Search Results

Search found 57023 results on 2281 pages for 'object to string'.

Page 594/2281 | < Previous Page | 590 591 592 593 594 595 596 597 598 599 600 601  | Next Page >

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Why does this MSDN example for Func<> delegate have a superfluous Select() call?

    - by Dan
    The MSDN gives this code example in the article on the Func Generic Delegate: Func<String, int, bool> predicate = ( str, index) => str.Length == index; String[] words = { "orange", "apple", "Article", "elephant", "star", "and" }; IEnumerable<String> aWords = words.Where(predicate).Select(str => str); foreach (String word in aWords) Console.WriteLine(word); I understand what all this is doing. What I don't understand is the Select(str => str) bit. Surely that's not needed? If you leave it out and just have IEnumerable<String> aWords = words.Where(predicate); then you still get an IEnumerable back that contains the same results, and the code prints the same thing. Am I missing something, or is the example misleading?

    Read the article

  • replace \n and \r\n with <br /> in java

    - by Bala R
    This has been asked several times for several languages but I can't get it to work. I have a string like this String str = "This is a string.\nThis is a long string."; And I'm trying to replace the \n with <br /> using str = str.replaceAll("(\r\n|\n)", "<br />"); but the \n is not getting replaced. I tried to use this RegEx Tool to verify and I see the same result. The input string does not have a match for "(\r\n|\n)". What am i doing wrong ?

    Read the article

  • Generic Dictionary - Getting Conversion Error

    - by pm_2
    The following code is giving me an error: // GetDirectoryList() returns Dictionary<string, DirectoryInfo> Dictionary<string, DirectoryInfo> myDirectoryList = GetDirectoryList(); // The following line gives a compile error foreach (Dictionary<string, DirectoryInfo> eachItem in myDirectoryList) The error it gives is as follows: Cannot convert type 'System.Collections.Generic.KeyValuePair<string,System.IO.DirectoryInfo>' to 'System.Collections.Generic.Dictionary<string,System.IO.DirectoryInfo>’ My question is: why is it trying to perform this conversion? Can I not use a foreach loop on this type of object?

    Read the article

  • NSString inheritance

    - by Stef
    Hi, I'm doing an useless thing for my first step in Obj-C @interface String : NSString { int m_isnull; } - (id) init; - (int) isNull; @end @implementation String - (id) init { self = [super init]; m_isnull=1; return self; } - (int) isNull { return m_isnull; } @end test : String *a; a=@"ok"; Works fine, but just 2 little questions 1) When I'm compiling I have this warning warning: incompatible Objective-C types assigning 'struct NSString *', expected 'struct String *' I don't know how to avoid it !? 2) a=@"ok" is a fastest way to initialize a string, but when I'm debugging, I don't stop by at my init constructor why ?

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • website inserting pics

    - by onfire4JesusCollins
    Hello i am getting this error message : Object reference not set to an instance of an object. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.NullReferenceException: Object reference not set to an instance of an object. Source Error: Line 7: Line 8: Protected Sub Page_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load Line 9: UserIdValue.Text = Membership.GetUser().ProviderUserKey.ToString() Line 10: cannotUploadImageMessage.Visible = False Line 11: End Sub can someone help me with this?

    Read the article

  • how to do collision detection for hollow(?) movieclips in flash AS3?

    - by Pieter888
    Hey everyone, I'm making small interactive games in flash to learn AS3, now I ran into a problem that I need some help with. I need to check the collision between the player and the wall which is normally simple using the hitTestObject function. But now I made a wall object totally surrounding the player with corridors and turn, a collision playground so to speak. Now when I use the hitTestObject function to check whether the player is in collision with the wall it tells me it always collides supposedly because the player object is within the bounds of the wall object. So assuming that I'm correct about the error: How can I prevent getting a collision when I'm inside the bounds of the wall object but not touching the actual walls in that object?

    Read the article

  • Obtaining Index value of dictionary

    - by Maudise
    I have a piece of code which looks at the following public Test As Dictionary(Of String, String()) Which is brought in tester = New Dictionary(Of String, String()) tester.add("Key_EN", {"Option 1_EN", "Option 2_EN", "Option 3_EN"}) tester.add("Key_FR", {"Option 1_FR", "Option 2_FR", "Option 3_FR"}) tester.add("Key_DE", {"Option 1_DE", "Option 2_DE", "Option 3_DE"}) There's then a combo box which looks at the following dim Language as string Language = "_EN" ' note this is done by a drop down combo box to select _EN or _FR etc. cboTestBox.items.AddRange(tester("Key" & Language)) What I need to be able to do is to see what index position the answer is in and convert it back to the Key_EN. So, for example _DE is selected, then the options of "Option 1_DE", "Option 2_DE", "Option 3_DE" would be displayed. If they chose Option 3_DE then I need to be able to convert this to Option 3_EN. Many thanks Maudise

    Read the article

  • parse json news feed array android

    - by user1827260
    I have an json feed from bbc in this format { "name": "ticker", "entries": [ { "headline": "text", "prompt": "LATEST", "isBreaking": "false", "mediaType": "Standard", "url": "" }, { "headline": "text", "prompt": "LATEST", "isBreaking": "false", "mediaType": "Standard", "url": "" }, etc........... My code is as follows: ArrayList mylist = new ArrayList(); JSONObject json = JSONfunctions.getJSONfromURL("http:/......"); try{ JSONArray item = json.getJSONArray("entries"); for (int i = 0; i<item.length(); i++) { HashMap<String, String> map = new HashMap<String, String>(); JSONObject e = item.getJSONObject(i); JSONObject title = e.JSONObject("headline"); map.put("title", "Title:" + e.getString("headline"); } It gives me the error "java.lang.String cannot be converted to JSONObject" I also tried leaving out JSONObject title = e.JSONObject("headline"); and it gives me a path error (note

    Read the article

  • How to validate phone number(US format) in Java?

    - by Maxood
    I just want to know where am i wrong here: import java.io.*; class Tokens{ public static void main(String[] args) { //String[] result = "this is a test".split(""); String[] result = "4543 6546 6556".split(""); boolean flag= true; String num[] = {"0","1","2","3","4","5","6","7","8","9"}; String specialChars[] = {"-","@","#","*"," "}; for (int x=1; x<result.length; x++) { for (int y=0; y<num.length; y++) { if ((result[x].equals(num[y]))) { flag = false; continue; } else { flag = true; } if (flag == true) break; } if (flag == false) break; } System.out.println(flag); } }

    Read the article

  • Python "string_escape" vs "unicode_escape"

    - by Mike Boers
    According to the docs, the builtin string encoding string_escape: Produce[s] a string that is suitable as string literal in Python source code ...while the unicode_escape: Produce[s] a string that is suitable as Unicode literal in Python source code So, they should have roughly the same behaviour. BUT, they appear to treat single quotes differently: >>> print """before '" \0 after""".encode('string-escape') before \'" \x00 after >>> print """before '" \0 after""".encode('unicode-escape') before '" \x00 after The string_escape escapes the single quote while the Unicode one does not. Is it safe to assume that I can simply: >>> escaped = my_string.encode('unicode-escape').replace("'", "\\'") ...and get the expected behaviour?

    Read the article

  • Java spliting strings

    - by N0b
    Hi I've got a Java problem. I'm trying split a string when ever a " " occurs, for example the sentence test abc. Then move the first letter in each word from first to last. I got the moving the letter to work on the original string using String text = JOptionPane.showInputDialog(null,"Skriv in en normal text:"); char firstLetter = text.charAt(0); normal = text.substring(1,text.length()+0) + firstLetter; So my question is how would I split the string then start moving the letters around in each part of the cut string? Thanks in advance

    Read the article

  • Validate NSString

    - by Chris
    I am validating an NSString to ensure that the string does not contain apostrophes. The code I'm using to do this is NSCharacterSet * invalidNumberSet = [NSCharacterSet characterSetWithCharactersInString:@"'"]; NSScanner * scanner = [NSScanner scannerWithString:string]; NSString * scannerResult; [scanner setCharactersToBeSkipped:nil]; [scanner scanUpToCharactersFromSet:invalidNumberSet intoString:&scannerResult]; if(![string isEqualToString:scannerResult]) { return 2; } Returning 2 represents an error. This code works, except for the case where the string is an apostrophe. To get around this issue, I added the following code above the preceding block. if([string isEqualToString:@"'"]); { return 2; } This code is evaluating to true, regardless of the input. I need to either prevent the first block from crashing with the input of ', or get the second block to work. What am I missing?

    Read the article

  • programming help

    - by user208639
    class Person holds personal data Its constructor receives 3 parameters, two Strings representing first and last names and an int representing age public Person(String firstName, String lastName, int age) { its method getName has no parameters and returns a String with format "Lastname, Firstname" its method getAge takes no parameters and returns an int representing the current age its method birthday increases age value by 1 and returns the new age value Create the class Person and paste the whole class into the textbox below public class Person { public Person(String first, String last, int age) { getName = "Lastname, Firstname"; System.out.print(last + first); getAge = age + 1; return getAge; System.out.print(getAge); birthday = age + 1; newAge = birthday; return newAge; } } im getting errors such as "cannot find symbol - variable getName" but when i declare a variable it still not working, i also wanted to ask if i am heading in the right direction or is it all totally wrong? im using a program called BlueJ to work on.

    Read the article

  • Android strange behavior with listview and custom cursor adapter

    - by Michael Little
    I have a problem with a list view and a custom cursor adapter and I just can't seem to figure out what is wrong with my code. Basically, in my activity I call initalize() that does a bunch of stuff to handle getting the proper data and initializing the listview. On first run of the activity you can see from the images that one of the items is missing from the list. If I go to another activity and go back to this activity the item that was missing shows up. I believe it has something to do with setContentView(R.layout.parent). If I move that to my initialize() then the item never shows up even when returning from another activity. So, for some reason, returning from another activity bypasses setContentView(R.layout.parent) and everything works fine. I know it's impossible for me to bypass setContentView(R.layout.parent) so I need to figure out what the problem is. Also, I did not include the layout because it is nothing more then two textviews. Also, the images I have attached do not show that the missing item is the last one on the list. Custom Cursor Adapter: public class CustomCursorAdapter extends SimpleCursorAdapter { private Context context; private int layout; public CustomCursorAdapter (Context context, int layout, Cursor c, String[] from, int[] to) { super(context, layout, c, from, to); this.context = context; this.layout = layout; } public View newView(Context context, Cursor cursor, ViewGroup parent) { LayoutInflater inflater = LayoutInflater.from(context); final View view = inflater.inflate(layout, parent, false); return view; } @Override public void bindView(View v, Context context, Cursor c) { if (c.getColumnName(0).matches("section")){ int nameCol = c.getColumnIndex("section"); String section = c.getString(nameCol); TextView section_text = (TextView) v.findViewById(R.id.text1); if ((section.length() > 0)) { section_text.setText(section); } else { //so we don't have an empty spot section_text.setText(""); section_text.setVisibility(2); section_text.setHeight(1); } } else if (c.getColumnName(0).matches("code")) { int nameCol = c.getColumnIndex("code"); String mCode = c.getString(nameCol); TextView code_text = (TextView) v.findViewById(R.id.text1); if (code_text != null) { int i = 167; byte[] data = {(byte) i}; String strSymbol = EncodingUtils.getString(data, "windows-1252"); mCode = strSymbol + " " + mCode; code_text.setText(mCode); code_text.setSingleLine(); } } if (c.getColumnName(1).matches("title")){ int nameCol = c.getColumnIndex("title"); String mTitle = c.getString(nameCol); TextView title_text = (TextView) v.findViewById(R.id.text2); if (title_text != null) { title_text.setText(mTitle); } } else if (c.getColumnName(1).matches("excerpt")) { int nameCol = c.getColumnIndex("excerpt"); String mExcerpt = c.getString(nameCol); TextView excerpt_text = (TextView) v.findViewById(R.id.text2); if (excerpt_text != null) { excerpt_text.setText(mExcerpt); excerpt_text.setSingleLine(); } } } The Activity: public class parent extends ListActivity { private static String[] TITLE_FROM = { SECTION, TITLE, _ID, }; private static String[] CODE_FROM = { CODE, EXCERPT, _ID, }; private static String ORDER_BY = _ID + " ASC"; private static int[] TO = { R.id.text1, R.id.text2, }; String breadcrumb = null; private MyData data; private SQLiteDatabase db; CharSequence parent_id = ""; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); data = new MyData(this); db = data.getReadableDatabase(); setContentView(R.layout.parent); initialize(); } public void initialize() { breadcrumb = null; Bundle bun = getIntent().getExtras(); TextView tvBreadCrumb; tvBreadCrumb = (TextView)findViewById(R.id.breadcrumb); if (bun == null) { //this is the first run tvBreadCrumb.setText(null); tvBreadCrumb.setHeight(0); parent_id = "0"; try { Cursor cursor = getData(parent_id); showSectionData(cursor); } finally { data.close(); } } else { CharSequence state = bun.getString("state"); breadcrumb = bun.getString("breadcrumb"); tvBreadCrumb.setText(breadcrumb); CharSequence code = bun.getString("code"); parent_id = code; if (state.equals("chapter")) { try { Cursor cursor = getData(parent_id); showSectionData(cursor); } finally { data.close(); } } else if (state.equals("code")) { try { Cursor cursor = getCodeData(parent_id); showCodeData(cursor); } finally { data.close(); } } } } @Override public void onStart() { //initialize(); super.onResume(); } @Override public void onResume() { initialize(); super.onResume(); } private Cursor getData(CharSequence parent_id) { Cursor cTitles = db.query(TITLES_TABLE_NAME, TITLE_FROM, "parent_id = " + parent_id, null, null, null, ORDER_BY); Cursor cCodes = db.query(CODES_TABLE_NAME, CODE_FROM, "parent_id = " + parent_id, null, null, null, ORDER_BY); Cursor[] c = {cTitles, cCodes}; Cursor cursor = new MergeCursor(c); startManagingCursor(cursor); return cursor; } private Cursor getCodeData(CharSequence parent_id2) { Bundle bun = getIntent().getExtras(); CharSequence intent = bun.getString("intent"); CharSequence searchtype = bun.getString("searchtype"); //SQLiteDatabase db = data.getReadableDatabase(); if (intent != null) { String sWhere = null; if(searchtype.equals("code")) { sWhere = "code LIKE '%"+parent_id2+"%'"; } else if(searchtype.equals("within")){ sWhere = "definition LIKE '%"+parent_id2+"%'"; } //This is a search request Cursor cursor = db.query(CODES_TABLE_NAME, CODE_FROM, sWhere, null, null, null, ORDER_BY); startManagingCursor(cursor); return cursor; } else { Cursor cursor = db.query(CODES_TABLE_NAME, CODE_FROM, "parent_id = "+ parent_id2, null, null, null, ORDER_BY); startManagingCursor(cursor); return cursor; } } private void showSectionData(Cursor cursor) { CustomCursorAdapter adapter= new CustomCursorAdapter(this, R.layout.item, cursor, TITLE_FROM, TO); setListAdapter(adapter); } private void showCodeData(Cursor cursor) { CustomCursorAdapter adapter = new CustomCursorAdapter(this, R.layout.item, cursor, CODE_FROM, TO); setListAdapter(adapter); Bundle bun = getIntent().getExtras(); CharSequence intent = bun.getString("intent"); if (intent != null) { Cursor cursor1 = ((CursorAdapter)getListAdapter()).getCursor(); startManagingCursor(cursor1); TextView tvBreadCrumb; tvBreadCrumb = (TextView)findViewById(R.id.breadcrumb); tvBreadCrumb.setText(cursor1.getCount() + " Records Found"); //cursor1.close(); //mdl } }

    Read the article

  • Programming an Android Button to update EditText views

    - by bergler77
    Ok guys, I have a button in android that i'm trying to use to update 8 EditText Views with different random numbers. Everything works up until I click the button. It appears I am missing a resource according to the debugger, but I'm not sure what. I've tried several different ways of implementing the button. Here is what I have after looking at several posts. import java.util.Random; import android.os.Bundle; import android.view.View; import android.view.View.OnClickListener; import android.widget.Button; import android.widget.EditText; public class MyCharNewChar extends MyCharActivity { private OnClickListener randomButtonListener = new OnClickListener(){ public void onClick(View v) { //Button creates a set of random numbers and updates the values //of the EditText views. Random rand = new Random(); int STR = 1 + rand.nextInt(12); int AGI = 1 + rand.nextInt(12); int DEX = 1 + rand.nextInt(12); int WIS = 1 + rand.nextInt(12); int INT = 1 + rand.nextInt(12); int CON = 1 + rand.nextInt(12); int HP = 1 + rand.nextInt(20); int AC = 1 + rand.nextInt(6); EditText str = (EditText) findViewById(R.id.str); str.setText(STR); EditText agi = (EditText) findViewById(R.id.agi); agi.setText(AGI); EditText dex = (EditText) findViewById(R.id.dex); dex.setText(DEX); EditText wis = (EditText) findViewById(R.id.wis); wis.setText(WIS); EditText intel = (EditText) findViewById(R.id.intel); intel.setText(INT); EditText con = (EditText) findViewById(R.id.con); con.setText(CON); EditText hp = (EditText) findViewById(R.id.baseHP); hp.setText(HP); EditText ac = (EditText) findViewById(R.id.baseAC); ac.setText(AC); } }; @Override public void onCreate(Bundle savedInstanceState){ super.onCreate(savedInstanceState); setContentView(R.layout.newchar); Button randomButton = (Button) findViewById(R.id.randomButton); randomButton.setOnClickListener(randomButtonListener); } } Here is the xml: <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:id="@+id/linearlayoutNew1" android:layout_width="match_parent" android:layout_height="match_parent" android:orientation="vertical" android:background="@drawable/background" > <TextView android:id="@+id/newCharLabel" android:layout_width="match_parent" android:layout_height="wrap_content" android:text="@string/new_character_screen" android:textSize="24dp" android:textColor="@color/splash" android:textStyle="bold" android:gravity="center"/> <TextView android:id="@+id/nameLabel" android:layout_width="match_parent" android:layout_height="wrap_content" android:text="@string/nameLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/editText1" android:layout_width="match_parent" android:layout_height="wrap_content" android:ems="10" android:inputType="textPersonName" > <requestFocus /> </EditText> <TableLayout android:id="@+id/statsLayout" android:layout_width="match_parent" android:layout_height="wrap_content" android:padding="5dp"> <TableRow android:id="@+id/tableRow01" android:orientation="horizontal" android:layout_width="match_parent" android:layout_height="wrap_content" android:padding="5dp"> <TextView android:id="@+id/strLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/strLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/str" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number" /> <TextView android:id="@+id/agiLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/agiLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/agi" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> <TextView android:id="@+id/dexLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/dexLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/dex" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> </TableRow> <TableRow android:id="@+id/tableRow02" android:orientation="horizontal" android:layout_width="match_parent" android:layout_height="wrap_content" android:padding="5dp"> <TextView android:id="@+id/intLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/intLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/intel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> <TextView android:id="@+id/wisLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/wisLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/wis" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> <TextView android:id="@+id/conLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/conLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/con" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> </TableRow> </TableLayout> <LinearLayout android:id="@+id/linearlayoutNew02" android:layout_width="match_parent" android:layout_height="wrap_content" android:padding="5dp" android:gravity="center"> <TextView android:id="@+id/baseHPLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/hpLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/baseHP" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> <TextView android:id="@+id/baseACLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/acLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/baseAC" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> </LinearLayout> <LinearLayout android:id="@+id/linearlayoutNew03" android:layout_width="match_parent" android:layout_height="wrap_content" android:orientation="horizontal"> <Button android:id="@+id/randomButton" android:layout_width="0dp" android:layout_height="wrap_content" android:layout_weight="1" android:text="@string/randomButton" android:textSize="16dp" android:clickable="true"/> </LinearLayout> </LinearLayout> I have also tried setting the onClick in xml to setup a specific onClick method. Still the same error so I must have a problem elsewhere. Any suggestions would be great!

    Read the article

  • parseInt and viewflipper layout problems

    - by user1234167
    I have a problem with parseInt it throws the error: unable to parse 'null' as integer. My view flipper is also not working. Hopefully this is an easy enough question. Here is my activity: import javax.xml.parsers.SAXParser; import javax.xml.parsers.SAXParserFactory; import org.xml.sax.InputSource; import org.xml.sax.XMLReader; import android.app.Activity; import android.graphics.Color; import android.os.Bundle; import android.util.Log; import android.view.View; import android.view.View.OnClickListener; import android.widget.Button; import android.widget.LinearLayout; import android.widget.TextView; import android.widget.ViewFlipper; import xml.parser.dataset; public class XmlParserActivity extends Activity implements OnClickListener { private final String MY_DEBUG_TAG = "WeatherForcaster"; // private dataset myDataSet; private LinearLayout layout; private int temp= 0; /** Called when the activity is first created. */ //the ViewSwitcher private Button btn; private ViewFlipper flip; // private TextView tv; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); layout=(LinearLayout)findViewById(R.id.linearlayout1); btn=(Button)findViewById(R.id.btn); btn.setOnClickListener(this); flip=(ViewFlipper)findViewById(R.id.flip); //when a view is displayed flip.setInAnimation(this,android.R.anim.fade_in); //when a view disappears flip.setOutAnimation(this, android.R.anim.fade_out); // String postcode = null; // public String getPostcode { // return postcode; // } //URL newUrl = c; // myweather.setText(c.toString()); /* Create a new TextView to display the parsingresult later. */ TextView tv = new TextView(this); // run(0); //WeatherApplicationActivity postcode = new WeatherApplicationActivity(); try { /* Create a URL we want to load some xml-data from. */ URL url = new URL("http://new.myweather2.com/developer/forecast.ashx?uac=gcV3ynNdoV&output=xml&query=G41"); //String url = new String("http://new.myweather2.com/developer/forecast.ashx?uac=gcV3ynNdoV&output=xml&query="+WeatherApplicationActivity.postcode ); //URL url = new URL(url); //url.toString( ); //myString(url.toString() + WeatherApplicationActivity.getString(postcode)); // url + WeatherApplicationActivity.getString(postcode); /* Get a SAXParser from the SAXPArserFactory. */ SAXParserFactory spf = SAXParserFactory.newInstance(); SAXParser sp = spf.newSAXParser(); /* Get the XMLReader of the SAXParser we created. */ XMLReader xr = sp.getXMLReader(); /* Create a new ContentHandler and apply it to the XML-Reader*/ handler myHandler = new handler(); xr.setContentHandler(myHandler); /* Parse the xml-data from our URL. */ xr.parse(new InputSource(url.openStream())); /* Parsing has finished. */ /* Our ExampleHandler now provides the parsed data to us. */ dataset parsedDataSet = myHandler.getParsedData(); /* Set the result to be displayed in our GUI. */ tv.setText(parsedDataSet.toString()); } catch (Exception e) { /* Display any Error to the GUI. */ tv.setText("Error: " + e.getMessage()); Log.e(MY_DEBUG_TAG, "WeatherQueryError", e); } temp = Integer.parseInt(xml.parser.dataset.getTemp()); if(temp <0){ //layout.setBackgroundColor(Color.BLUE); //layout.setBackgroundColor(getResources().getColor(R.color.silver)); findViewById(R.id.flip).setBackgroundColor(Color.BLUE); } else if(temp > 0 && temp < 9) { //layout.setBackgroundColor(Color.GREEN); //layout.setBackgroundColor(getResources().getColor(R.color.silver)); findViewById(R.id.flip).setBackgroundColor(Color.GREEN); } else { //layout.setBackgroundColor(Color.YELLOW); //layout.setBackgroundColor(getResources().getColor(R.color.silver)); findViewById(R.id.flip).setBackgroundColor(Color.YELLOW); } /* Display the TextView. */ this.setContentView(tv); } @Override public void onClick(View arg0) { // TODO Auto-generated method stub onClick(View arg0) { // TODO Auto-generated method stub flip.showNext(); //specify flipping interval //flip.setFlipInterval(1000); //flip.startFlipping(); } } this is my dataset: package xml.parser; public class dataset { static String temp = null; // private int extractedInt = 0; public static String getTemp() { return temp; } public void setTemp(String temp) { this.temp = temp; } this is my handler: public void characters(char ch[], int start, int length) { if(this.in_temp){ String setTemp = new String(ch, start, length); // myParsedDataSet.setTempUnit(new String(ch, start, length)); // myParsedDataSet.setTemp; } the dataset and handler i only pasted the code that involves the temp as i no they r working when i take out the if statement. However even then my viewflipper wont work. This is my main xml: <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:orientation="vertical" android:layout_width="fill_parent" android:layout_height="fill_parent" android:id="@+id/linearlayout1" > <TextView android:layout_width="fill_parent" android:layout_height="wrap_content" android:textSize="25dip" android:text="Flip Example" /> <TextView android:layout_width="fill_parent" android:layout_height="wrap_content" android:textSize="25dip" android:id="@+id/tv" /> <Button android:layout_width="wrap_content" android:layout_height="wrap_content" android:textSize="25dip" android:text="Flip" android:id="@+id/btn" android:onClick="ClickHandler" /> <ViewFlipper android:layout_width="fill_parent" android:layout_height="fill_parent" android:id="@+id/flip"> <LinearLayout android:orientation="vertical" android:layout_width="fill_parent" android:layout_height="fill_parent" > <TextView android:layout_width="fill_parent" android:layout_height="wrap_content" android:textSize="25dip" android:text="Item1a" /> </LinearLayout> <TextView android:layout_width="fill_parent" android:layout_height="wrap_content" android:textSize="25dip" android:id="@+id/tv2" /> </ViewFlipper> </LinearLayout> this is my logcat: 04-01 18:02:24.744: E/AndroidRuntime(7331): FATAL EXCEPTION: main 04-01 18:02:24.744: E/AndroidRuntime(7331): java.lang.RuntimeException: Unable to start activity ComponentInfo{xml.parser/xml.parser.XmlParserActivity}: java.lang.NumberFormatException: unable to parse 'null' as integer 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1830) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:1851) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.app.ActivityThread.access$1500(ActivityThread.java:132) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:1038) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.os.Handler.dispatchMessage(Handler.java:99) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.os.Looper.loop(Looper.java:150) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.app.ActivityThread.main(ActivityThread.java:4293) 04-01 18:02:24.744: E/AndroidRuntime(7331): at java.lang.reflect.Method.invokeNative(Native Method) 04-01 18:02:24.744: E/AndroidRuntime(7331): at java.lang.reflect.Method.invoke(Method.java:507) 04-01 18:02:24.744: E/AndroidRuntime(7331): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:849) 04-01 18:02:24.744: E/AndroidRuntime(7331): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:607) 04-01 18:02:24.744: E/AndroidRuntime(7331): at dalvik.system.NativeStart.main(Native Method) 04-01 18:02:24.744: E/AndroidRuntime(7331): Caused by: java.lang.NumberFormatException: unable to parse 'null' as integer 04-01 18:02:24.744: E/AndroidRuntime(7331): at java.lang.Integer.parseInt(Integer.java:356) 04-01 18:02:24.744: E/AndroidRuntime(7331): at java.lang.Integer.parseInt(Integer.java:332) 04-01 18:02:24.744: E/AndroidRuntime(7331): at xml.parser.XmlParserActivity.onCreate(XmlParserActivity.java:118) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1072) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1794) I hope I have given enough information about my problems. I will be extremely grateful if anyone can help me out.

    Read the article

  • Azure Diagnostics wrt Custom Logs and honoring scheduledTransferPeriod

    - by kjsteuer
    I have implemented my own TraceListener similar to http://blogs.technet.com/b/meamcs/archive/2013/05/23/diagnostics-of-cloud-services-custom-trace-listener.aspx . One thing I noticed is that that logs show up immediately in My Azure Table Storage. I wonder if this is expected with Custom Trace Listeners or because I am in a development environment. My diagnosics.wadcfg <?xml version="1.0" encoding="utf-8"?> <DiagnosticMonitorConfiguration configurationChangePollInterval="PT1M""overallQuotaInMB="4096" xmlns="http://schemas.microsoft.com/ServiceHosting/2010/10/DiagnosticsConfiguration"> <DiagnosticInfrastructureLogs scheduledTransferLogLevelFilter="Information" /> <Directories scheduledTransferPeriod="PT1M"> <IISLogs container="wad-iis-logfiles" /> <CrashDumps container="wad-crash-dumps" /> </Directories> <Logs bufferQuotaInMB="0" scheduledTransferPeriod="PT30M" scheduledTransferLogLevelFilter="Information" /> </DiagnosticMonitorConfiguration> I have changed my approach a bit. Now I am defining in the web config of my webrole. I notice when I set autoflush to true in the webconfig, every thing works but scheduledTransferPeriod is not honored because the flush method pushes to the table storage. I would like to have scheduleTransferPeriod trigger the flush or trigger flush after a certain number of log entries like the buffer is full. Then I can also flush on server shutdown. Is there any method or event on the CustomTraceListener where I can listen to the scheduleTransferPeriod? <system.diagnostics> <!--http://msdn.microsoft.com/en-us/library/sk36c28t(v=vs.110).aspx By default autoflush is false. By default useGlobalLock is true. While we try to be threadsafe, we keep this default for now. Later if we would like to increase performance we can remove this. see http://msdn.microsoft.com/en-us/library/system.diagnostics.trace.usegloballock(v=vs.110).aspx --> <trace> <listeners> <add name="TableTraceListener" type="Pos.Services.Implementation.TableTraceListener, Pos.Services.Implementation" /> <remove name="Default" /> </listeners> </trace> </system.diagnostics> I have modified the custom trace listener to the following: namespace Pos.Services.Implementation { class TableTraceListener : TraceListener { #region Fields //connection string for azure storage readonly string _connectionString; //Custom sql storage table for logs. //TODO put in config readonly string _diagnosticsTable; [ThreadStatic] static StringBuilder _messageBuffer; readonly object _initializationSection = new object(); bool _isInitialized; CloudTableClient _tableStorage; readonly object _traceLogAccess = new object(); readonly List<LogEntry> _traceLog = new List<LogEntry>(); #endregion #region Constructors public TableTraceListener() : base("TableTraceListener") { _connectionString = RoleEnvironment.GetConfigurationSettingValue("DiagConnection"); _diagnosticsTable = RoleEnvironment.GetConfigurationSettingValue("DiagTableName"); } #endregion #region Methods /// <summary> /// Flushes the entries to the storage table /// </summary> public override void Flush() { if (!_isInitialized) { lock (_initializationSection) { if (!_isInitialized) { Initialize(); } } } var context = _tableStorage.GetTableServiceContext(); context.MergeOption = MergeOption.AppendOnly; lock (_traceLogAccess) { _traceLog.ForEach(entry => context.AddObject(_diagnosticsTable, entry)); _traceLog.Clear(); } if (context.Entities.Count > 0) { context.BeginSaveChangesWithRetries(SaveChangesOptions.None, (ar) => context.EndSaveChangesWithRetries(ar), null); } } /// <summary> /// Creates the storage table object. This class does not need to be locked because the caller is locked. /// </summary> private void Initialize() { var account = CloudStorageAccount.Parse(_connectionString); _tableStorage = account.CreateCloudTableClient(); _tableStorage.GetTableReference(_diagnosticsTable).CreateIfNotExists(); _isInitialized = true; } public override bool IsThreadSafe { get { return true; } } #region Trace and Write Methods /// <summary> /// Writes the message to a string buffer /// </summary> /// <param name="message">the Message</param> public override void Write(string message) { if (_messageBuffer == null) _messageBuffer = new StringBuilder(); _messageBuffer.Append(message); } /// <summary> /// Writes the message with a line breaker to a string buffer /// </summary> /// <param name="message"></param> public override void WriteLine(string message) { if (_messageBuffer == null) _messageBuffer = new StringBuilder(); _messageBuffer.AppendLine(message); } /// <summary> /// Appends the trace information and message /// </summary> /// <param name="eventCache">the Event Cache</param> /// <param name="source">the Source</param> /// <param name="eventType">the Event Type</param> /// <param name="id">the Id</param> /// <param name="message">the Message</param> public override void TraceEvent(TraceEventCache eventCache, string source, TraceEventType eventType, int id, string message) { base.TraceEvent(eventCache, source, eventType, id, message); AppendEntry(id, eventType, eventCache); } /// <summary> /// Adds the trace information to a collection of LogEntry objects /// </summary> /// <param name="id">the Id</param> /// <param name="eventType">the Event Type</param> /// <param name="eventCache">the EventCache</param> private void AppendEntry(int id, TraceEventType eventType, TraceEventCache eventCache) { if (_messageBuffer == null) _messageBuffer = new StringBuilder(); var message = _messageBuffer.ToString(); _messageBuffer.Length = 0; if (message.EndsWith(Environment.NewLine)) message = message.Substring(0, message.Length - Environment.NewLine.Length); if (message.Length == 0) return; var entry = new LogEntry() { PartitionKey = string.Format("{0:D10}", eventCache.Timestamp >> 30), RowKey = string.Format("{0:D19}", eventCache.Timestamp), EventTickCount = eventCache.Timestamp, Level = (int)eventType, EventId = id, Pid = eventCache.ProcessId, Tid = eventCache.ThreadId, Message = message }; lock (_traceLogAccess) _traceLog.Add(entry); } #endregion #endregion } }

    Read the article

  • Ajax, Callback, postback and Sys.WebForms.PageRequestManager.getInstance().add_beginRequest

    - by user338262
    Hi, I have a user control which encapsulates a NumericUpDownExtender. This UserControl implements the interface ICallbackEventHandler, because I want that when a user changes the value of the textbox associated a custom event to be raised in the server. By the other hand each time an async postback is done I shoe a message of loading and disable the whole screen. This works perfect when something is changed in for example an UpdatePanel through this lines of code: Sys.WebForms.PageRequestManager.getInstance().add_beginRequest( function (sender, args) { var modalPopupBehavior = $find('programmaticSavingLoadingModalPopupBehavior'); modalPopupBehavior.show(); } ); The UserControl is placed inside a detailsview which is inside an UpdatePanel in an aspx. When the custom event is raised I want another textbox in the aspx to change its value. So far, When I click on the UpDownExtender, it goes correctly to the server and raises the custom event, and the new value of the textbox is assigned in the server. but it is not changed in the browser. I suspect that the problem is the callback, since I have the same architecture for a UserControl with an AutoCompleteExtender which implement IPostbackEventHandler and it works. Any clues how can I solve this here to make the UpDownNumericExtender user control to work like the AutComplete one? This is the code of the user control and the parent: using System; using System.Web.UI; using System.ComponentModel; using System.Text; namespace Corp.UserControls { [Themeable(true)] public partial class CustomNumericUpDown : CorpNumericUpDown, ICallbackEventHandler { protected void Page_PreRender(object sender, EventArgs e) { if (!Page.IsPostBack) { currentInstanceNumber = CorpAjaxControlToolkitUserControl.getNextInstanceNumber(); } registerControl(this.HFNumericUpDown.ClientID, currentInstanceNumber); string strCallServer = "NumericUpDownCallServer" + currentInstanceNumber.ToString(); // If this function is not written the callback to get the disponibilidadCliente doesn't work if (!Page.ClientScript.IsClientScriptBlockRegistered("ReceiveServerDataNumericUpDown")) { StringBuilder str = new StringBuilder(); str.Append("function ReceiveServerDataNumericUpDown(arg, context) {}").AppendLine(); Page.ClientScript.RegisterClientScriptBlock(typeof(CorpNumericUpDown), "ReceiveServerDataNumericUpDown", str.ToString(), true); } nudeNumericUpDownExtender.BehaviorID = "NumericUpDownEx" + currentInstanceNumber.ToString(); ClientScriptManager cm = Page.ClientScript; String cbReference = cm.GetCallbackEventReference(this, "arg", "ReceiveServerDataNumericUpDown", ""); String callbackScript = "function " + strCallServer + "(arg, context)" + Environment.NewLine + "{" + Environment.NewLine + cbReference + ";" + Environment.NewLine + "}" + Environment.NewLine; cm.RegisterClientScriptBlock(typeof(CustomNumericUpDown), strCallServer, callbackScript, true); base.Page_PreRender(sender,e); } [System.ComponentModel.Browsable(true)] [System.ComponentModel.Bindable(true)] public Int64 Value { get { return (string.IsNullOrEmpty(HFNumericUpDown.Value) ? Int64.Parse("1") : Int64.Parse(HFNumericUpDown.Value)); } set { HFNumericUpDown.Value = value.ToString(); //txtAutoCompleteCliente_AutoCompleteExtender.ContextKey = value.ToString(); // TODO: Change the text of the textbox } } [System.ComponentModel.Browsable(true)] [System.ComponentModel.Bindable(true)] [Description("The text of the numeric up down")] public string Text { get { return txtNumericUpDown.Text; } set { txtNumericUpDown.Text = value; } } public delegate void NumericUpDownChangedHandler(object sender, NumericUpDownChangedArgs e); public event NumericUpDownChangedHandler numericUpDownEvent; [System.ComponentModel.Browsable(true)] [System.ComponentModel.Bindable(true)] [System.ComponentModel.Description("Raised after the number has been increased or decreased")] protected virtual void OnNumericUpDownEvent(object sender, NumericUpDownChangedArgs e) { if (numericUpDownEvent != null) //check to see if anyone has attached to the event numericUpDownEvent(this, e); } #region ICallbackEventHandler Members public string GetCallbackResult() { return "";//throw new NotImplementedException(); } public void RaiseCallbackEvent(string eventArgument) { NumericUpDownChangedArgs nudca = new NumericUpDownChangedArgs(long.Parse(eventArgument)); OnNumericUpDownEvent(this, nudca); } #endregion } /// <summary> /// Class that adds the prestamoList to the event /// </summary> public class NumericUpDownChangedArgs : System.EventArgs { /// <summary> /// The current selected value. /// </summary> public long Value { get; private set; } public NumericUpDownChangedArgs(long value) { Value = value; } } } using System; using System.Collections.Generic; using System.Text; namespace Corp { /// <summary> /// Summary description for CorpAjaxControlToolkitUserControl /// </summary> public class CorpNumericUpDown : CorpAjaxControlToolkitUserControl { private Int16 _currentInstanceNumber; // This variable hold the instanceNumber assignated at first place. public short currentInstanceNumber { get { return _currentInstanceNumber; } set { _currentInstanceNumber = value; } } protected void Page_PreRender(object sender, EventArgs e) { const string strOnChange = "OnChange"; const string strCallServer = "NumericUpDownCallServer"; StringBuilder str = new StringBuilder(); foreach (KeyValuePair<String, Int16> control in controlsToRegister) { str.Append("function ").Append(strOnChange + control.Value).Append("(sender, eventArgs) ").AppendLine(); str.Append("{").AppendLine(); str.Append(" if (sender) {").AppendLine(); str.Append(" var hfield = document.getElementById('").Append(control.Key).Append("');").AppendLine(); str.Append(" if (hfield.value != eventArgs) {").AppendLine(); str.Append(" hfield.value = eventArgs;").AppendLine(); str.Append(" ").Append(strCallServer + control.Value).Append("(eventArgs, eventArgs);").AppendLine(); str.Append(" }").AppendLine(); str.Append(" }").AppendLine(); str.Append("}").AppendLine(); Page.ClientScript.RegisterClientScriptBlock(typeof(CorpNumericUpDown), Guid.NewGuid().ToString(), str.ToString(), true); } str = new StringBuilder(); foreach (KeyValuePair<String, Int16> control in controlsToRegister) { str.Append(" funcsPageLoad[funcsPageLoad.length] = function() { $find('NumericUpDownEx" + control.Value + "').add_currentChanged(").Append(strOnChange + control.Value).Append(");};").AppendLine(); str.Append(" funcsPageUnLoad[funcsPageUnLoad.length] = function() { $find('NumericUpDownEx" + control.Value + "').remove_currentChanged(").Append(strOnChange + control.Value).Append(");};").AppendLine(); } Page.ClientScript.RegisterClientScriptBlock(typeof(CorpNumericUpDown), Guid.NewGuid().ToString(), str.ToString(), true); } } } and to create the loading view I use this: //The beginRequest event is raised before the processing of an asynchronous postback starts and the postback is sent to the server. You can use this event to call custom script to set a request header or to start an animation that notifies the user that the postback is being processed. Sys.WebForms.PageRequestManager.getInstance().add_beginRequest( function (sender, args) { var modalPopupBehavior = $find('programmaticSavingLoadingModalPopupBehavior'); modalPopupBehavior.show(); } ); //The endRequest event is raised after an asynchronous postback is finished and control has been returned to the browser. You can use this event to provide a notification to users or to log errors. Sys.WebForms.PageRequestManager.getInstance().add_endRequest( function (sender, arg) { var modalPopupBehavior = $find('programmaticSavingLoadingModalPopupBehavior'); modalPopupBehavior.hide(); } ); Thanks in advance! Daniel.

    Read the article

  • PHP sorting issue with simpleXML

    - by tugbucket
    test.xml: <?xml version="1.0"?> <props> <prop> <state statename="Mississippi"> <info> <code>a1</code> <location>Jackson</location> </info> <info> <code>d2</code> <location>Gulfport</location> </info> <info> <code>g6</code> <location>Hattiesburg</location> </info> </state> <state statename="Texas"> <info> <code>i9</code> <location>Dallas</location> </info> <info> <code>a7</code> <location>Austin</location> </info> </state> <state statename="Maryland"> <info> <code>s5</code> <location>Mount Laurel</location> </info> <info> <code>f0</code> <location>Baltimore</location> </info> <info> <code>h4</code> <location>Annapolis</location> </info> </state> </prop> </props> test.php // start the sortCities function sortCities($a, $b){ return strcmp($a->location, $b->location); } // start the sortStates function sortStates($t1, $t2) { return strcmp($t1['statename'], $t2['statename']); } $props = simplexml_load_file('test.xml'); foreach ($props->prop as $prop) { $sortedStates = array(); foreach($prop->state as $states) { $sortedStates[] = $states; } usort($sortedStates, "sortStates"); // finish the sortStates /* --- */ echo '<pre>'."\n"; print_r($sortedStates); echo '</pre>'."\n"; /* --- */ foreach ($prop->children() as $stateattr) { // this doesn't do it //foreach($sortedStates as $hotel => @attributes){ // blargh! if(isset($stateattr->info)) { $statearr = $stateattr->attributes(); echo '<optgroup label="'.$statearr['statename'].'">'."\n"; $options = array(); foreach($stateattr->info as $info) { $options[] = $info; } usort($options, "sortCities"); // finish the sortCities foreach($options as $stateattr => $info){ echo '<option value="'.$info->code.'">'.$info->location.'</option>'."\n"; } echo '</optgroup>'."\n"; } else { //empty nodes don't do squat } } } ?> This is the array that: print_r($sortedStates); prints out: Array ( [0] => SimpleXMLElement Object ( [@attributes] => Array ( [statename] => Maryland ) [info] => Array ( [0] => SimpleXMLElement Object ( [code] => s5 [location] => Mount Laurel ) [1] => SimpleXMLElement Object ( [code] => f0 [location] => Baltimore ) [2] => SimpleXMLElement Object ( [code] => h4 [location] => Annapolis ) ) ) [1] => SimpleXMLElement Object ( [@attributes] => Array ( [statename] => Mississippi ) [info] => Array ( [0] => SimpleXMLElement Object ( [code] => a1 [location] => Jackson ) [1] => SimpleXMLElement Object ( [code] => d2 [location] => Gulfport ) [2] => SimpleXMLElement Object ( [code] => g6 [location] => Hattiesburg ) ) ) [2] => SimpleXMLElement Object ( [@attributes] => Array ( [statename] => Texas ) [info] => Array ( [0] => SimpleXMLElement Object ( [code] => i9 [location] => Dallas ) [1] => SimpleXMLElement Object ( [code] => a7 [location] => Austin ) ) ) ) this: // start the sortCities function sortCities($a, $b){ return strcmp($a->location, $b->location); } plus this part of code: $options = array(); foreach($stateattr->info as $info) { $options[] = $info; } usort($options, "sortCities"); // finish the sortCities foreach($options as $stateattr => $info){ echo '<option value="'.$info->code.'">'.$info->location.'</option>'."\n"; } is doing a fine job of sorting by the 'location' node within each optgroup. You can see that in the array I can make it sort by the attribute 'statename'. What I am having trouble with is echoing out and combining the two functions in order to have it auto sort both the states and the cities within and forming the needed optgroups. I tried copying the lines for the cities and changing the names called several ways to no avail.

    Read the article

  • Java homework help, Error <identifier> expected

    - by user2900126
    Help with java homework this is my assignment that I have, this assignment code I've tried. But when I try to compile it I keep getting errors which I cant seem to find soloutions too: Error says <identifier> expected for Line 67 public static void () Assignment brief To write a simple java classMobile that models a mobile phone. Details the information stored about each mobile phone will include • Its type e.g. “Sony ericsson x90” or “Samsung Galaxy S”; • Its screen size in inches; You may assume that this a whole number from the scale 3 to 5 inclusive. • Its memory card capacity in gigabytes You may assume that this a whole number • The name of its present service provider You may assume this is a single line of text. • The type of contract with service provider You may assume this is a single line of text. • Its camera resolution in megapixels; You should not assume that this a whole number; • The percentage of charge left on the phone e.g. a fully charged phone will have a charge of 100. You may assume that this a whole number • Whether the phone has GPS or not. Your class will have fields corresponding to these attributes . Start by opening BlueJ, creating a new project called myMobile which has a classMobile and set up the fields that you need, Next you will need to write a Constructor for the class. Assume that each phone is manufactured by creating an object and specifying its type, its screen size, its memory card capacity, its camera resolution and whether it has GPS or not. Therefore you will need a constructor that allows you to pass arguments to initialise these five attributes. Other fields should be set to appropriate default values. You may assume that a new phone comes fully charged. When the phone is sold to its owner, you will need to set the service provider and type of contract with that provider so you will need mutator methods • setProvider () - - to set service provider. • setContractType - - to set the type of contract These methods will be used when the phones provider is changed. You should also write a mutator method ChargeUp () which simulates fully charging the phone. To obtain information about your mobile object you should write • accessor methods corresponding to four of its fields: • getType () – which returns the type of mobile; • getProvider () – which returns the present service provider; • getContractType () – which returns its type of contract; • getCharge () – which returns its remaining charge. An accessor method to printDetails () to print, to the terminal window, a report about the phone e.g. This mobile phone is a sony Erricsson X90 with Service provider BigAl and type of contract PAYG. At present it has 30% of its battery charge remaining. Check that the new method works correctly by for example, • creating a Mobile object and setting its fields; • calling printDetails () and t=checking the report corresponds to the details you have just given the mobile; • changing the service provider and contract type by calling setprovider () and setContractType (); • calling printDetails () and checking the report now prints out the new details. Challenging excercises • write a mutator methodswitchedOnFor () =which simulates using the phone for a specified period. You may assume the phone loses 1% of its charge for each hour that it is switched on . • write an accessor method checkcharge () whichg checks the phone remaing charge. If this charge has a value less than 25%, then this method returns a string containg the message Be aware that you will soon need to re-charge your phone, otherwise it returns a string your phone charge is sufficient. • Write a method changeProvider () which simulates changing the provider (and presumably also the type of service contract). Finally you may add up to four additional fields, with appropriate methods, that might be required in a more detailed model. above is my assignment that I have, this assignment code I've tried. But when I try to oompile it I keep getting errors which I cant seem to find soloutions too: Error says <identifier> expected for Line 67 public static void () /** * to write a simple java class Mobile that models a mobile phone. * * @author (Lewis Burte-Clarke) * @version (14/10/13) */ public class Mobile { // type of phone private String phonetype; // size of screen in inches private int screensize; // menory card capacity private int memorycardcapacity; // name of present service provider private String serviceprovider; // type of contract with service provider private int typeofcontract; // camera resolution in megapixels private int cameraresolution; // the percentage of charge left on the phone private int checkcharge; // wether the phone has GPS or not private String GPS; // instance variables - replace the example below with your own private int x; // The constructor method public Mobile(String mobilephonetype, int mobilescreensize, int mobilememorycardcapacity,int mobilecameraresolution,String mobileGPS, String newserviceprovider) { this.phonetype = mobilephonetype; this.screensize = mobilescreensize; this.memorycardcapacity = mobilememorycardcapacity; this.cameraresolution = mobilecameraresolution; this.GPS = mobileGPS; // you do not use this ones during instantiation,you can remove them if you do not need or assign them some default values //this.serviceprovider = newserviceprovider; //this.typeofcontract = 12; //this.checkcharge = checkcharge; Mobile samsungPhone = new Mobile("Samsung", "1024", "2", "verizon", "8", "GPS"); 1024 = screensize; 2 = memorycardcapacity; 8 = resolution; GPS = gps; "verizon"=serviceprovider; //typeofcontract = 12; //checkcharge = checkcharge; } // A method to display the state of the object to the screen public void displayMobileDetails() { System.out.println("phonetype: " + phonetype); System.out.println("screensize: " + screensize); System.out.println("memorycardcapacity: " + memorycardcapacity); System.out.println("cameraresolution: " + cameraresolution); System.out.println("GPS: " + GPS); System.out.println("serviceprovider: " + serviceprovider); System.out.println("typeofcontract: " + typeofcontract); } /** * The mymobile class implements an application that * simply displays "new Mobile!" to the standard output. */ public class mymobile { public static void main(String[] args) { System.out.println("new Mobile!"); //Display the string. } } public static void buildPhones(){ Mobile Samsung = new Mobile("Samsung", "3.0", "4gb", "8mega pixels", "GPS"); Mobile Blackberry = new Mobile("Blackberry", "3.0", "4gb", "8mega pixels", "GPS"); Samsung.displayMobileDetails(); Blackberry.displayMobileDetails(); } public static void main(String[] args) { buildPhones(); } } any answers.replies and help would be greatly appreciated as I really lost!

    Read the article

  • 12.04 Unity 3D Not working where as Unity 2D works fine

    - by Stephen Martin
    I updated from 11.10 to 12.04 using the distribution upgrade, after that I couldn't log into using the Unity 3D desktop after logging in I would either never get unity's launcher or I would get the launcher and once I tried to do anything the windows lost their decoration and nothing would respond. If I use Unity 2D it works fine and in fact I'm using it to type this. I managed to get some info out of dmesg that looks like it's the route of whats happening. dmesg: [ 109.160165] [drm:i915_hangcheck_elapsed] *ERROR* Hangcheck timer elapsed... GPU hung [ 109.160180] [drm] capturing error event; look for more information in /debug/dri/0/i915_error_state [ 109.167587] [drm:i915_wait_request] *ERROR* i915_wait_request returns -11 (awaiting 1226 at 1218, next 1227) [ 109.672273] [drm:i915_reset] *ERROR* Failed to reset chip. output of lspci | grep vga 00:02.0 VGA compatible controller: Intel Corporation Mobile 4 Series Chipset Integrated Graphics Controller (rev 07) output of /usr/lib/nux/unity_support_test -p IN 12.04 OpenGL vendor string: VMware, Inc. OpenGL renderer string: Gallium 0.4 on llvmpipe (LLVM 0x300) OpenGL version string: 2.1 Mesa 8.0.2 Not software rendered: no Not blacklisted: yes GLX fbconfig: yes GLX texture from pixmap: yes GL npot or rect textures: yes GL vertex program: yes GL fragment program: yes GL vertex buffer object: yes GL framebuffer object: yes GL version is 1.4+: yes Unity 3D supported: no The same command in 11.10: stephenm@mcr-ubu1:~$ /usr/lib/nux/unity_support_test -p OpenGL vendor string: Tungsten Graphics, Inc OpenGL renderer string: Mesa DRI Mobile Intel® GM45 Express Chipset OpenGL version string: 2.1 Mesa 7.11 Not software rendered: yes Not blacklisted: yes GLX fbconfig: yes GLX texture from pixmap: yes GL npot or rect textures: yes GL vertex program: yes GL fragment program: yes GL vertex buffer object: yes GL framebuffer object: yes GL version is 1.4+: yes Unity 3D supported: yes stephenm@mcr-ubu1:~$ output of /var/log/Xorg.0.log [ 11.971] (II) intel(0): EDID vendor "LPL", prod id 307 [ 11.971] (II) intel(0): Printing DDC gathered Modelines: [ 11.971] (II) intel(0): Modeline "1280x800"x0.0 69.30 1280 1328 1360 1405 800 803 809 822 -hsync -vsync (49.3 kHz) [ 12.770] (II) intel(0): Allocated new frame buffer 2176x800 stride 8704, tiled [ 15.087] (II) intel(0): EDID vendor "LPL", prod id 307 [ 15.087] (II) intel(0): Printing DDC gathered Modelines: [ 15.087] (II) intel(0): Modeline "1280x800"x0.0 69.30 1280 1328 1360 1405 800 803 809 822 -hsync -vsync (49.3 kHz) [ 33.310] (II) XKB: reuse xkmfile /var/lib/xkb/server-93A39E9580D1D5B855D779F4595485C2CC66E0CF.xkm [ 34.900] (WW) intel(0): flip queue failed: Invalid argument [ 34.900] (WW) intel(0): Page flip failed: Invalid argument [ 34.900] (WW) intel(0): flip queue failed: Invalid argument [ 34.900] (WW) intel(0): Page flip failed: Invalid argument [ 34.913] (WW) intel(0): flip queue failed: Invalid argument [ 34.913] (WW) intel(0): Page flip failed: Invalid argument [ 34.913] (WW) intel(0): flip queue failed: Invalid argument [ 34.913] (WW) intel(0): Page flip failed: Invalid argument [ 34.926] (WW) intel(0): flip queue failed: Invalid argument [ 34.926] (WW) intel(0): Page flip failed: Invalid argument [ 34.926] (WW) intel(0): flip queue failed: Invalid argument [ 34.926] (WW) intel(0): Page flip failed: Invalid argument [ 35.501] (WW) intel(0): flip queue failed: Invalid argument [ 35.501] (WW) intel(0): Page flip failed: Invalid argument [ 35.501] (WW) intel(0): flip queue failed: Invalid argument [ 35.501] (WW) intel(0): Page flip failed: Invalid argument [ 41.519] [mi] Increasing EQ size to 512 to prevent dropped events. [ 42.079] (EE) intel(0): Detected a hung GPU, disabling acceleration. [ 42.079] (EE) intel(0): When reporting this, please include i915_error_state from debugfs and the full dmesg. [ 42.598] (II) intel(0): EDID vendor "LPL", prod id 307 [ 42.598] (II) intel(0): Printing DDC gathered Modelines: [ 42.598] (II) intel(0): Modeline "1280x800"x0.0 69.30 1280 1328 1360 1405 800 803 809 822 -hsync -vsync (49.3 kHz) [ 51.052] (II) AIGLX: Suspending AIGLX clients for VT switch I know im using the beta version so I'm not expecting it to work but does any one know what the problem may be or even why they Unity compatibility test is describing my video card as vmware when its an intel i915 and Ubuntu is running on the metal not virtualised. Unity 3D worked fine in 11.10

    Read the article

  • Unity 3D Not working where as Unity 2D works fine [closed]

    - by Stephen Martin
    I updated from 11.10 to 12.04 using the distribution upgrade, after that I couldn't log into using the Unity 3D desktop after logging in I would either never get unity's launcher or I would get the launcher and once I tried to do anything the windows lost their decoration and nothing would respond. If I use Unity 2D it works fine and in fact I'm using it to type this. I managed to get some info out of dmesg that looks like it's the route of whats happening. dmesg: [ 109.160165] [drm:i915_hangcheck_elapsed] *ERROR* Hangcheck timer elapsed... GPU hung [ 109.160180] [drm] capturing error event; look for more information in /debug/dri/0/i915_error_state [ 109.167587] [drm:i915_wait_request] *ERROR* i915_wait_request returns -11 (awaiting 1226 at 1218, next 1227) [ 109.672273] [drm:i915_reset] *ERROR* Failed to reset chip. output of lspci | grep vga 00:02.0 VGA compatible controller: Intel Corporation Mobile 4 Series Chipset Integrated Graphics Controller (rev 07) output of /usr/lib/nux/unity_support_test -p IN 12.04 OpenGL vendor string: VMware, Inc. OpenGL renderer string: Gallium 0.4 on llvmpipe (LLVM 0x300) OpenGL version string: 2.1 Mesa 8.0.2 Not software rendered: no Not blacklisted: yes GLX fbconfig: yes GLX texture from pixmap: yes GL npot or rect textures: yes GL vertex program: yes GL fragment program: yes GL vertex buffer object: yes GL framebuffer object: yes GL version is 1.4+: yes Unity 3D supported: no The same command in 11.10: stephenm@mcr-ubu1:~$ /usr/lib/nux/unity_support_test -p OpenGL vendor string: Tungsten Graphics, Inc OpenGL renderer string: Mesa DRI Mobile Intel® GM45 Express Chipset OpenGL version string: 2.1 Mesa 7.11 Not software rendered: yes Not blacklisted: yes GLX fbconfig: yes GLX texture from pixmap: yes GL npot or rect textures: yes GL vertex program: yes GL fragment program: yes GL vertex buffer object: yes GL framebuffer object: yes GL version is 1.4+: yes Unity 3D supported: yes stephenm@mcr-ubu1:~$ output of /var/log/Xorg.0.log [ 11.971] (II) intel(0): EDID vendor "LPL", prod id 307 [ 11.971] (II) intel(0): Printing DDC gathered Modelines: [ 11.971] (II) intel(0): Modeline "1280x800"x0.0 69.30 1280 1328 1360 1405 800 803 809 822 -hsync -vsync (49.3 kHz) [ 12.770] (II) intel(0): Allocated new frame buffer 2176x800 stride 8704, tiled [ 15.087] (II) intel(0): EDID vendor "LPL", prod id 307 [ 15.087] (II) intel(0): Printing DDC gathered Modelines: [ 15.087] (II) intel(0): Modeline "1280x800"x0.0 69.30 1280 1328 1360 1405 800 803 809 822 -hsync -vsync (49.3 kHz) [ 33.310] (II) XKB: reuse xkmfile /var/lib/xkb/server-93A39E9580D1D5B855D779F4595485C2CC66E0CF.xkm [ 34.900] (WW) intel(0): flip queue failed: Invalid argument [ 34.900] (WW) intel(0): Page flip failed: Invalid argument [ 34.900] (WW) intel(0): flip queue failed: Invalid argument [ 34.900] (WW) intel(0): Page flip failed: Invalid argument [ 34.913] (WW) intel(0): flip queue failed: Invalid argument [ 34.913] (WW) intel(0): Page flip failed: Invalid argument [ 34.913] (WW) intel(0): flip queue failed: Invalid argument [ 34.913] (WW) intel(0): Page flip failed: Invalid argument [ 34.926] (WW) intel(0): flip queue failed: Invalid argument [ 34.926] (WW) intel(0): Page flip failed: Invalid argument [ 34.926] (WW) intel(0): flip queue failed: Invalid argument [ 34.926] (WW) intel(0): Page flip failed: Invalid argument [ 35.501] (WW) intel(0): flip queue failed: Invalid argument [ 35.501] (WW) intel(0): Page flip failed: Invalid argument [ 35.501] (WW) intel(0): flip queue failed: Invalid argument [ 35.501] (WW) intel(0): Page flip failed: Invalid argument [ 41.519] [mi] Increasing EQ size to 512 to prevent dropped events. [ 42.079] (EE) intel(0): Detected a hung GPU, disabling acceleration. [ 42.079] (EE) intel(0): When reporting this, please include i915_error_state from debugfs and the full dmesg. [ 42.598] (II) intel(0): EDID vendor "LPL", prod id 307 [ 42.598] (II) intel(0): Printing DDC gathered Modelines: [ 42.598] (II) intel(0): Modeline "1280x800"x0.0 69.30 1280 1328 1360 1405 800 803 809 822 -hsync -vsync (49.3 kHz) [ 51.052] (II) AIGLX: Suspending AIGLX clients for VT switch I know im using the beta version so I'm not expecting it to work but does any one know what the problem may be or even why they Unity compatibility test is describing my video card as vmware when its an intel i915 and Ubuntu is running on the metal not virtualised. Unity 3D worked fine in 11.10

    Read the article

  • Subterranean IL: Pseudo custom attributes

    - by Simon Cooper
    Custom attributes were designed to make the .NET framework extensible; if a .NET language needs to store additional metadata on an item that isn't expressible in IL, then an attribute could be applied to the IL item to represent this metadata. For instance, the C# compiler uses DecimalConstantAttribute and DateTimeConstantAttribute to represent compile-time decimal or datetime constants, which aren't allowed in pure IL, and FixedBufferAttribute to represent fixed struct fields. How attributes are compiled Within a .NET assembly are a series of tables containing all the metadata for items within the assembly; for instance, the TypeDef table stores metadata on all the types in the assembly, and MethodDef does the same for all the methods and constructors. Custom attribute information is stored in the CustomAttribute table, which has references to the IL item the attribute is applied to, the constructor used (which implies the type of attribute applied), and a binary blob representing the arguments and name/value pairs used in the attribute application. For example, the following C# class: [Obsolete("Please use MyClass2", true)] public class MyClass { // ... } corresponds to the following IL class definition: .class public MyClass { .custom instance void [mscorlib]System.ObsoleteAttribute::.ctor(string, bool) = { string('Please use MyClass2' bool(true) } // ... } and results in the following entry in the CustomAttribute table: TypeDef(MyClass) MemberRef(ObsoleteAttribute::.ctor(string, bool)) blob -> {string('Please use MyClass2' bool(true)} However, there are some attributes that don't compile in this way. Pseudo custom attributes Just like there are some concepts in a language that can't be represented in IL, there are some concepts in IL that can't be represented in a language. This is where pseudo custom attributes come into play. The most obvious of these is SerializableAttribute. Although it looks like an attribute, it doesn't compile to a CustomAttribute table entry; it instead sets the serializable bit directly within the TypeDef entry for the type. This flag is fully expressible within IL; this C#: [Serializable] public class MySerializableClass {} compiles to this IL: .class public serializable MySerializableClass {} For those interested, a full list of pseudo custom attributes is available here. For the rest of this post, I'll be concentrating on the ones that deal with P/Invoke. P/Invoke attributes P/Invoke is built right into the CLR at quite a deep level; there are 2 metadata tables within an assembly dedicated solely to p/invoke interop, and many more that affect it. Furthermore, all the attributes used to specify p/invoke methods in C# or VB have their own keywords and syntax within IL. For example, the following C# method declaration: [DllImport("mscorsn.dll", SetLastError = true)] [return: MarshalAs(UnmanagedType.U1)] private static extern bool StrongNameSignatureVerificationEx( [MarshalAs(UnmanagedType.LPWStr)] string wszFilePath, [MarshalAs(UnmanagedType.U1)] bool fForceVerification, [MarshalAs(UnmanagedType.U1)] ref bool pfWasVerified); compiles to the following IL definition: .method private static pinvokeimpl("mscorsn.dll" lasterr winapi) bool marshal(unsigned int8) StrongNameSignatureVerificationEx( string marshal(lpwstr) wszFilePath, bool marshal(unsigned int8) fForceVerification, bool& marshal(unsigned int8) pfWasVerified) cil managed preservesig {} As you can see, all the p/invoke and marshal properties are specified directly in IL, rather than using attributes. And, rather than creating entries in CustomAttribute, a whole bunch of metadata is emitted to represent this information. This single method declaration results in the following metadata being output to the assembly: A MethodDef entry containing basic information on the method Four ParamDef entries for the 3 method parameters and return type An entry in ModuleRef to mscorsn.dll An entry in ImplMap linking ModuleRef and MethodDef, along with the name of the function to import and the pinvoke options (lasterr winapi) Four FieldMarshal entries containing the marshal information for each parameter. Phew! Applying attributes Most of the time, when you apply an attribute to an element, an entry in the CustomAttribute table will be created to represent that application. However, some attributes represent concepts in IL that aren't expressible in the language you're coding in, and can instead result in a single bit change (SerializableAttribute and NonSerializedAttribute), or many extra metadata table entries (the p/invoke attributes) being emitted to the output assembly.

    Read the article

< Previous Page | 590 591 592 593 594 595 596 597 598 599 600 601  | Next Page >