Search Results

Search found 17194 results on 688 pages for 'document databases'.

Page 595/688 | < Previous Page | 591 592 593 594 595 596 597 598 599 600 601 602  | Next Page >

  • Trying to fadein divs in a sequence, over time, using JQuery

    - by user346602
    Hi, I'm trying to figure out how to make 4 images fade in sequentially when the page loads. The following is my (amateurish) code: Here is the HTML: <div id="outercorners"> <img id="corner1" src="images/corner1.gif" width="6" height="6" alt=""/> <img id="corner2" src="images/corner2.gif" width="6" height="6" alt=""/> <img id="corner3" src="images/corner3.gif" width="6" height="6" alt=""/> <img id="corner4" src="images/corner4.gif" width="6" height="6" alt=""/> </div><!-- end #outercorners--> Here is the JQuery: $(document).ready(function() { $("#corner1").fadeIn("2000", function(){ $("#corner3").fadeIn("4000", function(){ $("#corner2").fadeIn("6000", function(){ $("#corner4").fadeIn("8000", function(){ }); }); }); }); Here is the css: #outercorners { position: fixed; top:186px; left:186px; width:558px; height:372px; } #corner1 { position: fixed; top:186px; left:186px; display: none; } #corner2 { position: fixed; top:186px; left:744px; display: none; } #corner3 { position: fixed; top:558px; left:744px; display: none; } #corner4 { position: fixed; top:558px; left:186px; display: none; } They seem to just wink at me, rather than fade in in the order I've ascribed to them. Should I be using the queue() function? And, if so, how would I implement it in this case? Thank you for any assistance.

    Read the article

  • How do I implement "cash out" on my site using PayPal?

    - by Alex
    I have a credit system set up on my site where user A can purchase a document from user B, let's say for 1 credit and user B's account gets credited, let's say for $1. User B can then "cash out" and recieve the money they earned from my (the site's) PayPal account into their PayPal account (let's assume that their email address is valid for now). When user A purchases a credit, they are taken to PayPal where they can login and complete the purchase, for this purpose I have an IPN listener set up on my site that stores credit information to my site's database. However, I can't find a mechanism to send the "cash out" information (i.e. user's email and amount to be paid) to PayPal. To elaborate: I understand that PayPal sends the IPN when someone purchases from me, but how do I post from my site to PayPal when the user clicks the "cash out" button? I have seen mention of Mass Pay, but can't seem to locate any code samples to go from. Am I missing something, or is there perhaps a different (and better) way to do this? Thanks!

    Read the article

  • why the main method are not covered? urgent, please help me

    - by Mike.Huang
    main method: public static void main(String[] args) throws Exception { if (args.length != EXPECTED_NUMBER_OF_ARGUMENTS) { System.err.println("Usage - java XFRCompiler ConfigXML PackageXML XFR"); } String configXML = args[0]; String packageXML = args[1]; String xfr = args[2]; AutoConfigCompiler compiler = new AutoConfigCompiler(); compiler.setConfigDocument(loadDocument(configXML)); compiler.setPackageInfoDoc(loadDocument(packageXML)); // compiler.setVisiblityDoc(loadDocument("VisibilityFilter.xml")); compiler.compileModel(xfr); } private static Document loadDocument(String fileName) throws Exception { TXDOMParser parser = (TXDOMParser) ParserFactory.makeParser(TXDOMParser.class.getName()); InputSource source = new InputSource(new FileInputStream(fileName)); parser.parse(source); return parser.getDocument(); } testcase: @Test public void testCompileModel() throws Exception { // construct parameters URL configFile = Thread.currentThread().getContextClassLoader().getResource("Ford_2008_Mustang_Config.xml"); URL packageFile = Thread.currentThread().getContextClassLoader().getResource("Ford_2008_Mustang_Package.xml"); File tmpFile = new File("Ford_2008_Mustang_tmp.xfr"); if(!tmpFile.exists()) { tmpFile.createNewFile(); } String[] args = new String[]{configFile.getPath(),packageFile.getPath(),tmpFile.getPath()}; try { // test main method XFRCompiler.main(args); } catch (Exception e) { assertTrue(true); } try { // test args length is less than 3 XFRCompiler.main(new String[]{"",""}); } catch (Exception e) { assertTrue(true); } tmpFile.delete(); } coverage outputs displayed as the lines from “String configXML = args[0];" in main method are not covered

    Read the article

  • jquery load returns empty, possible MVC 2 problem?

    - by Max Fraser
    I have a site that need to get some data from a different sit that is using asp.net MVC/ The data to get loaded is from these pages: http://charity.hondaclassic.com/home/totaldonations http://charity.hondaclassic.com/Home/CharityList This should be a no brainer but for some reason I get an empty response, here is my JS: <script> jQuery.noConflict(); jQuery(document).ready(function($){ $('.totalDonations').load('http://charity.hondaclassic.com/home/totaldonations'); $('#charityList').load('http://charity.hondaclassic.com/home/CharityList'); }); </script> in firebug I see the request is made and come back with a response of 200 OK but the response is empty, if you browse to these pages they work fine! What the heck? Here are the controller actions from the MVC site: public ActionResult TotalDonations() { var total = "$" + repo.All<Customer>().Sum(x => x.AmountPaid).ToString(); return Content(total); } public ActionResult CharityList() { var charities = repo.All<Company>(); return View(charities); } Someone please out what stupid little thing I am missing - this should have taken me 5 minutes and it's been hours!

    Read the article

  • JQuery Dragging Outside Parent

    - by Andy
    I'm using JQuery's draggable(); to make li elements draggable. The only problem is when the element is dragged outside its parent, it doesn't show up. That is, it doesn't leave the confines of its parent div. An example is here: http://imgur.com/N2N1L.png - it's as if the z-index for everything else has greater priority (and the element slides under everything). Here's the code: $('.photoList li').draggable({ distance: 20, snap: theVoteBar, revert: true, containment: 'document' }); And the li elements are placed in DIVs like this: <div class="coda-slider preload" id="coda-slider-1"> <div class="panel"> <div class="panel-wrapper"> <h2 class="title" style="display:none;">Page 1</h2> <ul class="photoList"> <li> <img class="ui-widget-content" src="photos/1.jpg" style="width:100px;height:100px;" /> </li> </ul> </div> </div> I'm positive the problem is it won't leave its parent container, but I'm not sure what to do to get it out. Any direction or help would be appreciated GREATLY!

    Read the article

  • Remove second class from an element and add another class

    - by rahul
    Hi, $(document).ready ( function () { $(".MenuItem").mouseover ( function () { // Remove second class and add another class [ Maintain MenuItem class ] // Eg: For div1 remove Sprite1 and then add Sprite1Dis and for div2 // remove Sprite2 and add Spprite2Dis }); $(".MenuItem").mouseout ( function () { // Reverse of mouseover. ie Remove Sprite1Dis and add Sprite1 }); }); <div id="div1" class="MenuItem Sprite1"> &nbsp; </div> <div id="div2" class="MenuItem Sprite2"> &nbsp; </div> <div id="div3" class="MenuItem Sprite3"> &nbsp; </div> <div id="div4" class="MenuItem Sprite4"> &nbsp; </div> <div id="div5" class="MenuItem Sprite5"> &nbsp; </div> <div id="div6" class="MenuItem Sprite6"> &nbsp; </div> My problem is listed as comment inside the code section. What will be the easiest way to achieve this? Thanks in advance

    Read the article

  • Issue reading in a cell from Excel with Apache POI

    - by Nick
    I am trying to use Apache POI to read in old (pre-2007 and XLS) Excel files. My program goes to the end of the rows and iterates back up until it finds something that's not either null or empty. Then it iterates back up a few times and grabs those cells. This program works just fine reading in XLSX and XLS files made in Office 2010. I get the following error message: Exception in thread "main" java.lang.NumberFormatException: empty String at sun.misc.FloatingDecimal.readJavaFormatString(Unknown Source) at java.lang.Double.parseDouble(Unknown Source) at the line: num = Double.parseDouble(str); from the code: str = cell.toString(); if (str != "" || str != null) { System.out.println("Cell is a string"); num = Double.parseDouble(str); } else { System.out.println("Cell is numeric."); num = cell.getNumericCellValue(); } where the cell is the last cell in the document that's not empty or null. When I try to print the first cell that's not empty or null, it prints nothing, so I think I'm not accessing it correctly.

    Read the article

  • Event type property lost in IE-8

    - by Channel72
    I've noticed a strange Javascript error which only seems to happen on Internet Explorer 8. Basically, on IE-8 if you have an event handler function which captures the event object in a closure, the event "type" property seems to become invalidated from within the closure. Here's a simple code snippet which reproduces the error: <html> <head> <script type = "text/javascript"> function handleClickEvent(ev) { ev = (ev || window.event); alert(ev.type); window.setTimeout(function() { alert(ev.type); // Causes error on IE-8 }, 20); } function foo() { var query = document.getElementById("query"); query.onclick = handleClickEvent; } </script> </head> <body> <input id = "query" type = "submit"> <script type = "text/javascript"> foo(); </script> </body> </html> So basically, what happens here is that within the handleClickEvent function, we have the event object ev. We call alert(ev.type) and we see the event type is "click". So far, so good. But then when we capture the event object in a closure, and then call alert(ev.type) again from within the closure, now all of a sudden Internet Explorer 8 errors, saying "Member not found" because of the expression ev.type. It seems as though the type property of the event object is mysteriously gone after we capture the event object in a closure. I tested this code snippet on Firefox, Safari and Chrome, and none of them report an error condition. But in IE-8, the event object seems to become somehow invalidated after it's captured in the closure. Question: Why is this happening in IE-8, and is there any workaround?

    Read the article

  • How to emulate mod_rewrite in PHP

    - by Tyler Crompton
    I have a few URLs that I want to map to certain files via PHP. Currently, I am just using mod_rewrite in Apache. However, my application is getting too large for the rewriting to be done with regular expressions. So I created a file router.php that does the rewriting. I understand to do a redirect I could just send the Location: header. However, I don't always want to do a redirect. For example, I may want /api/item/ to map to the file /herp/derp.php relative to the document root. I need to preserve the HTTP method as well. "No problem," I thought. I made my .htaccess have the following snippet. RewriteEngine On RewriteRule ^api/item/$ /cgi-bin/router.php [L] And my router.php file looks as follows: <?php $uri = parse_url($_SERVER['REQUEST_URI']); $query = isset($uri['query']) ? $uri['query'] ? array(); // some code that modifies the query require_once "{$_SERVER['DOCUMENT_ROOT']}/herp/derp.php?" . http_build_query($query); ?> However, this doesn't work, because the OS is looking for a file named derp.php?some=query. How can I simulate a rewrite rule such as RewriteRule ^api/item/$ /herp/derp/ [L] in PHP. In other words, how do I tell the server to process a different URL than requested and preserve the query and HTTP method without causing a redirect? Note: Using variables set in router.php is less than desirable and is bad structure since it's only supposed to be responsible for handling URLs. I am open to using a light-weight third party solution.

    Read the article

  • javascript: waiting for an iframe page to load before writing to it (but not from the page that's tr

    - by Bill Dawes
    Apologies if this has been answered elsewhere, but I haven't been able to find it referenced. (Probably because nobody else would want to do such a daft thing, I admit). So, I have a page with three iframes in it. An event on one triggers a javascript function which loads new pages into the other two iframes; ['topright'] and ['bottomright']. However, javascript in the page that is being loaded into iframe 'topright' then needs to send information to elements in the 'bottomright' iframe. window.frames['bottomright'].document.subform.ID_client = client; etc But this will only work if the page has fully loaded into the bottomright frame. So what would be the most efficient way for that code in the 'topright' iframe to check and ensure that that form element in the bottomright frame is actually available to write to, before it does write to it? Bearing in mind that the page load has NOT been triggered from the topright frame, so I can't simply use an onLoad function. (I know this probably sounds like a hideously tortuous route for getting data from one page to another, but that's another story. The client is always right, etc...:-))

    Read the article

  • Jquery cant get facebox working inside ajax call

    - by John
    From my main page I call an ajax file via jquery, in that ajax file is some additional jquery code. Original link looks like this: <a href="/page1.php" class="guest-action notify-function"><img src="/icon1.png"></a> Then the code: $(document).ready(function(){ $('a[rel*=facebox]').facebox(); $('.guest-action').click( function() { $.get( $(this).attr('href'), function(responseText) { $.jGrowl(responseText); }); return false; }); $('.notify-function').click( function() { $(this).find('img').attr('src','/icon2.png'); $(this).attr('href','/page2.php'); $(this).removeClass('guest-action').removeClass('notify-function').attr('rel','facebox'); }); }); So basically after notify-function is clicked I am changing the icon and the url of the link, I then am removing the classes so that the click wont be ran again and add rel="facebox" to the link so that the facebox window will pop up if they try to click the new icon2.png that shows up. The problem is after I click the initial icon everything works just fine except when I try to click the new icon2.png it still executes the jgrowl code from the guest-action. But when I view the source it shows this: <a href="/page2.php" rel="facebox" class=""><img src="/icon2.png"></a> So it seemed that should work right? What am I doing wrong? I tried adding the facebox code to the main page that is calling the ajax file as well and still same issue.

    Read the article

  • How do I animate text links in jquery?

    - by Peter
    I am somewhat new to jquery and I have a problem with something I am trying to implement using jquery. I have a vertical navigation menu where each link animates on hover by changing color, increasing letter spacing, and adding a border on the left. Everything is working the way I want it to except for when I click on the link. After I click on the link, the text changes to a different color and remains that same color even when I hover over the link. I am wanting to make it to where the color change on hover remains intact even after I click the link. I'm sure I am missing something simple, but I have tried everything I know to do with no luck. Any suggestions would be helpful! Here is what I have for the animation... <script type="text/javascript"> $(document).ready(function(){ $("ul.navlist li a").hover(function(){ $(this).stop() .animate({paddingLeft: '10px',letterSpacing: '2px',borderWidth:'20px'},{queue:false,easing:'easeInQuad'},50) }, function(){ $(this).stop() .animate({paddingLeft: '0px', letterSpacing: '0px',borderWidth:'0px'},{queue:false,easing:'easeOutQuad'},50) }); }); </script> My css for the navigation list is here... .navlist { list-style: none; } .navlist a { border-left-color: #555555; border-left-style: solid; border-left-width: 0px; color: #c4c4c4; } .navlist a:hover { border-left-color: #555555; border-left-style: solid; color: #555555; }

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • asp.net jquery how to use Plugin/Validation with web content

    - by Eyla
    I have a asp.net web content from that have a asp.net textbox and I want to use Plugin/Validation but it is not working with me here is my code: <%@ Page Title="" Language="C#" MasterPageFile="~/Master.Master" AutoEventWireup="true" CodeBehind="WebForm1.aspx.cs" Inherits="IMAM_APPLICATION.WebForm1" %> <%@ Register assembly="AjaxControlToolkit" namespace="AjaxControlToolkit" tagprefix="asp" %> <asp:Content ID="Content1" ContentPlaceHolderID="head" runat="server"> <script src="js/jquery-1.4.1.js" type="text/javascript"></script> <script src="js/jquery.validate.js" type="text/javascript"></script> <script type="text/javascript"> $(document).ready(function() { $.validator.addMethod("#<%=TextBox1.ClientID %>", function(value, element) { return this.optional(element) || /^(?=.*\d)(?=.*[a-z])(?=.*[A-Z]).{8,16}$/i.test(value); }, "Passwords are 8-16 characters with uppercase letters, lowercase letters and at least one number."); }); </script> </asp:Content> <asp:Content ID="Content2" ContentPlaceHolderID="ContentPlaceHolder1" runat="server"> </asp:Content> <asp:Content ID="Content3" ContentPlaceHolderID="ContentPlaceHolder2" runat="server"> <asp:TextBox ID="TextBox1" runat="server"></asp:TextBox> </asp:Content>

    Read the article

  • add dynamic field near his parent field?

    - by Kaps Hasija
    hi in my web page i am using Add Dynamic Field Functionality by using jquery. I am adding new div bu clicking on Existing div Like <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> by clicking on parent div i am creating new daynamic div <div class="divA">DivA2 </div> its coming end of the all div's like that <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> <div class="divA">DivA2 </div> But i need along with his parent div Like that <div class="divA">divA1 </div> <div class="divA">DivA2 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> any idea Thanks. This is My Jquery Code newTextBoxDiv = $(document.createElement('div')) .attr("id", text).attr("class", 'test0 ' + text); newTextBoxDiv.html('<div style=" width:150px; class="DivA" float: left"> </div>'); } newTextBoxDiv.appendTo("#contents"); contents is id of main div

    Read the article

  • How to make HTML layout whitespace-agnostic?

    - by ssg
    If you have consecutive inline-blocks white-space becomes significant. It adds some level of space between elements. What's the "correct" way of avoiding whitespace effect to HTML layout if you want those blocks to look stuck to each other? Example: <span>a</span> <span>b</span> This renders differently than: <span>a</span><span>b</span> because of the space inbetween. I want whitespace-effect to go away without compromising HTML source code layout. I want my HTML templates to stay clean and well-indented. I think these options are ugly: 1) Tweaking text-indent, margin, padding etc. (Because it would be dependent on font-size, default white-space width etc) 2) Putting everything on a single line, next to each other. 3) Zero font-size. That would require overriding font-size in blocks, which would otherwise be inherited. 4) Possible document-wide solutions. I want the solution to stay local for a certain block of HTML. Any ideas, any obvious points which I'm missing?

    Read the article

  • jquery image fading with tabs

    - by StealthRT
    Hey all, i am trying my best to figure out how to go about doing this: I have 2 tabs. When the page loads tab1 is selected automatically. This shows the tab as 1.0 transparency while tab2 stays at 0.7. Once the user clicks on tab2, tab1 goes to 0.7 transparency and tab2 goes to 1.0. However, i can not seem to get it to do that! Here is my code: <script type="text/javascript"> function checkTab(theTab) { $('#tab1').fadeTo(250, 0.70); $('#tab2').fadeTo(250, 0.70); if ($("#tabActive").val() == theTab) { $(theTab).fadeTo(250, 1); } } $(document).ready(function() { $('#tab1').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab1')}); $('#tab2').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab2')}); $('#tab2').fadeTo(250, 0.70); $('#tabActive').val('tab1'); }); </script> <li class="stats"><img src="images/Stats.png" name="nav1" width="70" height="52" id="tab1" onclick="$('#tabActive').val('tab1');" /></li> <li class="cal"><img src="images/cal.png" name="nav1" width="70" height="52" id="tab2" onclick="$('#tabActive').val('tab2');" /></li> <input name="tabActive" id="tabActive" type="text" /> Any help would be great! :) David

    Read the article

  • Javascript onclick() event bubbling - working or not?

    - by user1071914
    I have a table in which the table row tag is decorated with an onclick() handler. If the row is clicked anywhere, it will load another page. In one of the elements on the row, is an anchor tag which also leads to another page. The desired behavior is that if they click on the link, "delete.html" is loaded. If they click anywhere else in the row, "edit.html" is loaded. The problem is that sometimes (according to users) both the link and the onclick() are fired at once, leading to a problem in the back end code. They swear they are not double-clicking. I don't know enough about Javascript event bubbling, handling and whatever to even know where to start with this bizarre problem, so I'm asking for help. Here's a fragment of the rendered page, showing the row with the embedded link and associated script tag. Any suggestions are welcomed: <tr id="tableRow_3339_0" class="odd"> <td class="l"></td> <td>PENDING</td> <td>Yabba Dabba Doo</td> <td>Fred Flintstone</td> <td> <a href="/delete.html?requestId=3339"> <div class="deleteButtonIcon"></div> </a> </td> <td class="r"></td> </tr> <script type="text/javascript">document.getElementById("tableRow_3339_0").onclick = function(event) { window.location = '//edit.html?requestId=3339'; };</script>

    Read the article

  • How do I use HTML5's localStorage in a Google Chrome extension?

    - by davidkennedy85
    I am trying to develop an extension that will work with Awesome New Tab Page. I've followed the author's advice to the letter, but it doesn't seem like any of the script I add to my background page is being executed at all. Here's my background page: <script> var info = { poke: 1, width: 1, height: 1, path: "widget.html" } chrome.extension.onRequestExternal.addListener(function(request, sender, sendResponse) { if (request === "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-poke") { chrome.extension.sendRequest( sender.id, { head: "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-pokeback", body: info, } ); } }); function initSelectedTab() { localStorage.setItem("selectedTab", "Something"); } initSelectedTab(); </script> Here is manifest.json: { "update_url": "http://clients2.google.com/service/update2/crx", "background_page": "background.html", "name": "Test Widget", "description": "Test widget for mgmiemnjjchgkmgbeljfocdjjnpjnmcg.", "icons": { "128": "icon.png" }, "version": "0.0.1" } Here is the relevant part of widget.html: <script> var selectedTab = localStorage.getItem("selectedTab"); document.write(selectedTab); </script> Every time, the browser just displays null. The local storage isn't being set at all, which makes me think the background page is completely disconnected. Do I have something wired up incorrectly?

    Read the article

  • How to only fade content once it is ready in Jquery?

    - by Jared
    Hello, I've seen examples for load() and ready(), but they always seem to apply to the window or document body, or a div or img or something like that. I have a hover() function, and when you hover over it, it uses fadeIn() to reveal it. Problem is, the images inside the div aren't loaded yet, so it ends up just appearing anyway. I need code that will only allow the image to fade when it's contents are fully loaded. When I just plug in other selectors like the following, it doesn't work $(this).next(".menuPopup").ready(function () { //or load(), neither work fadeTo(300, 1); }); EDIT: Relevant code $( '.leftMenuProductButton' ).hover ( function () { $(this).next(".menuPopup").stop().css("opacity", 1).fadeIn('slow'); }, function () { $(this).next(".menuPopup").stop().hide(); }); HTML <div class="leftMenuProductButton"> Product 1</div> <div id="raceramps56" class="menuPopup"><IMG SRC="myimage.jpeg"> </div>

    Read the article

  • [jquery] multiple resizables acting strange

    - by Noweem
    Hi there everyone, I'm trying to place multiple resizable and draggable div's on one page that move (vertically) inside their own parent div. you can take a look at http://bit.ly/bCutBE However, these div's act really strange when I want to resize them, especially from the north side, they kind of move out of the screen very fast, while they shouldn't be able to get outside the parent div. I only want the div to be able to move and resize vertically inside it's parent, the dragging-part works pretty good, but the resize part give this problem. I can't really describe it better than this, but take a look for yourself and it will be clear immediately when you try to resize one of the coloured div's: move it a little downwards and try to resize it from the north side. the problem seems to be caused by the containment: 'parent', line of the resizable. when I delete this line it works fine, but then the coloured blocks don't stay in their parent, and I want them to stay inside their parent. I hope someone can help me with this... the jquery code I used: $(document).ready(function(){ $(".move") .draggable({ containment: 'parent', grid: [50,50], axis: 'y' }) .resizable({ containment: 'parent', grid: [50,50], handles: 'n, s', minHeight: 50 }); });

    Read the article

  • Django Template For Loop Removing <img> Self-Closing

    - by Zack
    Django's for loop seems to be removing all of my <img> tag's self-closing...ness (/>). In the Template, I have this code: {% for item in item_list %} <li> <a class="left" href="{{ item.url }}">{{ item.name }}</a> <a class="right" href="{{ item.url }}"> <img src="{{ item.icon.url }}" alt="{{ item.name }} Logo." /> </a> </li> {% endfor %} It outputs this: <li> <a class="left" href="/some-url/">This is an item</a> <a class="right" href="/some-url/"> <img src="/media/img/some-item.jpg" alt="This is an item Logo."> </a> </li> As you can see, the <img> tag is no longer closed, and thus the page doesn't validate. This isn't a huge issue since it'll still render properly in all browsers, but I'd like to know how to solve it. I've tried wrapping the whole for loop in {% autoescape off %}...{% endautoescape %} but that didn't change anything. All other self-closed <img> tags in the document outside the for loop still properly close.

    Read the article

  • Handling Types Defined in Plug-ins That Are No Longer Available

    - by Chris
    I am developing a .NET framework application that allows users to maintain and save "projects". A project can consist of components whose types are defined in the assemblies of the framework itself and/or in third-party assemblies that will be made available to the framework via a yet-to-be-built plug-in architecture. When a project is saved, it is simply binary-serialised to file. Projects are portable, so multiple users can load the same project into their own instances of the framework (just as different users may open the same MSWord document in their own local copies of MSWord). What's more, the plug-ins available to one user's framework might not be available to that of another. I need some way of ensuring that when a user attempts to open (i.e. deserialise) a project that includes a type whose defining assembly cannot be found (either because of a framework version incompatibility or the absence of a plug-in), the project still opens but the offending type is somehow substituted or omitted. Trouble is, the research I've done to date does not even hint at a suitable approach. Any ideas would be much appreciated, thanks.

    Read the article

  • Why this class assignment is not working in IE

    - by user550750
    I've wrote this peice of code, this works fine in FF and Chrome but not in IE. Why is it? <html> <header> <style type="text/css"> .red{ color: red; } .green{ color: green; } .yellow{ color: yellow; } </style> </header> <body> <div id="mydiv" style="height: 50px">Some contents</div> <div> <input type="radio" value="1" name="change" onclick="onClick(this)">Red</input> <input type="radio" value="2" name="change" onclick="onClick(this)">Green</input> <input type="radio" value="3" name="change" onclick="onClick(this)">Yellow</input> </div> <script type="text/javascript"> function onClick(el){ var className = ""; if(el.value == 1){ className = "red"; }else if(el.value == 2){ className = "green"; }else if(el.value == 3){ className = "yellow"; } document.getElementById("mydiv").setAttribute("class", className); } </script> </body> </html>

    Read the article

  • Unable to send '+' through AJAX post?

    - by Harish Kurup
    I am using Ajax POST method to send data, but i am not able to send '+'(operator to the server i.e if i want to send 1+ or 20k+ it will only send 1 or 20k..just wipe out '+') HTML code goes here.. <form method='post' onsubmit='return false;' action='#'> <input type='input' name='salary' id='salary' /> <input type='submit' onclick='submitVal();' /> </form> and javascript code goes here, function submitVal() { var sal=document.getElementById("salary").value; alert(sal); var request=getHttpRequest(); request.open('post','updateSal.php',false); request.setRequestHeader("Content-Type","application/x-www-form-urlencoded"); request.send("sal="+sal); if(request.readyState == 4) { alert("update"); } } function getHttpRequest() { var request=false; if(window.XMLHttpRequest) { request=new XMLHttpRequest(); } else if(window.ActiveXObject) { try { request=new ActiveXObject("Msxml2.XMLHTTP"); } catch(e) { try { request=new ActiveXObject("Microsoft.XMLHTTP"); } catch(e) { request=false; } } } return request; } in the function submitVal() it first alert's the salary value as it is(if 1+ then alerts 1+), but when it is posted it just post's value without '+' operator which is needed... is it any problem with query string, as the PHP backend code is working fine...

    Read the article

< Previous Page | 591 592 593 594 595 596 597 598 599 600 601 602  | Next Page >