Search Results

Search found 17194 results on 688 pages for 'document databases'.

Page 598/688 | < Previous Page | 594 595 596 597 598 599 600 601 602 603 604 605  | Next Page >

  • Loading default value in a dropdown and calling onchange event

    - by J. Davidson
    Hi i have following dropdown <div class="fcolumn"> <label class="text" for="o_Id">Months:</label> <select class="textMonths" id="o_Id" name="periodName" > <option value="000">Select Period--</option> </select> </div> In the following jquery, first it loads fnLoadP() in a drop down list. Than as a default I am loading one of the values in drop down which is '10'. It loads too as default value. But it should be executing $("#o_Id").change.. which it doesn't. $(document).ready(function () { var sProfileUserId = null; $("#o_Id").change(function () { //---- }); fnLoadP(); $("select[name='pName']").val('10'); }); }); Basically my goal is. After dropdown values are loaded, to load '10' as default value and call onchange event in the dom. Please let me know how to fix it.

    Read the article

  • updating multiple nodes in xml with xquery and xdmp:node-replace

    - by morja
    Hi all, I wnat to update an XML document in my xml database (Marklogic). I have xml as input and want to replace each node that exists in the target xml. If a node does not exist it would be great if it gets added, but thats maybe another task. My XML in the database: <user> <username>username</username> <firstname>firstname</firstname> <lastname>lastname</lastname> <email>[email protected]</email> <comment>comment</comment> </user> The value of $user_xml: <user> <firstname>new firstname</firstname> <lastname>new lastname</lastname> </user> My function so far: declare function update-user ( $username as xs:string, $user_xml as node()) as empty-sequence() { let $uri := user-uri($username) return for $node in $user_xml/user return xdmp:node-replace(fn:doc($uri)/user/fn:node-name($node), $node) }; First of all I cannot iterate over $user_xml/user. If I try to iterate over $user_xml I get "arg1 is not of type node()" exception. But maybe its the wrong approach anyway? Does anybody maybe have sample code how to do this?

    Read the article

  • Solr/Lucene Scorer

    - by TFor
    We are currently working on a proof-of-concept for a client using Solr and have been able to configure all the features they want except the scoring. Problem is that they want scores that make results fall in buckets: Bucket 1: exact match on category (score = 4) Bucket 2: exact match on name (score = 3) Bucket 3: partial match on category (score = 2) Bucket 4: partial match on name (score = 1) First thing we did was develop a custom similarity class that would return the correct score depending on the field and an exact or partial match. The only problem now is that when a document matches on both the category and name the scores are added together. Example: searching for "restaurant" returns documents in the category restaurant that also have the word restaurant in their name and thus get a score of 5 (4+1) but they should only get 4. I assume for this to work we would need to develop a custom Scorer class but we have no clue on how to incorporate this in Solr. Another option is to create a custom SortField implementation similar to the RandomSortField already present in Solr. Maybe there is even a simpler solution that we don't know about. All suggestions welcome!

    Read the article

  • How to select LI except first and second ?

    - by Wazdesign
    Here is the structure of the content, I want to select all LI except the first two (ie no-link) jQuery(document).ready(function(){ var nosubnav = jQuery('.first-level li:not(:has(ul))'); var nosubnavsize = jQuery('.first-level li:not(:has(ul))').size(); jQuery(nosubnav).css('border' , '1px solid red'); alert('List item which does not have submenu '+nosubnavsize); }); div class="navigation-container"> <ul class="first-level"> <li><a href="#">No Link</a></li> <li><a href="#">No Link</a></li> <li><a href="#">Link 1</a></li> <li><a href="#">Link 2</a> <ul> <li><a href="#">Link2.1</a></li> <li><a href="#">Link2.2</a> <ul> <li><a href="#">Link 2.2.1</a></li> </ul> </li> </ul> </li> <li><a href="#">Link </a></li> </ul> </div> related Question : http://stackoverflow.com/questions/2771801/how-to-count-li-which-does-not-have-ul

    Read the article

  • Generate custom RSS/Atom feed with SyndicationFeedFormatter made from XML

    - by Sentax
    I have followed this article and implemented my service and I can open the web browser and see the test data being published. I would like to create a custom formatted response, as for my needs this will not be published to the internet and it's an isolated feed that other devices on the local network could read to get the data I'm publishing. I'd like to create an XML document and publish it instead of using the SyndicationItem that is being used in the article to display title, author, description, etc. Would like to create something simple to be published: <MyData> <ID>33883</ID> <Title>The Name</Title> <Artist>The Artist</Artist> </MyData> I know how to create that in an XMLWriter, but how to publish in a SyndicationFeedFormatter that is the return type for the function in the article? I have seen the XmlSyndicationContent class but haven't seen any practical examples that would accomplish what I want to do.

    Read the article

  • IE "Microsoft JScript runtime error: Object expected"

    - by Stephen Borg
    Hi there, I have problems with regards to javascript only when using IE. The error I am getting is "Microsoft JScript runtime error: Object expected" and I have no idea why. It is then jumping into the JQuery 1.4.2 file, without giving me a proper error message. All I am doing is simply reading on page load the raw URL, and getting a query string named Search. Using that in an AJAX call to return products and put then into a DIV. No biggies, but somehow IE is managing to blow my page up :-( Any ideas? Code as follows : <script type="text/javascript"> $(document).ready(function (e) { $('.boxLoader').show(); function getParameterByName(name) { name = name.replace(/[\[]/, "\\\[").replace(/[\]]/, "\\\]"); var regexS = "[\\?&]" + name + "=([^&#]*)"; var regex = new RegExp(regexS); var results = regex.exec(window.location.href); if (results == null) return ""; else return decodeURIComponent(results[1].replace(/\+/g, " ")); } var Search; Search = getParameterByName("search"); $('#searchCriteria').text(Search); $.get("/Handlers/processProducts.aspx", { SearchCriteria: Search }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); $('#searchBox').live("click", function () { $.get("/Handlers/processProducts.aspx", { SearchCriteria: $('#searchCriteria').val() }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); }); }); </script>

    Read the article

  • opening a new page and passing a parameter to it with Javascript

    - by recipriversexclusion
    I have a JS function that processes XML I GET from a server to dynamically create a table as below // Generate table of services by parsing the returned XML service list. function convertServiceXmlDataToTable(xml) { var tbodyElem = document.getElementById("myTbody"); var trElem, tdElem; var j = 0; $(xml).find("Service").each(function() { trElem = tbodyElem.insertRow(tbodyElem.rows.length); trElem.className = "tr" + (j % 2); // first column -> service ID var serviceID = $(this).attr("service__id"); tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col0"; tdElem.innerHTML = serviceID; // second column -> service name tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col1"; tdElem.innerHTML = "<a href=javascript:showServiceInfo(" + serviceID + ")>" + $(this).find("name").text() + "</a>"; j++; }); // each service } where showServiceInfo retrieves more detailed information about each service from the server based on the serviceID and displays it in the same page as the services table. So far so good. But, it turns out that I have to display the detailed service information in another page rather than the same page as the table. I have creates a generic service_info.html with an empty layout template, but I don't understand how to pass serviceID to this new page so that it gets customized with the detailed service info. How can I do this? Or, is there a better way to handle these situations? Thanks!

    Read the article

  • Trying to fadein divs in a sequence, over time, using JQuery

    - by user346602
    Hi, I'm trying to figure out how to make 4 images fade in sequentially when the page loads. The following is my (amateurish) code: Here is the HTML: <div id="outercorners"> <img id="corner1" src="images/corner1.gif" width="6" height="6" alt=""/> <img id="corner2" src="images/corner2.gif" width="6" height="6" alt=""/> <img id="corner3" src="images/corner3.gif" width="6" height="6" alt=""/> <img id="corner4" src="images/corner4.gif" width="6" height="6" alt=""/> </div><!-- end #outercorners--> Here is the JQuery: $(document).ready(function() { $("#corner1").fadeIn("2000", function(){ $("#corner3").fadeIn("4000", function(){ $("#corner2").fadeIn("6000", function(){ $("#corner4").fadeIn("8000", function(){ }); }); }); }); Here is the css: #outercorners { position: fixed; top:186px; left:186px; width:558px; height:372px; } #corner1 { position: fixed; top:186px; left:186px; display: none; } #corner2 { position: fixed; top:186px; left:744px; display: none; } #corner3 { position: fixed; top:558px; left:744px; display: none; } #corner4 { position: fixed; top:558px; left:186px; display: none; } They seem to just wink at me, rather than fade in in the order I've ascribed to them. Should I be using the queue() function? And, if so, how would I implement it in this case? Thank you for any assistance.

    Read the article

  • Jquery Returning values to original

    - by Cam
    So my script works perfectly, but here is the issue, I have buttons (Sprite action here) that are 40px height, but the top 20 only shows perfectly. When you click the button ie img the bottom 20px show perfecto! but... Issue, i included in my script a way to return all others to there default (only one should be selected) now, how can I fix this issue that I seem unable to correct as I can select multiple of them ** USERS can switch ** The last part of the script that is the issue. Thanks $(document).ready(function() { $('.form_sub').hide(); $('.theader').addClass('active'); $('.theader_t').click(function() { $('.form_header').show(); $('.form_sub').hide(); $('.theader').addClass('active'); $('.sub_theader').removeClass('active'); }); $('.sub_theader_t').click(function() { $('.form_header').hide(); $('.form_sub').show(); $('.theader').removeClass('active'); $('.sub_theader').addClass('active'); }); $('.top_head_img').click(function() { $(this).css({ position: 'relative', bottom: '20px' }).siblings().css( 'bottom', '0' ); }); }); <ul class="top_head"> <li> <a href="javascript:void(0)" onClick="selectPic5('top');"><img src="custom/images/top2.jpg" alt="Left" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('center');"><img src="custom/images/mid2.jpg" alt="Center" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('bottom');"><img src="custom/images/bot2.jpg" alt="Right" border="0" class="top_head_img"/></a> </li> </ul>

    Read the article

  • Opening a xul file in response to a toolbar extension button click

    - by Graham
    I'm currently building my first Firefox extension, and am having a little difficulty with one piece of functionality. I'd like to open a new browser tab in response to a button click on the toolbar. The new tab should contain the contents of a webpage, together with some extra buttons. At the moment I've created a separate xul file for the contents of the new tab: <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <window id="myapp-report-window" title="Example 4.5.1" xmlns:html="http://www.w3.org/1999/xhtml" xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul"> <script type="application/x-javascript" src="chrome://myapp/content/main.js" /> <toolbox> <toolbar id="nav-toolbar"> <toolbarbutton label="This-is-going-to-do-some-stuff"/> </toolbar> </toolbox> <iframe id="myapp-report-frame" flex="1"/> <script type="text/javascript"> function loadPage(url){ document.getElementById('myapp-report-frame').setAttribute('src',url); } </script> </window> This xul file is launched via this javascript, referenced from the main myapptoolbar.xul: gBrowser.selectedTab = gBrowser.addTab('chrome://myapp/content/report.xul'); var newTabBrowser = gBrowser.getBrowserForTab(gBrowser.selectedTab); newTabBrowser.addEventListener("load", function(){ loadPage('http://www.somedynamicallysetwebsite.com'); }, true); The problem that I'm having is that the loadPage function is not being found, so the src attribute of the iframe is never set. I'm sure it's some silly scoping problem, but I'm very new to firefox extensions (day 2!) so any help would be much appreciated. Thanks for looking! Graham

    Read the article

  • JQuery date picker does not firing in ajax page using Rails

    - by prabu
    Hi Here I have using datepicker from JQueryUI in my public/javascript folder as effects,prototype,control,dragdrop js files. in my public folder contains jqueryui development buddle. (css,js,development-bundle) in layout/application.rhtml <%= stylesheet_link_tag 'application' %> <%=javascript_include_tag :defaults%> <%= stylesheet_link_tag '/jquery-ui/css/custom-theme/jquery-ui-1.8.1.custom.css' %> <%=javascript_include_tag "/jquery-ui/js/jquery-1.4.2.min.js"%> <%=javascript_include_tag "/jquery-ui/js/jquery-ui-1.8.1.custom.min.js"%> <script> $(document).ready(function(){ var $j=jQuery.noConflict(); $j( '#date' ).datepicker({ dateFormat: 'dd-mm-yy' }); }); </script> in home/index.rhtml <%title "Home"%> <%=link_to "Add Details" ,:action=>"add"%> <%=link_to_remote "Ajax Add Details", :update=>"add" , :url=>{ :action=>"add" }%> <div id='add' /> in home/add.rhtml <%title "Add details"%> <%form_tag :action=>"create" do%> Name : <%=text_field_tag "name" ,"",:size=>15%> DOB : <%=text_field_tag "dob","",:id=>"date"%> <%=submit_tag "Save"%> <%end%> the datepicker works when I run home/add.rhtml directly but the datepicker not work when i run ajax page home/index.rhtml Any solutions for that,????

    Read the article

  • JQuery tablesorter - Second click on column header doesn't resort

    - by Jonathan
    I'm using tablesorter in on a table I added to a view in django's admin (although I'm not sure this is relevant). I'm extending the html's header: {% block extrahead %} <script type="text/javascript" src="http://code.jquery.com/jquery-1.4.2.js"></script> <script type="text/javascript" src="http://mysite.com/media/tablesorter/jquery.tablesorter.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#myTable").tablesorter(); } ); </script> {% endblock %} When I click on a column header, it sorts the table using this column in descending order - that's ok. When I click the same column header a second time - it does not reorder to ascending order. What's wrong with it? the table's html looks like: <table id="myTable" border="1"> <thead> <tr> <th>column_name_1</th> <th>column_name_2</th> <th>column_name_3</th> </tr> </thead> <tbody> {% for item in extra.items %} <tr> <td>{{ item.0|safe }} </td> <td>{{ item.1|safe }} </td> <td>{{ item.2|safe }} </td> </tr> {% endfor %} </tbody> </table>

    Read the article

  • jQuery when div is clicked update input field issue

    - by stogdilla
    Hello, I'm rather new to jquery so this may be the issue. I have a script that outputs several divs all with different text data in them. I would like it when I click one of them that an input field's value is updated to that text currently I have: <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.1/jquery.min.js"></script> <script type="text/javascript"> $(document).ready(function() { $("a.results]").click(function() { data= this.text(); $("#updateme").val(data); }); }); </script> <p> <label>Field <input type="text" name="updateme" id="updateme"> </label> </p> <a href="#" class="results">Florida</a> <a href="#" class="results">Florida 2</a> <a href="#" class="results">Florida 3</a> How can I make it so that whatever link is clicked that is the data that gets updated into the input's value? I can get it to take one or I can script out different cases of each changing the class name but I think there has to be a way where it references whatever link is being clicked instead of what it's currently doing. Thanks in advance!

    Read the article

  • Why don't copy this dokument attributes from the source xml file??

    - by siegfried storr
    Hi anyone, i'm working the first time with xslt and i really don't understand why this xsl don't copy attributes from the source xml. Perhaps someone can give me a hint?? <xsl:stylesheet version="2.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:output omit-xml-declaration="yes" indent="yes"/> <xsl:variable name="rpl" select="document('ParamInvoice.xml')"/> <xsl:template match="/"> <xsl:copy> <xsl:apply-templates select="* | @*"/> </xsl:copy> </xsl:template> <xsl:template match="*"> <xsl:variable name="vInvoiceElement" select="$rpl/StoraInvoice/*[name()=name(current())]"/> <xsl:copy> <xsl:if test="$vInvoiceElement/Attribute"> <xsl:call-template name="AttributeErzeugen"> <xsl:with-param name="pAttr" select="$vInvoiceElement/Attribute"/> </xsl:call-template> </xsl:if> <xsl:apply-templates/> </xsl:copy> </xsl:template> <xsl:template name="AttributeErzeugen"> <xsl:param name="pAttr"/> <xsl:for-each select="$pAttr"> <xsl:attribute name="{@name}"><xsl:value-of select="."/></xsl:attribute> </xsl:for-each> </xsl:template> </xsl:stylesheet>

    Read the article

  • Testing approach for multi-threaded software

    - by Shane MacLaughlin
    I have a piece of mature geospatial software that has recently had areas rewritten to take better advantage of the multiple processors available in modern PCs. Specifically, display, GUI, spatial searching, and main processing have all been hived off to seperate threads. The software has a pretty sizeable GUI automation suite for functional regression, and another smaller one for performance regression. While all automated tests are passing, I'm not convinced that they provide nearly enough coverage in terms of finding bugs relating race conditions, deadlocks, and other nasties associated with multi-threading. What techniques would you use to see if such bugs exist? What techniques would you advocate for rooting them out, assuming there are some in there to root out? What I'm doing so far is running the GUI functional automation on the app running under a debugger, such that I can break out of deadlocks and catch crashes, and plan to make a bounds checker build and repeat the tests against that version. I've also carried out a static analysis of the source via PC-Lint with the hope of locating potential dead locks, but not had any worthwhile results. The application is C++, MFC, mulitple document/view, with a number of threads per doc. The locking mechanism I'm using is based on an object that includes a pointer to a CMutex, which is locked in the ctor and freed in the dtor. I use local variables of this object to lock various bits of code as required, and my mutex has a time out that fires my a warning if the timeout is reached. I avoid locking where possible, using resource copies where possible instead. What other tests would you carry out?

    Read the article

  • jQuery selector for option tag value attribute returns null

    - by Ben
    Hello, I am trying to change the selected option in a select dropdown box with jQuery. I have it set so that it finds the hash tag at the end of the URL and based on that hash tag it changes the selected option in the select box. Most of my code is functional, it successfully finds the hash tag and executes the if statement that corresponds with it. However, when it goes to execute the "then" section of the statement when it goes to the selector for the option (which uses an attribute selector based on the value attribute of the option tag) it returns null. If figured this out with firebug, in the console it says that the selector is null. Here is my code: $(document).ready(function() { var $hash = window.location.hash if($hash == "#htmlcss") { $('option[value="HTML/CSS Coding"]').attr("selected","selected") } if($hash == "#php") { $('option[value="PHP Coding"]').attr("selected","selected") } if($hash == "#jscript") { $('option[value="Javascript and jQuery Coding"]').attr("selected","selected") } if($hash == "#improv") { $('option[value="General Website Improvements"]').attr("selected","selected") } if($hash == "#towp") { $('option[value="Website Conversion to Wordpress"]').attr("selected","selected") } if($hash == "#wptheme") { $('option[value="Wordpress Theme Design"]').attr("selected","selected") } if($hash == "#complete") { $('option[value="Complete Website Creation"]').attr("selected","selected") } if($hash == "#server") { $('option[value="Web Server Configuration"]').attr("selected","selected") } }); So to clarify, when I enter in a url that ends in the #php hash tag, for example, the desired action does not occur which would change the "PHP Coding" option to the selected one by using the "selected" html attribute however the selector for the particular option tag returns null. Is there a problem with my syntax or is my code not functioning in the way that I think it should? Thanks very much.

    Read the article

  • Indexing and Searching Over Word Level Annotation Layers in Lucene

    - by dmcer
    I have a data set with multiple layers of annotation over the underlying text, such as part-of-tags, chunks from a shallow parser, name entities, and others from various natural language processing (NLP) tools. For a sentence like The man went to the store, the annotations might look like: Word POS Chunk NER ==== === ===== ======== The DT NP Person man NN NP Person went VBD VP - to TO PP - the DT NP Location store NN NP Location I'd like to index a bunch of documents with annotations like these using Lucene and then perform searches across the different layers. An example of a simple query would be to retrieve all documents where Washington is tagged as a person. While I'm not absolutely committed to the notation, syntactically end-users might enter the query as follows: Query: Word=Washington,NER=Person I'd also like to do more complex queries involving the sequential order of annotations across different layers, e.g. find all the documents where there's a word tagged person followed by the words arrived at followed by a word tagged location. Such a query might look like: Query: "NER=Person Word=arrived Word=at NER=Location" What's a good way to go about approaching this with Lucene? Is there anyway to index and search over document fields that contain structured tokens?

    Read the article

  • Can someone tell me why this JavaScript code isn't lining up an array in order?

    - by DarkLightA
    Live code: http://jsfiddle.net/fCUZC/ //INPUT ARRAY: var input = [28,32,21,11,8,2,14,32,64]; //VARIABLE DECLARATION. a = highest number so far, b = position of that number entireLoop: for (var i = 1; i<=input.length; i++) { if(input[i] > input[i-1]) { for(var o = i; o>=0; o--) { if(input[i-1] > input[o]) { input.splice(i,0,input[o]); input.splice((o+1),1); continue entireLoop; } else if(input[o] > input[0]) { input.splice(0,0,input[o]); input.splice((o+1),1); continue entireLoop; } } } } document.write(input); I'm trying to order the array from largest to smallest, but there's a 32 stuck somewhere. I know there's the sort method, but I'm a newbie and want to try this for myself.

    Read the article

  • Set .aspx page title to that of an Eval

    - by user1860529
    I am trying to use an <%# Eval("name") %> to be the title of my page. I can't seem to figure out any solutions online. I have tried the other StackOverflow question but that did now work either. The page is a bio.aspx and on the site it is displayed as bio.aspx?id=123 so the page title needs to vary depending on the ID. I figured I could just use the Eval("name") but no luck yet. I currently am using JavaScript: window.onload = function() { document.title = '<%# Eval("name") %> | Title Line'; } This works, but it still leaves the title tags empty, and it's kind of spammy. Here is the codebehind: using System; using System.Data; using System.Configuration; using System.Collections; using System.Web; using System.Web.Security; using System.Web.UI; using System.Web.UI.WebControls; using System.Web.UI.WebControls.WebParts; using System.Web.UI.HtmlControls; public partial class DoctorBio : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { Page.Title = "Your Page Title"; HtmlMeta metaDescription = new HtmlMeta(); metaDescription.Name = "description"; metaDescription.Content = "brief description"; Page.Header.Controls.Add(metaDescription); HtmlMeta metaKeywords = new HtmlMeta(); metaKeywords.Name = "keywords"; metaKeywords.Content = "keywords, keywords"; Page.Header.Controls.Add(metaKeywords); } protected void SetPageTitle(object title) { this.Title = title.ToString(); } protected string ReplaceLineBreaks(object text) { string newText = text as string; if (newText == null) { return string.Empty; } return newText.Replace("\r\n", "<br />"); } }

    Read the article

  • Add xml-stylesheet and get standalone = yes.

    - by tumba25
    The code at the bottom is what I have. I removed the creation of all tags. At the top in the xml file I get.<?xml version="1.0" encoding="UTF-8" standalone="no"?> Note that standalone is no, even thou I have it set to yes. The first question: How do I get standalone = yes? I would like to add <?xml-stylesheet type="text/xsl" href="my.stylesheet.xsl"?> at line two in the xml file. Second question: How do I do that? Some useful links? Anything? DocumentBuilderFactory dbfac = DocumentBuilderFactory.newInstance(); DocumentBuilder docBuilder = dbfac.newDocumentBuilder(); Document doc = docBuilder.newDocument(); <cut> TransformerFactory transfac = TransformerFactory.newInstance(); transfac.setAttribute("indent-number", new Integer(2)); Transformer trans = transfac.newTransformer(); trans.setOutputProperty(OutputKeys.OMIT_XML_DECLARATION, "no"); trans.setOutputProperty(OutputKeys.STANDALONE, "yes"); trans.setOutputProperty(OutputKeys.INDENT, "yes"); trans.setOutputProperty(OutputKeys.CDATA_SECTION_ELEMENTS, "name"); FileOutputStream fout = new FileOutputStream(filepath); BufferedOutputStream bout= new BufferedOutputStream(fout); trans.transform(new DOMSource(doc), new StreamResult(new OutputStreamWriter(bout, "utf-8")));

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • jQuery/ajax working on IIS5.1 but not IIS6

    - by Mikejh99
    I'm running a weird issue here. I have code that makes jquery ajax calls to a web service and dynamically adds controls using jquery. Everything works fine on my dev machine running IIS 5.1, but not when deployed to IIS 6. I'm using VS2010/ASP.Net 4.0, C#, jQuery 1.4.2 and jQuery UI 1.8.1. I'm using the same browser for each. It partially works though. The code will add the controls to the page, but they aren't visible until I click them (they aren't visible though). I thought this was a css issue, but the styles are there too. The ajax calls look like this: $.ajax({ url: "/WebServices/AssetManager.asmx/Assets", type: "POST", datatype: "json", async: false, data: "{'q':'" + req.term + "', 'type':'Condition'}", contentType: "application/javascript; charset=utf-8", success: function (data) { res($.map(data.d, function (item) { return { label: item.Name, value: item.Name, id: item.Id, datatype: item.DataType } })) } }) Changing the content-type makes the autocomplete fail. I've quadruple checked and all the paths are correct, there is no document footer enabled in IIS, and I'm not using IIS compression. Any idea why the page will display and work properly in IIS 5 but only partially in IIS 6? (If it failed completely, that'd make more sense!). Is it a jQuery or CSS issue?

    Read the article

  • Syntax for documenting JSON structure

    - by Roman A. Taycher
    So I'm trying to document the format of the json returned by an api I am writing against and I'd like to know if there is any popular format for the documentation of json structure. Note I'm not trying to to test or validate anything, I'm just using this for documentation. Also some ways to add comments to non-constants(items always returned w/ the same value) would be nice. This the not totally thought out scheme I'm currently using: Plain names refer to identifiers or types. Some types have type-comment Strings that appear to be constant(always returned for that type of request) strings are "str" Constant Numbers would be just the number Constant null is null Booleans are true/false for constant booleans or Boolean otherwise [a,b,c] are lists with 3 items a,b,c [... ...] is a list of repeating elements of some types/constants/patterns {a:A,b:B,c:c} and {... ...} is the same for a dictionary. example: story := [header,footer] header := {"data":realHeader,"kind":"Listing"} realHeader := {"after": null, "before": null, "children": [{"data": realRealHeader, "kind": "t3"}], "modhash": ""} footer := {"data":AlmostComments,"kind":"Listing"} AlmostComments := {"data": {"after": null, "before": null, "children": comments, "modhash": ""}, "kind": "t1"} comments := [...{"data":comment, "kind":"t1"}...] realRealHeader := {"author": string, "clicked": boolean, "created": int, "created_utc": int, "domain": "code.reddit.com", "downs": int, "hidden": boolean, "id": string-id, "is_self": boolean, "levenshtein": null, "likes": null, "media": null, "media_embed": { }, "name": string-id, "num_comments": int, "over_18": false, "permalink": string-urlLinkToStoryStartingFrom/r, "saved": false, "score": int, "selftext": string, "selftext_html": string-html, "subreddit": string-subredditname, "subreddit_id": string-id, "thumbnail": "", "title": string, "ups": int, "url": "http://code.reddit.com/" } comments := { "author": string, "body": string-body_html-wout-html, "body_html": string-html-formated, "created": int, "created_utc": int, "downs": int, "id": string-id, "levenshtein": null, "likes": null, "link_id": string-id, "name": string-id", "parent_id": string-id, "replies": AlmostComments or null, "subreddit": string-subredditname, "subreddit_id": string-id, "ups": int }

    Read the article

  • Problem uploading app to google app engine

    - by Oberon
    I'm having problems uploading an app to the google-app-engine from my work place. I believe the problem is related to proxy, because I do not see the same problem when following the same procedure from home. (I do not specify HTTP_PROXY from home). These are the commands I run: HTTP_PROXY=http://proxy.<thehostname>.com:8080 HTTP_PROXY=https://proxy.<thehostname>.com:8080 appcfg.py --insecure update myappfolder When running the commands I get prompted for email and password, as expected, but after that it immediately exits with this errormessage: Error 302: --- begin server output --- <HTML> <HEAD> <TITLE>Moved Temporarily</TITLE> </HEAD> <BODY BGCOLOR="#FFFFFF" TEXT="#000000"> <H1>Moved Temporarily</H1> The document has moved <A HREF="https://www.google.com/accounts/ClientLogin">here</A>. </BODY> </HTML> --- end server output --- Note: I added the --insecure option because else it gave a warning of missing ssl module. Any idea how to solve or workaround this problem?

    Read the article

  • calling java script function then C# function after clicking ASP.NET button

    - by Eyla
    I have this serious: I have ASP.NET page, This page contents Update panel with ASP.NET control. I have Java script function to do validation so when I click the button I will use onclientclick to call the java function to do the validation and after this one done should call then event click button function from code behind. I tried vew methods but they did not work for me. here is sample of my code that after I click the button onclientclick will call the java script function for validation and if the validation is OK should call onclick event. .................... java script function ........................ <script type="text/javascript" > function add(){ if (tag == trye) { document.getElementById('<%=btnInfor.ClientID%>').click(); alert("DataAdded") } else { alert("Requiered Field Missing.") return false; } } </script> ..................... ASP.NET button ................... <asp:Button ID="btnInfor" runat="server" Text="Add Information" Style="position: absolute; top: 1659px; left: 433px;" onclientclick="JavaScript: return myAdd()" /> .................... code behind in C# ...................... protected void btnInfor_Click(object sender, EventArgs e) { \\mycode }

    Read the article

< Previous Page | 594 595 596 597 598 599 600 601 602 603 604 605  | Next Page >