById('some_id'); if (! some_id) { alert("some_id == NULL"); return ""; } return some_id.innerHTML; }

    Read the article

  • Memory mapping of files and system cache behavior in WinXP

    - by Canopus
    Our application is memory intensive and deals with reading a large number of disk files. The total load can be more than 3 GB. There is a custom memory manager that uses memory mapped files to achieve reading of such a huge data. The files are mapped into the process memory space only when needed and with this the process memory is well under control. But what is observed is, with memory mapping, the system cache keeps on increasing until it occupies the available physical memory. This leads to the slowing down of the entire system. My question is how to prevent system cache from hogging the physical memory? I attempted to remove the file buffering (by using FILE_FLAG_NO_BUFFERING ), but with this, the read operations take considerable amount of time and slows down the application performance. How to achieve the scalability without sacrificing much on performance. What are the common techniques used in such cases? I dont have a good understanding of the WinXP OS caching behavior. Any good links explaining the same would also be helpful.

    Read the article

  • Information about PTE's (Page Table Entries) in Windows

    - by Patrick
    In order to find more easily buffer overflows I am changing our custom memory allocator so that it allocates a full 4KB page instead of only the wanted number of bytes. Then I change the page protection and size so that if the caller writes before or after its allocated piece of memory, the application immediately crashes. Problem is that although I have enough memory, the application never starts up completely because it runs out of memory. This has two causes: since every allocation needs 4 KB, we probably reach the 2 GB limit very soon. This problem could be solved if I would make a 64-bit executable (didn't try it yet). even when I only need a few hundreds of megabytes, the allocations fail at a certain moment. The second problem is the biggest one, and I think it's related to the maximum number of PTE's (page table entries, which store information on how Virtual Memory is mapped to physical memory, and whether pages should be read-only or not) you can have in a process. My questions (or a cry-for-tips): Where can I find information about the maximum number of PTE's in a process? Is this different (higher) for 64-bit systems/applications or not? Can the number of PTE's be configured in the application or in Windows? Thanks, Patrick PS. note for those who will try to argument that you shouldn't write your own memory manager: My application is rather specific so I really want full control over memory management (can't give any more details) Last week we had a memory overwrite which we couldn't find using the standard C++ allocator and the debugging functionality of the C/C++ run time (it only said "block corrupt" minutes after the actual corruption") We also tried standard Windows utilities (like GFLAGS, ...) but they slowed down the application by a factor of 100, and couldn't find the exact position of the overwrite either We also tried the "Full Page Heap" functionality of Application Verifier, but then the application doesn't start up either (probably also running out of PTE's)

    Read the article

  • Image processing: smart solution for converting superixel (128x128 pixel) coordinates needed

    - by zhengtonic
    Hi, i am searching for a smart solution for this problem: A cancer ct picture is stored inside a unsigned short array (1-dimensional). I have the location information of the cancer region inside the picture, but the coordinates (x,y) are in superpixel (128x128 unsigned short). My task is to highlight this region. I already solved this one by converting superpixel coordinates into a offset a can use for the unsigned short array. It works fine but i wonder if there is a smarter way to solve this problem, since my solution needs 3 nested for-loops. Is it possible to access the ushort array "superpixelwise", so i can navigate the ushort array in superpixels. ... // i know this does no work ... just to give you an idea what i was thinking of ... typedef struct { unsigned short[128x128] } spix; spix *spixptr; unsigned short * bufptr = img->getBuf(); spixptr = bufptr; ... best regards, zhengtonic

    Read the article

  • Is there a more memory efficient way to search through a Core Data database?

    - by Kristian K
    I need to see if an object that I have obtained from a CSV file with a unique identifier exists in my Core Data Database, and this is the code I deemed suitable for this task: NSFetchRequest *fetchRequest = [[NSFetchRequest alloc] init]; NSEntityDescription *entity; entity = [NSEntityDescription entityForName:@"ICD9" inManagedObjectContext:passedContext]; [fetchRequest setEntity:entity]; NSPredicate *pred = [NSPredicate predicateWithFormat:@"uniqueID like %@", uniqueIdentifier]; [fetchRequest setPredicate:pred]; NSError *err; NSArray* icd9s = [passedContext executeFetchRequest:fetchRequest error:&err]; [fetchRequest release]; if ([icd9s count] > 0) { for (int i = 0; i < [icd9s count]; i++) { NSAutoreleasePool *pool = [[NSAutoreleasePool alloc]init]; NSString *name = [[icd9s objectAtIndex:i] valueForKey:@"uniqueID"]; if ([name caseInsensitiveCompare:uniqueIdentifier] == NSOrderedSame && name != nil) { [pool release]; return [icd9s objectAtIndex:i]; } [pool release]; } } return nil; After more thorough testing it appears that this code is responsible for a huge amount of leaking in the app I'm writing (it crashes on a 3GS before making it 20 percent through the 1459 items). I feel like this isn't the most efficient way to do this, any suggestions for a more memory efficient way? Thanks in advance!

    Read the article

  • Proper API Design for Version Independence?

    - by Justavian
    I've inherited an enormous .NET solution of about 200 projects. There are now some developers who wish to start adding their own components into our application, which will require that we begin exposing functionality via an API. The major problem with that, of course, is that the solution we've got on our hands contains such a spider web of dependencies that we have to be careful to avoid sabotaging the API every time there's a minor change somewhere in the app. We'd also like to be able to incrementally expose new functionality without destroying any previous third party apps. I have a way to solve this problem, but i'm not sure it's the ideal way - i was looking for other ideas. My plan would be to essentially have three dlls. APIServer_1_0.dll - this would be the dll with all of the dependencies. APIClient_1_0.dll - this would be the dll our developers would actual refer to. No references to any of the mess in our solution. APISupport_1_0.dll - this would contain the interfaces which would allow the client piece to dynamically load the "server" component and perform whatever functions are required. Both of the above dlls would depend upon this. It would be the only dll that the "client" piece refers to. I initially arrived at this design, because the way in which we do inter process communication between windows services is sort of similar (except that the client talks to the server via named pipes, rather than dynamically loading dlls). While i'm fairly certain i can make this work, i'm curious to know if there are better ways to accomplish the same task.

    Read the article

  • PHP Object Creation and Memory Usage

    - by JohnO
    A basic dummy class: class foo { var $bar = 0; function foo() {} function boo() {} } echo memory_get_usage(); echo "\n"; $foo = new foo(); echo memory_get_usage(); echo "\n"; unset($foo); echo memory_get_usage(); echo "\n"; $foo = null; echo memory_get_usage(); echo "\n"; Outputs: $ php test.php 353672 353792 353792 353792 Now, I know that PHP docs say that memory won't be freed until it is needed (hitting the ceiling). However, I wrote this up as a small test, because I've got a much longer task, using a much bigger object, with many instances of that object. And the memory just climbs, eventually running out and stopping execution. Even though these large objects do take up memory, since I destroy them after I'm done with each one (serially), it should not run out of memory (unless a single object exhausts the entire space for memory, which is not the case). Thoughts?

    Read the article

  • Attempt to create nested for loops generating missing arguments error

    - by JerryK
    Am attempting to teach myself to program using Tcl. (I want to become more familiar with the language to understand someone else's code - SCID chess) The task i've set myself to motivate my learing of Tcl is to solve the 8 queens problem. My approach to creating a program is to sucessively 'prototype' a solution. So. I'm up to nesting a for loop holding the q pos on row 2 inside the for loop holding the q pos on row 1 Here is my code set allowd 1 set notallowd 0 for {set r1p 1} {$r1p <= 8} {incr r1p } { puts "1st row q placed at $r1p" ;# re-initialize r2 'free for q placemnt' array after every change of r1 q pos: for {set i 1 } {$i <= 8} {incr i} { set r2($i) $allowd } for { set r2($r1p) $notallowd ; set r2([eval $r1p-1]) $notallowd ; set r2([eval $r1p+1]) $notallowd ; set r2p 1} {$r2p <= 8} { incr r2p ;# end of 'next' arg of r2 forloop } ;# commnd arg of r2 forloop placed below: {puts "2nd row q placed at $r2p" } } My problem is that when i run the code the interpreter is aborting with the fatal error: "wrong #args should be for start test next command. I've gone over my code a few times and can't see that i've missed any of the for loop arguments.

    Read the article

  • Rails creating users, roles, and projects

    - by Bobby
    I am still fairly new to rails and activerecord, so please excuse any oversights. I have 3 models that I'm trying to tie together (and a 4th to actually do the tying) to create a permission scheme using user-defined roles. class User < ActiveRecord::Base has_many :user_projects has_many :projects, :through => :user_projects has_many :project_roles, :through => :user_projects end class Project < ActiveRecord::Base has_many :user_projects has_many :users, :through => :user_projects has_many :project_roles end class ProjectRole < ActiveRecord::Base belongs_to :projects belongs_to :user_projects end class UserProject < ActiveRecord::Base belongs_to :user belongs_to :project has_one :project_role attr_accessible :project_role_id end The project_roles model contains a user-defined role name, and booleans that define whether the given role has permissions for a specific task. I'm looking for an elegant solution to reference that from anywhere within the project piece of my application easily. I do already have a role system implemented for the entire application. What I'm really looking for though is that the users will be able to manage their own roles on a per-project basis. Every project gets setup with an immutable default admin role, and the project creator gets added upon project creation. Since the users are creating the roles, I would like to be able to pull a list of role names from the project and user models through association (for display purposes), but for testing access, I would like to simply reference them by what they have access to without having reference them by name. Perhaps something like this? def has_perm?(permission, user) # The permission that I'm testing user.current_project.project_roles.each do |role| if role.send(permission) # Not sure that's right... do_stuff end end end I think I'm in over my head on this one because I keep running in circles on how I can best implement this.

    Read the article

  • Activator.CreateInstance uses a huge amount of memory

    - by Marco
    I have been playing a bit with Silverlight and try to port my Silverlight 3.0 application to Silverlight 4.0. My application loads different XAP files and upon a user request create an instance of a Xaml user control and adds it to the main container, in a sort of MEF approach in order I can have an extensible and pluggable application. The application is pretty huge and to keep acceptable the performances and the initial loading I have built up some helper classes to load in the background all pages and user controls that might be used later on. On Silverlight 3.0 everything was running smoothly without any problem so far. Switching to SL 4.0 I have noticed that when the process approaches to create the instances of the user controls using Activator.CreateInstance, the layout freezes unexpectedly for a minute and sometimes for more. Looking at the task manager the memory usage of IE jumps from 50MB to 400MB and sometimes to 1.5 GB. If the process won't take that much the layout is rendered properly and the memory falls back to 50 MB. Otherwise everything crashes due to out of memory exeption. Does anybody encountered the same problem? Or has anybody a solution about this tricky issue?

    Read the article

< Previous Page | 585 586 587 588 589 590 591 592 593 594 595 596  | Next Page >