Search Results

Search found 137 results on 6 pages for 'atg'.

Page 6/6 | < Previous Page | 2 3 4 5 6 

  • 2012 Oracle Fusion Innovation Awards - Part 2

    - by Michelle Kimihira
    Author: Moazzam Chaudry Continuing from Friday's blog on 2012 Oracle Fusion Innovation Awards, this blog (Part 2) will provide more details around the customers. It was a tremendous honor to be in single room of winners. We only wish we could have had more time to share stories from all the winners.  We received great insight from all the innovative solutions that our customers deploy and would like to share them broadly, so that others can benefit from best practices. There was a customer panel session joined by Ingersoll Rand, Nike and Motability and here is what was discussed: Barry Bonar, Enterprise Architect from Ingersoll Rand shared details around their solution, comprised of Oracle Exalogic, Oracle WebLogic Server and Oracle SOA Suite. This combined solutoin enabled their business transformation to increase decision-making, speed and efficiency, resulting in 40% reduced IT spend, 41X Faster response time and huge cost savings. Ashok Balakrishnan, Architect from Nike shared how they leveraged Oracle Coherence to analyze their digital "footprint" of activities. This helps them compete, collaborate and compare athletic data over time. Lastly, Ashley Doodly, Head of IT from Motability shared details around their solution compromised of Oracle SOA Suite, Service Bus, ADF, Coherence, BO and E-Business Suite. This solution helped Motability achieve 100% ROI within the first few months, performance in seconds vs. 10's of minutes and tremendous improvement in throughput that increased up to 50%.  This year's winners by category are: Oracle Exalogic Customer Results using Fusion Middleware Netshoes ATG on Exalogic: 6X Reduced H/W foot print, 6.2X increased throughput and 3 weeks time to market Claro Part of America Movil, running mission critical Java Application on Exalogic with 35X Faster Java response time, 5X Throughput Underwriters Laboratories Exalogic as an Apps Consolidation platform to power tremendous growth Ingersoll Rand EBS on Exalogic: Up to 40% Reduction in overall IT budget, 3x reduced foot print Oracle Cloud Application Foundation Customer Results using Fusion Middleware  Mazda Motor Corporation Tuxedo ART Batch runtime environment to migrate their batch apps on new open environment and reduce main frame cost. HOTELBEDS Technology Open Source to WebLogic transformation Globalia Corporation Introduced Oracle Coherence to fully reengineer DTH system and provide multiple business and technical benefits Nike Nike+, digital sports platform, has 8M users and is expecting an 5X increase in users, many of who will carry multiple devices that frequently sync data with the Digital Sport platform Comcast Corporation The solution is expected to increase availability, continuity, performance, and simplify and make the code at the application layer more flexible. Oracle SOA and Oracle BPM Customer Results using Fusion Middleware NTT Docomo Network traffic solution based on Oracle event processing and coherence - massive in scale: 12M users (50M in future) - 800,000 events/sec. Schneider National, Inc. SOA/B2B/ADF/Data Integration to orchestrate key order processes across Siebel, OTM & EBS.  Platform runs 60M trans/day and  50 million composite SOA instances per day across 10G and 11G Amadeus Oracle BPM solution: Business Rules and processes vary across local (80), regional (~10) and corporate approval process. Up to 10 levels of approval. Plans to deploy across 20+ markets Navitar SOA solution integrates a fully non-Oracle legacy application/ERP environment using Oracle’s SOA Suite and Oracle AIA Foundation Pack. Motability Uses SOA Suite to synchronize data across the systems and to manage the vehicle remarketing process Oracle WebCenter Customer Results using Fusion Middleware  News Limited Single platform running websites for 50% of Australia's newspapers University of Louisville “Facebook for Medicine”: Oracle Webcenter platform and Oracle BIEE to analyze patient test data and uncover potential health issues. Expecting annualized ROI of 277% China Mobile Jiangsu Company portal (25k users) to drive collaboration & productivity Life Technologies Portal for remotely monitoring & repairing biotech instruments LA Dept. of Water & Power Oracle WebCenter Portal to power ladwp.com on desktop and mobile for 1.6million users Oracle Identity Management Customer Results using Fusion Middleware Education Testing Service Identity Management platform for provisioning & SSO of 6 million GRE, GMAT, TOEFL customers Avea Oracle Identity Manager allowing call center personnel to quickly change Identity Profile to handle varying call loads based on a user self service interface. Decreased Admin Cost by 30% Oracle Data Integration Customer Results using Fusion Middleware Raymond James Near real-time integration for improved systems (throughput & performance) and enhanced operational flexibility in a 24 X 7 environment Wm Morrison Supermarkets Electronic Point of Sale integration handling over 80 million transactions a day in near real time (15 min intervals) Oracle Application Development Framework and Oracle Fusion Development Customer Results using Fusion Middleware Qualcomm Incorporated Solution providing  immediate business value enabling a self-service model necessary for growing the new customer base, an increase in customer satisfaction, reduced “time-to-deliver” Micros Systems, Inc. ADF, SOA Suite, WebCenter  enables services that include managing distribution of hotel rooms availability and rates to channels such as Hotel Web-site, Expedia, etc. Marfin Egnatia Bank A new web 2.0 UI provides a much richer experience through the ADF solution with the end result being one of boosting end-user productivity    Business Analytics (Oracle BI, Oracle EPM, Oracle Exalytics) Customer Results using Fusion Middleware INC Research Self-service customer portal delivering 5–10% of the overall revenue - expected to grow fast with the BI solution Experian Reduction in Time to Complete the Financial Close Process Hologic Inc Solution, saving months of decision-making uncertainty! We look forward to seeing many more innovative nominations. The nominatation process for 2013 begins in April 2013.    Additional Information: Blog: Oracle WebCenter Award Winners Blog: Oracle Identity Management Winners Blog: Oracle Exalogic Winners Blog: SOA, BPM and Data Integration will be will feature award winners in its respective areas this week Subscribe to our regular Fusion Middleware Newsletter Follow us on Twitter and Facebook

    Read the article

  • PRUEBAS DE ESPECIALIZACION 2013/2014

    - by agallego
    Consigue  tu Certificado de Especialista Oracle  de forma GRATUITA , 27 y 28 de Noviembre de 2013  Ahora puedes realizar los exámenes de implementación de las especializaciones de Oracle y convertirte en especialista. Podrás realizar cualquiera de los exámenes de implementación de la siguiente lista: Oracle Fusion Customer Relationship Management 11g Sales Certified Implementation Specialist (1Z0-456) Oracle Fusion Customer Relationship Management 11g Incentive Compensation Certified Implementation Specialist (1Z0-472) Oracle ATG Web Commerce 10 Implementation Developer Certified Implementation Specialist (1Z0-510) Oracle RightNow CX Cloud Service 2012 Certified Implementation Specialist (1Z0-465) Oracle RightNow CX Cloud Service 2012 Developer Certified Implementation Specialist (1Z0-480) Oracle Fusion Human Capital Management 11g Human Resources Certified Implementation Specialist (1Z0-584) Oracle Fusion Human Capital Management 11g Talent Management Certified Implementation Specialist (1Z0-585) Oracle Taleo Recruiting Cloud Service 2013 Certified Implementation Specialist  (1Z0-474) Oracle Fusion Financials 11g Accounts Payable Certified Implementation Specialist(1Z0-507) Oracle Fusion Financials 11g Accounts Receivable Certified Implementation Specialist(1Z0-506) Oracle Fusion Financials 11g General Ledger Certified Implementation Specialist (1Z0-508) Oracle Fusion Distributed Order Orchestration 11g Essentials (1Z0-469) Oracle Documaker Standard Edition 12 Implementation Essentials (1Z0-570) Oracle Hyperion Planning 11 Essentials (1Z0-533) Oracle Hyperion Financial Management 11 Essentials (1Z0-532) Oracle Business Intelligence Foundation Suite 11g Essentials (1Z0-591) Oracle Essbase 11 Essentials (1Z0-531) Oracle GoldenGate 10 Essentials (1Z0-539) Oracle GoldenGate 11g Certified Implementation Exam Essentials Oracle Business Intelligence Applications 7.9.6 for CRM Essentials (1Z0-524) Oracle Business Intelligence Applications 7.9.6 for ERP Essentials (1Z0-525) Oracle Oracle Endeca Information Discovery 2.3 Certified Implementation Specialist (1Z0-461) Oracle SOA Suite 11g Essentials (1Z0-478) Oracle Service-Oriented Architecture Certified Implementation Specialist (1Z0-451) Oracle Unified Business Process Management Suite 11g Certified Implementation Specialist (1Z0-560) Oracle WebLogic Server 12c Certified Implementation Specialist (1Z0-599) Oracle Application Grid Certified Implementation Specialist(1Z0-523) Oracle WebCenter Content 11g Essentials (1Z0-542) Oracle WebCenter Portal 11g Essentials (1Z0-541) Oracle Application Development Framework Essentials (1Z1-554) Oracle Identity Governance Suite 11g Essentials(1z0-459) Oracle Access Management Suite Plus 11g Essentials Exam(1z0-479) M2M Platform Certified Architecture Essentials (1Z0-467) Oracle WebCenter Sites 11g Certified Implementation Specialist (1Z0-462)  Oracle Cloud Application Foundation Essentials(1Z0-468) Oracle Exadata 11g Essentials (1Z0-536) Exadata Database Machine Models X3-2 and X3-8 Certified Implementation Specialist (1Z0-485) Oracle Certified Expert, Oracle Exadata X3 Administration(1Z0-027) Exalogic Elastic Cloud X2-2 Certified Implementation Specialist (1Z0-569) Oracle Linux System Administration (1Z0-403) Oracle Linux Fundamentals (1Z0-402) Oracle Linux 6 Certified Implementation Specialist (1Z0-460) Oracle VM 3 for x86 Certified Implementation Specialist (1Z0-590) Oracle Enterprise Manager 11g Essentials  (1Z0-530 ) Oracle Enterprise Manager 12c Essentials (1Z0-457) SPARC T4-Based Server Installation Essentials (1Z0-597) 1Z0-821 Oracle Solaris 11 System Administration 1Z0-822 Oracle Solaris 11 Advanced System Administration Oracle Solaris 11 Installation and Configuration Essentials (1Z0-580) StorageTek Tape Libraries Certified Implementation Specialist(1Z0-546) Sun ZFS Storage Appliance Certified Implementation Specialist The Primavera P6 Enterprise Project Portfolio Management 8 Essentials (1Z0-567) The Primavera Portfolio Management Essentials (1Z0-544) Primavera Contract Management 14 Certified Implementation Specialist (1Z0-582) Oracle Utilities Customer Care and Billing 2 Certified Implementation Specialist (1Z0-562) Oracle Policy Automation 10 Certified Implementation Specialist (1Z0-534) Oracle User Productivity Kit 11 Certified Implementation Specialist (1Z0-566) Oracle User Productivity Kit 11 Technical Certified Implementation Specialist (1Z0-583) Oracle Retail Demand Forecasting 13.3 Functional Implementer Certified Implementation Specialist (1Z0-463) Oracle Retail Predictive Application Server 13 Configuration Implementation Specialist (1Z0-576) Oracle Retail Merchandising System 13.2 Foundation Functional Implementer Certified Implementation Specialist (1Z0-453) Oracle Retail Predictive Application Server 13 Configuration Implementation Specialist (1Z0-576) Oracle Retail Point-of-Service Technical Certified Implementation Specialist (1Z0-572) Oracle Retail Price Management 13.2 Functional Implementer Certified Implementation Specialist (1Z0-454) Oracle Retail Predictive Application Server 13 Configuration Implementation Specialist (1Z0-576) Oracle Retail Store Inventory Management 13.2 Functional Implementer Certified Implementation Specialist (1Z0-455) Oracle Flexcube Universal Banking 11 Technical Implementation Essentials (1Z0-579) Oracle FlexCube Universal Banking 11 Basic Implementation Essentials (1Z0-561) Oracle Flexcube Universal Banking 11 Technical Implementation Essentials (1Z0-579) Oracle FLEXCUBE Direct Banking 6 Implementation Essentials (1Z0-594)   Puedes consultar la información acerca de los examenes en cada uno de los enlaces. Para prepararte los examenes sigue la Guia de estudio que encontrarás en la página de cada examen. Requisitos: ser  Partner Gold, Platinum o Diamond de Oracle y tener un usuario de Oracle Pearson Vue.  ¿Cuándo?: 27 y 28 de noviembre  a las (9:00, 12:00, 16:00)  ¿Dónde?: Core Networks, C.E.Parque Norte, Edificio Olmo, Planta 1 Serrano Galvache 56 | 28033, Madrid Para inscribirte: Create una cuenta en Pearson Vue (www.pearsonvue.com/oracle). Para Registrarte aquí. Para más información sobre el programa de especializaciones, haz clic aquí. No pierdas esta oportunidad e inscríbete hoy.  Para cualquier duda contactar con [email protected]. Ana María Gallego Partner Enablement Manager Spain and Portugal        

    Read the article

  • Parner Webcast - Innovations in Products Program

    - by Richard Lefebvre
    We are pleased to invite you to join the Innovations in Products –webcast. Innovations in Products will present Oracle Applications' Product's new functions and features including sales positioning. The key objectives of these webcasts are to inspire System Integrator's implementation personnel to conduct successful after sales in their Customer projects. Innovations in Products will be presented on the 1st Monday of each quarter after the billable day (4:00 to 5:00 PM CET). The webcast is intended for System Integrator's Implementation Certified Specialists but Innovations in Products is open for other interested Oracle Applications system Integrator's personnel as well. At first, two Oracle representatives will discuss Oracle's contribution to Partners. Then you will see product breakout session followed by Q&A with Oracle Experts. Each session will last for maximum 1 hour. A Q&A document covering all questions and answers will be made available after the webcast. What are the Benefits for partners? Find out how Innovations in Products helps you to improve your after sales Discover new functions and features so you can enrich your Customers's solution Learn more about Oracle Applications products, especially sales positioning Hear crucial questions raised by colleague alike, learn from their interest Engage and present your questions to subject experts Be inspired of the richness of Oracle Application portfolio – for your and your customer’s benefit Note: Should you already be familiar with a specific Product, then choose another one. Doing so you would expand your knowledge of the overall Applications portfolio. Some presentations contain product demonstration, although these presentations are not intended to be extremely detailed technical presentations. Note: At the latter part of this email you have also 17 links into the recent Applications Products presentations and 6 links into the Public Sector Value Proposition presentations that were presented in Innovations in Industries -program. Product breakout sessions: Topics Speaker To Register Fusion Applications Technology and Extensibility: A next-generation platform that adapts to client needs. Matthew Johnson, Sr. Director, SCM Product Development, EMEA CLICK HERE Fusion Applications - Transforming your Back-Office Accounting Function: Changing how people work in back office functions to drive value add Liam Nolan, Director, ERP Product Development, EMEA CLICK HERE Fusion HCM & Talent Overview & Extensibility: A more in-depth look into a personalized HCM solution Synco Jonkeren, Vice-President HCM Product Development & Management, EMEA CLICK HERE Fusion HCM Compensation Planning: Compensate To Compete Rosie Warner, Director, HCM Sales Development CLICK HERE Enterprise PLM for the Product Value Chain: Oracle Enterprise PLM offers Industry specific solutions that cover the Product Value Chain Ulf Köster, Sales Development Leader Enterprise PLM, Oracle Western Europe CLICK HERE Oracle's Asset Management and Maintenance Solution: What you need to know to successfully implement Oracle Asset Management solutions within Oracle Installed Base Philip Carey, Asset Management and Maintenance Solution Specialist CLICK HERE For more details please visit Innovations in Products and other breakout sessions on OPN page. Delivery Format Innovations in Products –program is a series of FREE prerecorded Applications product presentations followed by Q&A. It will be delivered over the Web. Participants have the opportunity to submit questions during the web cast via chat and subject matter experts will provide verbal answers live. Innovations in Products consists of several parallel prerecorded product breakout sessions, each lasting for max. 1 hour. At first, two Oracle representatives will discuss Oracle’s contribution to Partners. Then you’ll see the product breakout sessions followed by Q&A with Oracle Experts. A Q&A document covering all questions and answers will be made available after the webcast. You can also see Innovations in Products afterwards as its content will be available online for the next 6-12 months. The next Innovations in Products web casts will be presented as follows: July 2nd 2012 October 1st 2012 January 14th 2013 April 8th 2013. Note: Depending on local network bandwidth please allow some seconds time the presentations to download. You might want to refresh your screen by pressing F5. Duration Maximum 1 hour For further information please contact me Markku Rouhiainen. Recent Innovations in Products presentations Applications Products presented on April the 2nd, 2012 Speaker To Register Fusion CRM: Effective, Efficient and Easy James Penfold , Senior Director, Applications Product Development and Product Management CLICK HERE Fusion HCM: Talent management overview performance, goals, talent review Jaime Losantos Viñolas, Director, HCM Sales Development CLICK HERE Distributed Order Management - Fusion SCM Solution Vikram K Singla, Business Development Director, Supply Chain Management Applications, UK CLICK HERE Oracle Transportation Management Dominic Regan, Senior Director Oracle Transportation Management EMEA CLICK HERE Oracle Value Chain Planning: Demantra Sales & Operation Planning and Demantra Demand Management Lionel Albert, Senior Director Value Chain Planning, EMEA CLICK HERE Oracle CX (Customer Experience) - formerly CEM: Powering Great Customer Experiences Maria Ramirez , CRM Presales Consultant, EPC CLICK HERE EPM 11.1.2.2 Overview Nicholas Cox , EMEA Sales Development Director - Enterprise Performance Management CLICK HERE Oracle Hyperion Profitability and Cost Management, 11.1.2.1 Daniela Lazar , Senior EPM Sales Consultant, EPC CLICK HERE January the 16th 2012 Speaker To Register CRM / ATG: Best-in-Class CRM & Commerce Maria Ramirez , Associate CRM Presales Consultant, EPC CLICK HERE CRM / Automate Business Rules for Maximum Efficiency with OPA (Oracle Policy Automation) Marco Nilo, Associate CRM Presales Consultant, EPC CLICK HERE CRM / InQuira Toby Baker, Principal Sales Consultant, CRM Product Specialist Team CLICK HERE EPM / Business Intelligence Foundation Suite – Sales and Product Updates Liviu Nitescu, Senior BI Sales Consultant, EPC CLICK HERE EPM / Hyperion Planning 11.1.2.1 - Sales & Product Updates Andreea Voinea, EPM Sales Consultant, EPC CLICK HERE ERP / JDE EnterpriseOne Fulfillment Management Overview Mirela Andreea Nasta , ERP Presales Consultant, EPC CLICK HERE ERP / Spotlights on iExpenses Elena Nita ,ERP Presales Consultant, EPC CLICK HERE MDM / Master Data Management Martin Boyd , Senior Director Product Strategy CLICK HERE Product break through session Fusion Applications Human Capital Management Rosie Warner , Director, HCM Sales Development CLICK HERE Recent Innovations in Industries Value Proposition presentations January the 16th 2012 Speaker To Register Process Modernisation Iemke Idsingh Public Sector Solutions Director CLICK HERE Shared Services Ann Smith Business Development Director, Shared Services CLICK HERE Strengthening Financial Discipline Whilst Delivering Cashable Savings Philippa Headley UK Sales Development Director Public Sector - EPM Solutions CLICK HERE Social Welfare Industry Solutions Christian Wernberg-Tougaard Industry Director - Social Welfare CLICK HERE Police Industry Solutions Jeff Penrose Solution Sales Director CLICK HERE Tax and Revenue Management Industry Solutions Andre van der Post Global Director - Tax Solutions and Strategy CLICK HERE  

    Read the article

  • Highlights from the Oracle Customer Experience Summit @ OpenWorld

    - by Kathryn Perry
    A guest post by David Vap, Group Vice President, Oracle Applications Product Development The Oracle Customer Experience Summit was the first-ever event covering the full breadth of Oracle's CX portfolio -- Marketing, Sales, Commerce, and Service. The purpose of the Summit was to articulate the customer experience imperative and to showcase the suite of Oracle products that can help our customers create the best possible customer experience. This topic has always been a very important one, but now that there are so many alternative companies to do business with and because people have such public ways to voice their displeasure, it's necessary for vendors to have multiple listening posts in place to gauge consumer sentiment. They need to know what is going on in real time and be able to react quickly to turn negative situations into positive ones. Those can then be shared in a social manner to enhance the brand and turn the customer into a repeat customer. The Summit was focused on Oracle's portfolio of products and entirely dedicated to customers who are committed to building great customer experiences within their businesses. Rather than DBAs, the attendees were business people looking to collaborate with other like-minded experts and find out how Oracle can help in terms of technology, best practices, and expertise. The event was at the Westin St. Francis Hotel in San Francisco as part of Oracle OpenWorld. We had eight hundred people attend, which was great for the first year. Next year, there's no doubt in my mind, we can raise that number to 5,000. Alignment and Logic Oracle's Customer Experience portfolio is made up of a combination of acquired and organic products owned by many people who are new to Oracle. We include homegrown Fusion CRM, as well as RightNow, Inquira, OPA, Vitrue, ATG, Endeca, and many others. The attendees knew of the acquisitions, so naturally they wanted to see how the products all fit together and hear the logic behind the portfolio. To tell them about our alignment, we needed to be aligned. To accomplish that, a cross functional team at Oracle agreed on the messaging so that every single Oracle presenter could cover the big picture before going deep into a product or topic. Talking about the full suite of products in one session produced overflow value for other products. And even though this internal coordination was a huge effort, everyone saw the value for our customers and for our long-term cooperation and success. Keynotes, Workshops, and Tents of Innovation We scored by having Seth Godin as our keynote speaker ? always provocative and popular. The opening keynote was a session orchestrated by Mark Hurd, Anthony Lye, and me. Mark set the stage by giving real-world examples of bad customer experiences, Anthony clearly articulated the business imperative for addressing these experiences, and I brought it all to life by taking the audience around the Customer Lifecycle and showing demos and videos, with partners included at each of the stops around the lifecycle. Brian Curran, a VP for RightNow Product Strategy, presented a session that was in high demand called The Economics of Customer Experience. People loved hearing how to build a business case and justify the cost of building a better customer experience. John Kembel, another VP for RightNow Product Strategy, held a workshop that customers raved about. It was based on the journey mapping methodology he created, which is a way to talk to customers about where they want to make improvements to their customers' experiences. He divided the audience into groups led by facilitators. Each person had the opportunity to engage with experts and peers and construct some real takeaways. From left to right: Brian Curran, John Kembel, Seth Godin, and George Kembel The conference hotel was across from Union Square so we used that space to set up Innovation Tents. During the day we served lunch in the tents and partners showed their different innovative ideas. It was very interesting to see all the technologies and advancements. It also gave people a place to mix and mingle and to think about the fringe of where we could all take these ideas. Product Portfolio Plus Thought Leadership Of course there is always room for improvement, but the feedback on the format of the conference was positive. Ninety percent of the sessions had either a partner or a customer teamed with an Oracle presenter. The presentations weren't dry, one-way information dumps, but more interactive. I just followed up with a CEO who attended the conference with his Head of Marketing. He told me that they are using John Kembel's journey mapping methodology across the organization to pull people together. This sort of thought leadership in these highly competitive areas gives Oracle permission to engage around the technology. We have to differentiate ourselves and it's harder to do on the product side because everyone looks the same on paper. But on thought leadership ? we can, and did, take some really big steps. David VapGroup Vice PresidentOracle Applications Product Development

    Read the article

  • RightNow CX @ OpenWorld: What to Experience

    - by Tony Berk
    We want to welcome our RightNow CX customers to Oracle OpenWorld next week. Get ready for a great week and a whole new experience! For a high level overview of what is going on during the week, please review these previous posts: Is There a Cloud Over OpenWorld? and What to "CRM" in San Francisco? CRM Highlights for OpenWorld '12. Also, don't forget you can add on the Customer Experience Summit @ OpenWorld to make your week even more complete and get involved with the Experience Revolution! Below is a highlight of only some of the RightNow related sessions at OpenWorld. Please use OpenWorld Schedule Builder or check the OpenWorld Content Catalog for all of the session details and any time or location changes. Tip: Pre-enrolled session registrants via Schedule Builder are allowed into the session rooms before anyone else, so Schedule Builder will guarantee you a seat. Many of the sessions below will likely be at capacity. No better way to start off than hearing where Oracle RightNow is going! Oracle RightNow CX Cloud Service Vision and Roadmap (CON9764) - Oct 1, 10:45 AM. Oracle RightNow CX Cloud Service combines Web, social, and contact center experiences for a unified, cross-channel service solution in the cloud, enabling organizations to increase sales and adoption, build trust, strengthen relationships, and reduce costs and effort. Come to this session to hear from David Vap and his team of Oracle experts about where the product is going and how Oracle is committed to accelerating the pace of innovation and value to its customers. Interested in the Cloud and want to know why some leading CIOs are moving to the cloud? You can hear first hand from CIOs from Emerson, Intuit and Overstock.com: CIOs and Governance in the Cloud (CON9767) - Oct 3, 11:45 AM.   And of course there are a number of sessions that drill down into more specific areas. Here are just a few: Deliver Outstanding Customer Experiences: Oracle RightNow Dynamic Agent Desktop Cloud Service (CON9771) - Oct 1, 4:45 PM. This session covers how companies have delivered exceptional customer experiences and how the Oracle RightNow Dynamic Agent Desktop Cloud Service roadmap will evolve in the future. The Oracle RightNow Contact Center Experience suite includes incident management, knowledge, guided processes, and other service capabilities to unify the customer experience across channels. Come learn about the powerful tools that enable even your junior agents to consistently provide outstanding service across all customer interaction channels. Self-Service in the Age of Data Intimacy (CON11516) - Oct 1, 3:15. Even though businesses are generating more and more data around their relationships and interactions with customers, very little of the information a business generates ends up available to the contact center and even less is made available to the online service experience. The generic one-size-fits-all approach that typifies most online service experiences ultimately fails to address all user needs, and that failure ultimately leads to the continued use of high-cost agent-assisted channels for low-value interactions. This session introduces Oracle RightNow Web Experience’s Virtual Assistant and discusses how you can deliver rich, engaging, highly personalized experiences with the quality of agent-assisted service at a much lower cost. Improve Chat Experiences: Best Practices for Chat Pilots and Deployments (CON11517) - Oct 1, 4:45 PM. Today’s organizations are challenged to grow revenue and retain customers with fewer resources, and many have turned to chat as an approach to improving the customer experience, increasing sales conversions, and reducing costs at the same time. From setting goals and metrics and training staff to customizing and tuning the solution, this session provides best practices and lessons learned from a broad set of implementations to help you get the most out of your chat solution. Differentiated Experience with Web Service (CON9770) - Oct 2, 1:15 PM. A reputation for excellent customer service can differentiate your brand and drive revenue. In this session, learn how to develop that reputation by transforming your online self-service into a highly interactive, branded customer experience. See live examples of how Oracle RightNow Web Experience has helped customers deliver on their Web service strategies. Unifying the Agent’s Engagement Console (CON11518) - Oct 2, 1:15 PM. Does your customer experience suffer because your agents are toggling between multiple tools? Do your agent productivity and morale suffer as well? Come to this session to learn how Oracle RightNow CX Cloud Service seamlessly unifies these disparate systems into a single engagement console. Regardless of channel, powerful adaptive tools consistently guide agents across contextually aware personalized workflows. Great agent experiences drive great customer experiences. Oracle RightNow CX Cloud Service and the Oracle Customer Experience Portfolio (CON9775) - Oct 3, 10:15 AM. This session covers how Oracle’s integrated suite of customer experience (CX) products fits with the Oracle CX portfolio of products (Oracle Fusion Customer Relationship Management; the Oracle ATG, Oracle Endeca, and Oracle Knowledge product families; and Oracle Business Intelligence) to increase revenues, strengthen customer relationships, and reduce costs across the entire end-to-end customer lifecycle for companies that sell to consumers and those that sell to businesses. Greater Insights from Customer Engagements (CON9773) Oct 4, 12:45 PM. In this session, hear how to leverage service interaction insights, customer feedback, and segmented service engagements to improve the customer experience. Discover how customers, such as J&P Cycles, learn and take action based on business insights gained through their customer engagements. Again, these are just some of the sessions, so check out the Content Catalog for details on Knowledge Management, Customization, Integration and more in the Oracle Develop stream for Customer Experience. Be sure to visit the Oracle DEMOgrounds in the Moscone West Exhibit Hall. If this is your first OpenWorld, welcome! If you are returning, hi again and enjoy!

    Read the article

  • Highlights from the Oracle Customer Experience Summit @ OpenWorld

    - by Richard Lefebvre
    The Oracle Customer Experience Summit was the first-ever event covering the full breadth of Oracle's CX portfolio -- Marketing, Sales, Commerce, and Service. The purpose of the Summit was to articulate the customer experience imperative and to showcase the suite of Oracle products that can help our customers create the best possible customer experience. This topic has always been a very important one, but now that there are so many alternative companies to do business with and because people have such public ways to voice their displeasure, it's necessary for vendors to have multiple listening posts in place to gauge consumer sentiment. They need to know what is going on in real time and be able to react quickly to turn negative situations into positive ones. Those can then be shared in a social manner to enhance the brand and turn the customer into a repeat customer. The Summit was focused on Oracle's portfolio of products and entirely dedicated to customers who are committed to building great customer experiences within their businesses. Rather than DBAs, the attendees were business people looking to collaborate with other like-minded experts and find out how Oracle can help in terms of technology, best practices, and expertise. The event was at the Westin St. Francis Hotel in San Francisco as part of Oracle OpenWorld. We had eight hundred people attend, which was great for the first year. Next year, there's no doubt in my mind, we can raise that number to 5,000. Alignment and Logic Oracle's Customer Experience portfolio is made up of a combination of acquired and organic products owned by many people who are new to Oracle. We include homegrown Fusion CRM, as well as RightNow, Inquira, OPA, Vitrue, ATG, Endeca, and many others. The attendees knew of the acquisitions, so naturally they wanted to see how the products all fit together and hear the logic behind the portfolio. To tell them about our alignment, we needed to be aligned. To accomplish that, a cross functional team at Oracle agreed on the messaging so that every single Oracle presenter could cover the big picture before going deep into a product or topic. Talking about the full suite of products in one session produced overflow value for other products. And even though this internal coordination was a huge effort, everyone saw the value for our customers and for our long-term cooperation and success. Keynotes, Workshops, and Tents of Innovation We scored by having Seth Godin as our keynote speaker ? always provocative and popular. The opening keynote was a session orchestrated by Mark Hurd, Anthony Lye, and me. Mark set the stage by giving real-world examples of bad customer experiences, Anthony clearly articulated the business imperative for addressing these experiences, and I brought it all to life by taking the audience around the Customer Lifecycle and showing demos and videos, with partners included at each of the stops around the lifecycle. Brian Curran, a VP for RightNow Product Strategy, presented a session that was in high demand called The Economics of Customer Experience. People loved hearing how to build a business case and justify the cost of building a better customer experience. John Kembel, another VP for RightNow Product Strategy, held a workshop that customers raved about. It was based on the journey mapping methodology he created, which is a way to talk to customers about where they want to make improvements to their customers' experiences. He divided the audience into groups led by facilitators. Each person had the opportunity to engage with experts and peers and construct some real takeaways. The conference hotel was across from Union Square so we used that space to set up Innovation Tents. During the day we served lunch in the tents and partners showed their different innovative ideas. It was very interesting to see all the technologies and advancements. It also gave people a place to mix and mingle and to think about the fringe of where we could all take these ideas. Product Portfolio Plus Thought Leadership Of course there is always room for improvement, but the feedback on the format of the conference was positive. Ninety percent of the sessions had either a partner or a customer teamed with an Oracle presenter. The presentations weren't dry, one-way information dumps, but more interactive. I just followed up with a CEO who attended the conference with his Head of Marketing. He told me that they are using John Kembel's journey mapping methodology across the organization to pull people together. This sort of thought leadership in these highly competitive areas gives Oracle permission to engage around the technology. We have to differentiate ourselves and it's harder to do on the product side because everyone looks the same on paper. But on thought leadership ? we can, and did, take some really big steps. David Vap Group Vice President Oracle Applications Product Development

    Read the article

  • What to "CRM" in San Francisco? CRM Highlights for OpenWorld '12

    - by Tony Berk
    There is plenty to SEE for CRM during OpenWorld in San Francisco, September 30 - October 4! As I mentioned in my earlier post about some of the keynote sessions, Is There a Cloud Over OpenWorld?, I'm going try to highlight some key sessions to help you find the best sessions for you. Interested to find out where Oracle CRM products are headed, then find your "roadmap" session. Here are some of the sessions in the CRM Track that you might want to consider attending for products you currently own or might consider for the future. I think you'll agree, there is quite a bit of investment going on across Oracle CRM. Please use OpenWorld Schedule Builder or check the OpenWorld Content Catalog for all of the session details and any time or location changes. Tip: Pre-enrolled session registrants via Schedule Builder are allowed into the session rooms before anyone else, so Schedule Builder will guarantee you a seat. Many of the sessions below will likely be at capacity. General Session: Oracle Fusion CRM—Improving Sales Effectiveness, Efficiency, and Ease of Use (Session ID: GEN9674) - Oct 2, 11:45 AM - 12:45 PM. Anthony Lye, Senior VP, Oracle leads this general session focused on Oracle Fusion CRM. Oracle Fusion CRM optimizes territories, combines quota management and incentive compensation, integrates sales and marketing, and cleanses and enriches data—all within a single application platform. Oracle Fusion can be configured, changed, and extended at runtime by end users, business managers, IT, and developers. Oracle Fusion CRM can be used from the Web, from a smartphone, from Microsoft Outlook, or from an iPad. Deloitte, sponsor of the CRM Track, will also present key concepts on CRM implementations. Oracle Fusion Customer Relationship Management: Overview/Strategy/Customer Experiences/Roadmap (CON9407) - Oct 1, 3:15PM - 4:15PM. In this session, learn how Oracle Fusion CRM enables companies to create better sales plans, generate more quality leads, and achieve higher win rates and find out why customers are adopting Oracle Fusion CRM. Gain a deeper understanding of the unique capabilities only Oracle Fusion CRM provides, and learn how Oracle’s commitment to CRM innovation is driving a wide range of future enhancements. Oracle RightNow CX Cloud Service Vision and Roadmap (CON9764) - Oct 1, 10:45 AM - 11:45 AM. Oracle RightNow CX Cloud Service combines Web, social, and contact center experiences for a unified, cross-channel service solution in the cloud, enabling organizations to increase sales and adoption, build trust, strengthen relationships, and reduce costs and effort. Come to this session to hear from Oracle experts about where the product is going and how Oracle is committed to accelerating the pace of innovation and value to its customers. Siebel CRM Overview, Strategy, and Roadmap (CON9700) - Oct 1, 12:15PM - 1:15PM. The world’s most complete CRM solution, Oracle’s Siebel CRM helps organizations differentiate their businesses. Come to this session to learn about the Siebel product roadmap and how Oracle is committed to accelerating the pace of innovation and value for its customers on this platform. Additionally, the session covers how Siebel customers can leverage many Oracle assets such as Oracle WebCenter Sites; InQuira, RightNow, and ATG/Endeca applications, and Oracle Policy Automation in conjunction with their current Siebel investments. Oracle Fusion Social CRM Strategy and Roadmap: Future of Collaboration and Social Engagement (CON9750) - Oct 4, 11:15 AM - 12:15 PM. Social is changing the customer experience! Come find out how Oracle can help you know your customers better, encourage brand affinity, and improve collaboration within your ecosystem. This session reviews Oracle’s social media solution and shows how you can discover hidden insights buried in your enterprise and social data. Also learn how Oracle Social Network revolutionizes how enterprise users work, collaborate, and share to achieve successful outcomes. Oracle CRM On Demand Strategy and Roadmap (CON9727) - Oct 1, 10:45AM - 11:45AM. Oracle CRM On Demand is a powerful cloud-based customer relationship management solution. Come to this session to learn directly from Oracle experts about future product plans and hear how Oracle is committed to accelerating the pace of innovation and value to its customers. Knowledge Management Roadmap and Strategy (CON9776) - Oct 1, 12:15PM - 1:15PM. Learn how to harness the knowledge created as a natural byproduct of day-to-day interactions to lower costs and improve customer experience by delivering the right answer at the right time across channels. This session includes an overview of Oracle’s product roadmap and vision for knowledge management for both the Oracle RightNow and Oracle Knowledge (formerly InQuira) product families. Oracle Policy Automation Roadmap: Supercharging the Customer Experience (CON9655) - Oct 1, 12:15PM - 1:15PM. Oracle Policy Automation delivers rapid customer value by streamlining the capture, analysis, and deployment of policies across every facet of the customer experience. This session discusses recent Oracle Policy Automation enhancements for policy analytics; the latest Oracle Policy Automation Connector for Siebel; and planned new capabilities, including availability with the Oracle RightNow product line. There is much more, so stay tuned for more highlights or check out the Content Catalog and search for your areas of interest. Which session are you most interested in? Make your suggestions! But no voting for Pearl Jam or Kings of Leon. Those are after hours! 

    Read the article

  • What to "CRM" in San Francisco? CRM Highlights for OpenWorld '12

    - by Richard Lefebvre
    There is plenty to SEE for CRM during OpenWorld in San Francisco, September 30 - October 4! Here are some of the sessions in the CRM Track that you might want to consider attending for products you currently own or might consider for the future. I think you'll agree, there is quite a bit of investment going on across Oracle CRM. Please use OpenWorld Schedule Builder or check the OpenWorld Content Catalog for all of the session details and any time or location changes. Tip: Pre-enrolled session registrants via Schedule Builder are allowed into the session rooms before anyone else, so Schedule Builder will guarantee you a seat. Many of the sessions below will likely be at capacity. General Session: Oracle Fusion CRM—Improving Sales Effectiveness, Efficiency, and Ease of Use (Session ID: GEN9674) - Oct 2, 11:45 AM - 12:45 PM. Anthony Lye, Senior VP, Oracle leads this general session focused on Oracle Fusion CRM. Oracle Fusion CRM optimizes territories, combines quota management and incentive compensation, integrates sales and marketing, and cleanses and enriches data—all within a single application platform. Oracle Fusion can be configured, changed, and extended at runtime by end users, business managers, IT, and developers. Oracle Fusion CRM can be used from the Web, from a smartphone, from Microsoft Outlook, or from an iPad. Deloitte, sponsor of the CRM Track, will also present key concepts on CRM implementations. Oracle Fusion Customer Relationship Management: Overview/Strategy/Customer Experiences/Roadmap (CON9407) - Oct 1, 3:15PM - 4:15PM. In this session, learn how Oracle Fusion CRM enables companies to create better sales plans, generate more quality leads, and achieve higher win rates and find out why customers are adopting Oracle Fusion CRM. Gain a deeper understanding of the unique capabilities only Oracle Fusion CRM provides, and learn how Oracle’s commitment to CRM innovation is driving a wide range of future enhancements. Oracle RightNow CX Cloud Service Vision and Roadmap (CON9764) - Oct 1, 10:45 AM - 11:45 AM. Oracle RightNow CX Cloud Service combines Web, social, and contact center experiences for a unified, cross-channel service solution in the cloud, enabling organizations to increase sales and adoption, build trust, strengthen relationships, and reduce costs and effort. Come to this session to hear from Oracle experts about where the product is going and how Oracle is committed to accelerating the pace of innovation and value to its customers. Siebel CRM Overview, Strategy, and Roadmap (CON9700) - Oct 1, 12:15PM - 1:15PM. The world’s most complete CRM solution, Oracle’s Siebel CRM helps organizations differentiate their businesses. Come to this session to learn about the Siebel product roadmap and how Oracle is committed to accelerating the pace of innovation and value for its customers on this platform. Additionally, the session covers how Siebel customers can leverage many Oracle assets such as Oracle WebCenter Sites; InQuira, RightNow, and ATG/Endeca applications, and Oracle Policy Automation in conjunction with their current Siebel investments. Oracle Fusion Social CRM Strategy and Roadmap: Future of Collaboration and Social Engagement (CON9750) - Oct 4, 11:15 AM - 12:15 PM. Social is changing the customer experience! Come find out how Oracle can help you know your customers better, encourage brand affinity, and improve collaboration within your ecosystem. This session reviews Oracle’s social media solution and shows how you can discover hidden insights buried in your enterprise and social data. Also learn how Oracle Social Network revolutionizes how enterprise users work, collaborate, and share to achieve successful outcomes. Oracle CRM On Demand Strategy and Roadmap (CON9727) - Oct 1, 10:45AM - 11:45AM. Oracle CRM On Demand is a powerful cloud-based customer relationship management solution. Come to this session to learn directly from Oracle experts about future product plans and hear how Oracle is committed to accelerating the pace of innovation and value to its customers. Knowledge Management Roadmap and Strategy (CON9776) - Oct 1, 12:15PM - 1:15PM. Learn how to harness the knowledge created as a natural byproduct of day-to-day interactions to lower costs and improve customer experience by delivering the right answer at the right time across channels. This session includes an overview of Oracle’s product roadmap and vision for knowledge management for both the Oracle RightNow and Oracle Knowledge (formerly InQuira) product families. Oracle Policy Automation Roadmap: Supercharging the Customer Experience (CON9655) - Oct 1, 12:15PM - 1:15PM. Oracle Policy Automation delivers rapid customer value by streamlining the capture, analysis, and deployment of policies across every facet of the customer experience. This session discusses recent Oracle Policy Automation enhancements for policy analytics; the latest Oracle Policy Automation Connector for Siebel; and planned new capabilities, including availability with the Oracle RightNow product line. There is much more, so stay tuned for more highlights or check out the Content Catalog and search for your areas of interest. 

    Read the article

  • conversion of DNA to Protein - c structure issue

    - by sam
    I am working on conversion of DNA sequence to Protein sequence. I had completed all program only one error I found there is of structure. dna_codon is a structure and I am iterating over it.In first iteration it shows proper values of structure but from next iteration, it dont show the proper value stored in structure. Its a small error so do not think that I havnt done anything and downvote. I am stucked here because I am new in c for structures. CODE : #include <stdio.h> #include<string.h> void main() { int i, len; char short_codons[20]; char short_slc[1000]; char sequence[1000]; struct codons { char amino_acid[20], slc[20], dna_codon[40]; }; struct codons c1 [20]= { {"Isoleucine", "I", "ATT, ATC, ATA"}, {"Leucine", "L", "CTT, CTC, CTA, CTG, TTA, TTG"}, {"Valine", "V", "GTT, GTC, GTA, GTG"}, {"Phenylalanine", "F", "TTT, TTC"}, {"Methionine", "M", "ATG"}, {"Cysteine", "C", "TGT, TGC"}, {"Alanine", "A", "GCT, GCC, GCA, GCG"}, {"Proline", "P", "CCT, CCC, CCA,CCG "}, {"Threonine", "T", "ACT, ACC, ACA, ACG"}, {"Serine", "S", "TCT, TCC, TCA, TCG, AGT, AGC"}, {"Tyrosine", "Y", "TAT, TAC"}, {"Tryptophan", "W", "TGG"}, {"Glutamine", "Q", "CAA, CAG"}, {"Aspargine","N" "AAT, AAC"}, {"Histidine", "H", "CAT, CAC"}, {"Glutamic acid", "E", "GAA, GAG"}, {"Aspartic acid", "D", "GAT, GAC"}, {"Lysine", "K", "AAA, AAG"}, {"Arginine", "R", "CGT, CGC, CGA, CGG, AGA, AGG"}, {"Stop codons", "Stop", "AA, TAG, TGA"} }; int count = 0; printf("Enter the sequence: "); gets(sequence); char *input_string = sequence; char *tmp_str = input_string; int k; char *pch; while (*input_string != '\0') { char string_3l[4] = {'\0'}; strncpy(string_3l, input_string, 3); printf("\n-----------%s & %s----------", string_3l, tmp_str ); for(k=0;k<20;k++) { //printf("@REAL - %s", c1[0].dna_codon); printf("@ %s", c1[k].dna_codon); int x; x = c1[k].dna_codon; pch = strtok(x, ","); while (pch != NULL) { printf("\n%d : %s with %s", k, string_3l, pch); count=strcmp(string_3l, pch); if(count==0) { strcat(short_slc, c1[k].slc); printf("\n==>%s", short_slc); } pch = strtok (NULL, " ,.-"); } } input_string = input_string+3; } printf("\nProtien sequence is : %s\n", short_slc); } INPUT : TAGTAG OUTPUT : If you see output of printf("\n-----------%s & %s----------", string_3l, tmp_str ); in both iterations, we found that values defined in structure are reduced. I want to know why structure reduces it or its my mistake? because I am stucked here

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • A Look Back at 2010 Predictions

    - by David Dorf
    Now is the time of year people make their predictions for next year, but before I start thinking about 2011 it's worth a look back to see how my predictions for 2010 fared. 1. Borders and Blockbuster bite the dust. I would have never predicted a strong brand such as Circuit City could die, but now I know it can happen to anyone. Borders has lost the battle with Barnes & Noble and Blockbuster has lost to Netflix. And just to be sure, Amazon put an extra nail in each coffin. Borders received additional investment from Bennett LeBow to keep it afloat, but the stock is down around $1.25 with no profits in sight. Blockbuster filed for bankruptcy back in September. 2. Every retailer finally has a page on Facebook... but very few figure out how to keep fans engaged. Retailer postings become noise, and fans start to unsubscribe. Twitter goes in the same direction. A few standout retailers will figure out how to use social media, and the rest will remain dumbfounded. Most retailers are on the Facebook bandwagon, and their fan bases seem to be increasing thanks to promotions like The Gap's logo redesign, Lowes' black Friday sneak peak, and Walmart's Crowd Savers. There are several examples of f-commerce advancements, including some interesting integrations from Amazon.3. Smartphones consolidate and grow. More and more people will step-up to smartphones, most of which will choose iPhone, Blackberry, and Android phones. Other smartphones will vanish, and networks will start to strain. But retailers will finally embrace mobile as the next big channel. Retail marketing departments will build mobile apps without the help of their IT department, and eventually they will get into a bind. Android has been on a tear lately stealing market share from Blackberry. Palm and Microsoft are trending down, and Apple is holding steady. Smartphone sales are up 15% and expected to continue. Retailers understand the importance of mobile, and some innovative applications have been produced this year. 4. Google helps the little guys. Google will push its Favorite Places project to help give exposure to small retailers and restaurants. They will enable small retailers to act like big ones by providing storefronts, detailed product information, and coupons for consumers. Google will find a way to bring augmented reality to the masses. I can't say I've seen much new from Google regarding Favorite Places, but they've continued to push local product search. From the PC or smartphone, consumers can search for products and see which nearby stores have it stock. Oracle Retail even productized an integration to Google to support this effort. I suppose if Google ever buys Groupon then it will bring them even closer to local shopping. Google talked about augmented humanity, but that has nothing to do with augmented reality. 5. Steve Jobs Is Bugs Bunny and Steve Ballmer is Elmer Fudd. (OK, I stole that headline from an InformationWeek article. I couldn't resist.) Both Apple and Microsoft will continue to open new stores, but only Apple will show real growth. POSReady 2009 (formerly WEPOS) will continue to share the POS market with Linux. The iPhone and iPod will continue to capture market share, but there won't be an Apple tablet. There won't be an Apple tablet? What was I thinking? While Apple has well over 300 stores, there are less than 10 Microsoft stores. Initial impressions show that even though Microsoft is locating its store near Apple Stores, they are not converting customers, with shoppers citing a lack of assortment and high prices. 6. Consolidation of e-commerce software providers. Software vendors in the areas of search, reviews, online call-centers, payments, and e-commerce will consolidate, partly driven by the success of m-commerce and SaaS. Amazon will find someone else to buy, and eBay will continue to lose momentum. Consolidation of e-commerce providers continued with IBM acquiring Sterling Commerce and CoreMetrics, and Oracle recently announcing the acquisition of ATG. Amazon grabbed Zappos, Woot, and Diapers.com to continue its dominance of online selling. While eBay's Marketplace growth may have slowed, its PayPal division is doing quite well, fueled in part by demand for mobile payments. 7. Book publishers mirror music labels. Just as the iPod brought digital downloads to the masses, the Kindle and Nook will power the e-book revolution. Books will continue to use DRM for a few more years before following the path of music. Publishers will try to preserve the margins of hardbacks by associating e-book releases with paperbacks. Amazon has done a good job providing e-reader clients for smartphones, PCs, and tablets. Competition from Barnes & Noble has forced Amazon to support book loaning, and both companies are making it easier for people to publish ebooks (with or without DRM). Progress is slow but steady. 8. NFC makes inroads, RFID treads water. Near Field Communications start to appear in mobile phones, and retailers beta test its use for payments and loyalty programs. RFID tag costs come down a bit, but not enough to spur accelerated adoption.Nokia announced plans to offer NFC-enabled phones in 2011, and rumors are swirling about NFC in the upcoming iPhone.  I think NFC is heading in the right direction, and I've heard more interest from retailers about specialized uses for RFID.9. Digital Signage goes the way of augmented reality. People use their camera phones to leave geo-tagged notes all over cities, rating stores and restaurants, and "painting" graffiti. But people get tired of holding their phones in front of their faces, so AR glasses are offered in much the same way bluetooth headsets emerged. Retailers experiement with in-store advertising using AR. Several retailers like Pizza Hut, Benetton, and Target have experimented with AR but its still somewhat of a gimmick used by marketing.  I think this prediction is a year or two too early. 10. JDA flip-flops again. After announcing their embracing of the .Net architecture, then switching to J2EE after the Manugistics acquisition, JDA will finally decide to standardize on Apple's Objective C. Everything will be ported to the iPhone and be available on the AppStore. After all, there's not much left to try. This was, of course, a joke but the sentiment is still valid.  JDA seems more supply-chain focused than retail focused, which is a an outcrop if their i2 acquisition.  Of the 10 predictions, I'm going to say I got 6 somewhat correct.  (Don't you just love grading your own paper?)  Soon I'll post my predictions for 2011 so be on the lookout.  Until then here's one more prediction:  Va Tech beats Stanford in the Orange Bowl -- count on it!

    Read the article

  • ???? ????? ????? ?????? ????? 10.2.0.4

    - by gadi.chen
    Normal 0 false false false EN-US X-NONE HE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";} DBA's ?????? ?????? ???? ??? ????? ??? ?????? ???? ????? ????? ??? ?????. ??? ????? ???? ????? ???? ??????? 30-Apr-2011  ???? ???? ?????? ????? ???? ??????? 10.2.0.4. ?????? ????? EBS ?? ????? ????? ????? ????? ??? ??? ???? ????? ?????? extended support, ???? ???? 11.5.10.2 ??? ???? ? 01-Dec-2011 . ) ????? ?????? ????  Minimum Baseline For Extended Support ????? ?????: 883202.1) ???? ????? ????? ?????? ?????? ?? ????? ????? ????? ????????? ???? ?? :   # ATG.RUP6 # Forms6i Patchset 19 # JRE 1.6.0_03       ???? ???? ?????? EBS ?? ????? ?????? ?????? ????? ???? ?????? ?? ,?? ??? ????? ?? ???? ??????.   ????? ???? 10.2.0.4 ?? ???? ?patches ????? ????  30-Apr-2011 . ???? ????  patches ????? ?? ????? ????? 10.2.0.5   .   ???? ????? EBS ????? 3 ?????? ?????? ?? ???: 1.      ????? ????? 11.2.0.2 - ??? ???? ????? ??????? ?????? ??? EBS ??????? 11i   ? R12 2.      ????? ????? 11.1.0.7 -  ??? ???? ????? ?????? ????? ????? 11.1 ??? ?????. 3.      ?????/????? patch 10.2.0.5 -   ???? ????? ?????? ????? ?????? ????? 10gR2 . v\:* {behavior:url(#default#VML);} o\:* {behavior:url(#default#VML);} w\:* {behavior:url(#default#VML);} .shape {behavior:url(#default#VML);} Normal 0 false false false false EN-US X-NONE HE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";}   ?????? ??????? ???? ??????:     http://blogs.oracle.com/stevenChan/2011/01/ecs_10gr2_10204.html On Database Patching and Support: A Primer for E-Business Suite Users Oracle Database 10.2 End of Premier Support -- Frequently Asked Questions (Note 1130327.1)        

    Read the article

< Previous Page | 2 3 4 5 6