Search Results

Search found 16054 results on 643 pages for 'reference architecture'.

Page 601/643 | < Previous Page | 597 598 599 600 601 602 603 604 605 606 607 608  | Next Page >

• What is the best practice to segment c#.net projects based on a single base project

  - by Anthony

  Honestly, I can't word my question any better without describing it. I have a base project (with all its glory, dlls, resources etc) which is a CMS. I need to use this project as a base for othe custom bake projects. This base project is to be maintained and updated among all custom bake projects. I use subversion (Collabnet and Tortise SVN) I have two questions: 1 - Can I use subversion to share the base project among other projects What I mean here is can I "Checkout" the base project into another "Checked Out" project and have both update and commit seperatley. So, to paint a picture, let's say I am working on a custom project and I modify the core/base prject in some way (which I know will suit the others) can I then commit those changes and upon doing so when I update the base project in the other "Checked out" resources will it pull the changes? In short, I would like not to have to manually deploy updated core files whenever I make changes into each seperate project. 2 - If I create a custom file (let's say an webcontrol or aspx page etc) can I have it compile seperatley from the base project Another tricky one to explain. When I publish my web application it creates DLLs based on the namespaces of projects attached to it. So I may have a number of DLLs including the "Website's" namespace DLL, which could simply be website. I want to be able to make a seperate, custom, control which does not compile into those DLLs as the custom files should not rely on those DLLS to run. Is it as simple to set a seperate namespace for those files like CustomFiles.ProjectName for example? Think of the whole idea as adding modules to the .NET project, I don't want the module's code in any of the core DLLs but I do need for module to be able to access the core dlls. (There is no need for the core project to access the module code as it should be one way only in theory, though I reckon it woould not be possible anyway without using JSON/SOAP or something like that, maybe I am wrong.) I want to create a pluggable environment much like that of Joomla/Wordpress as since PHP generally doesn't have to be compiled first I see this is the reason why all this is possible/easy. The idea is to allow pluggable themes, modules etc etc. (I haven't tried simply adding .NET themes after compile/publish but I am assuming this is possible anyway? OR does the compiler need to reference items in the files?)

  Read the article

• Saving JQuery Draggable Sitemap Values Correctly

  - by mdolon

  I am trying to implement Boagworld's Sitemap tutorial, however I am running into difficulty trying to correctly save the child/parent relationships. The HTML is as follows, however populated with other items as well: <input type="hidden" name="sitemap-order" id="sitemap-order" value="" /> <ul id=”sitemap”> <li id="1"> <dl> <dt><a href=”#”>expand/collapse</a> <a href=”#”>Page Title</a></dt> <dd>Text Page</dd> <dd>Published</dd> <dd><a href=”#”>delete</a></dd> </dl> <ul><!–child pages–></ul> </li> </ul> And here is the JQuery code: $('#sitemap li').prepend('<div class="dropzone"></div>'); $('#sitemap li').draggable({ handle: ' > dl', opacity: .8, addClasses: false, helper: 'clone', zIndex: 100 }); var order = ""; $('#sitemap dl, #sitemap .dropzone').droppable({ accept: '#sitemap li', tolerance: 'pointer', drop: function(e, ui) { var li = $(this).parent(); var child = !$(this).hasClass('dropzone'); //If this is our first child, we'll need a ul to drop into. if (child && li.children('ul').length == 0) { li.append('<ul/>'); } //ui.draggable is our reference to the item that's been dragged. if (child) { li.children('ul').append(ui.draggable); }else { li.before(ui.draggable); } //reset our background colours. li.find('dl,.dropzone').css({ backgroundColor: '', backgroundColor: '' }); li.find('.dropzone').css({ height: '8px', margin: '0' }); // THE PROBLEM: var parentid = $(this).parent().attr('id'); menuorder += ui.draggable.attr('id')+'=>'+parentid+','; $("#sitemap-order").val(order); }, over: function() { $(this).filter('dl').css({ backgroundColor: '#ccc' }); $(this).filter('.dropzone').css({ backgroundColor: '#aaa', height: '30px', margin: '5px 0'}); }, out: function() { $(this).filter('dl').css({ backgroundColor: '' }); $(this).filter('.dropzone').css({ backgroundColor: '', height: '8px', margin: '0' }); } }); When moving items into the top-level (without parents), the parentid value I get is of the first list item (the parent container), so I can never remove the parent value and have a top-level item. Is there a no-brainer answer that I'm just not seeing right now? Any help is appreciated.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• using a Singleton to pass credentials in a multi-tenant application a code smell?

  - by Hans Gruber

  Currently working on a multi-tenant application that employs Shared DB/Shared Schema approach. IOW, we enforce tenant data segregation by defining a TenantID column on all tables. By convention, all SQL reads/writes must include a Where TenantID = '?' clause. Not an ideal solution, but hindsight is 20/20. Anyway, since virtually every page/workflow in our app must display tenant specific data, I made the (poor) decision at the project's outset to employ a Singleton to encapsulate the current user credentials (i.e. TenantID and UserID). My thinking at the time was that I didn't want to add a TenantID parameter to each and every method signature in my Data layer. Here's what the basic pseudo-code looks like: public class UserIdentity { public UserIdentity(int tenantID, int userID) { TenantID = tenantID; UserID = userID; } public int TenantID { get; private set; } public int UserID { get; private set; } } public class AuthenticationModule : IHttpModule { public void Init(HttpApplication context) { context.AuthenticateRequest += new EventHandler(context_AuthenticateRequest); } private void context_AuthenticateRequest(object sender, EventArgs e) { var userIdentity = _authenticationService.AuthenticateUser(sender); if (userIdentity == null) { //authentication failed, so redirect to login page, etc } else { //put the userIdentity into the HttpContext object so that //its only valid for the lifetime of a single request HttpContext.Current.Items["UserIdentity"] = userIdentity; } } } public static class CurrentUser { public static UserIdentity Instance { get { return HttpContext.Current.Items["UserIdentity"]; } } } public class WidgetRepository: IWidgetRepository{ public IEnumerable<Widget> ListWidgets(){ var tenantId = CurrentUser.Instance.TenantID; //call sproc with tenantId parameter } } As you can see, there are several code smells here. This is a singleton, so it's already not unit test friendly. On top of that you have a very tight-coupling between CurrentUser and the HttpContext object. By extension, this also means that I have a reference to System.Web in my Data layer (shudder). I want to pay down some technical debt this sprint by getting rid of this singleton for the reasons mentioned above. I have a few thoughts on what an better implementation might be, but if anyone has any guidance or lessons learned they could share, I would be much obliged.

  Read the article

• What's a clean way to have the server return a JavaScript function which would then be invoked?

  - by Khnle

  My application is architected as a host of plug-ins that have not yet been written. There's a long reason for this, but with each new year, the business logic will be different and we don't know what it will be like (Think of TurboTax if that helps). The plug-ins consist of both server and client components. The server components deals with business logic and persisting the data into database tables which will be created at a later time as well. The JavaScript manipulates the DOM for the browsers to render afterward. Each plugin lives in a separate assembly, so that they won't disturb the main application, i.e., we don't want to recompile the main application. Long story short, I am looking for a way to return JavaScript functions to the client from an Ajax get request, and execute these JavaScript functions (which are just returned). Invoking a function in Javascript is easy. The hard part is how to organize or structure so that I won't have to deal with maintenance problem. So concat using StringBuilder to end up with JavaScript code as a result of calling toString() from the string builder object is out of the question. I want to have no difference between writing JavaScript codes normally and writing Javascript codes for this dynamic purpose. An alternative is to manipulate the DOM on the server side, but I doubt that it would be as elegantly as using jQuery on the client side. I am open for a C# library that supports chainable calls like jQuery that also manipulates the DOM too. Do you have any idea or is it too much to ask or are you too confused? Edit1: The point is to avoid recompiling, hence the plug-ins architecture. In some other parts of the program, I already use the concept of dynamically loading Javascript files. That works fine. What I am looking here is somewhere in the middle of the program when an Ajax request is sent to the server. Edit 2: To illustrate my question: Normally, you would see the following code. An Ajax request is sent to the server, a JSON result is returned to the client which then uses jQuery to manipulate the DOM (creating tag and adding to the container in this case). $.ajax({ type: 'get', url: someUrl, data: {'': ''}, success: function(data) { var ul = $('<ul>').appendTo(container); var decoded = $.parseJSON(data); $.each(decoded, function(i, e) { var li = $('<li>').text(e.FIELD1 + ',' + e.FIELD2 + ',' + e.FIELD3); ul.append(li); }); } }); The above is extremely simple. But next year, what the server returns is totally different and how the data to be rendered would also be different. In a way, this is what I want: var container = $('#some-existing-element-on-the-page'); $.ajax({ type: 'get', url: someUrl, data: {'': ''}, success: function(data) { var decoded = $.parseJSON(data); var fx = decoded.fx; var data = decode.data; //fx is the dynamic function that create the DOM from the data and append to the existing container fx(container, data); } }); I don't need to know, at this time what data would be like, but in the future I will, and I can then write fx accordingly.

  Read the article

• How do I pass the value of the previous form element into an "onchange" javascript function?

  - by Jen

  Hello, I want to make some UI improvements to a page I am developing. Specifically, I need to add another drop down menu to allow the user to filter results. This is my current code: HTML file: <select name="test_id" onchange="showGrid(this.name, this.value, 'gettestgrid')"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> This is pseudo code for what I want to happen: <select name="test_id"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> <select name="statistics" onchange="showGrid(PREVIOUS.name, PREVIOUS.VALUE, THIS.value)"> <option selected>Select a data display --></option> <option value='gettestgrid'>Show averages by student</option> <option value='gethomeroomgrid'>Show averages by homeroom</option> <option value='getschoolgrid'>Show averages by school</option> </select> How do I access the previous field's name and value? Any help much appreciated, thx! Also, JS function for reference: function showGrid(name, value, phpfile) { xmlhttp=GetXmlHttpObject(); if (xmlhttp==null) { alert ("Browser does not support HTTP Request"); return; } var url=phpfile+".php"; url=url+"?"+name+"="+value; url=url+"&sid="+Math.random(); xmlhttp.onreadystatechange=stateChanged; xmlhttp.open("GET",url,true); xmlhttp.send(null); }

  Read the article

• Programmatically Binding to a Property

  - by M312V

  I know it's a generic title, but my question is specific. I think it will boil down to a question of practice. So, I have the following code: public class Component : UIElement { public Component() { this.InputBindings.Add(new MouseBinding(SomeCommandProperty, new MouseGesture(MouseAction.LeftClick))); } } I could easily aggregate the ViewModel that owns SomeCommandProperty into the Component class, but I'm currently waiving that option assuming there is another way. Component is a child of ComponentCollection which is child of a Grid which DataContext is the ViewModel. ComponentCollection as the name suggests contains a collection of Components. <Grid Name="myGrid"> <someNamespace:ComponentCollection x:Name="componentCollection"/> </Grid> It's the same scenario as the XAML below, but with TextBlock. I guess I'm trying to replicate what's being done in the XAML below programatically. Again, Component's top most ancestor's DataContext is set to ViewModel. <Grid Name="myGrid"> <TextBlock Text="SomeText"> <TextBlock.InputBindings> <MouseBinding Command="{Binding SomeCommandProperty}" MouseAction="LeftClick" /> </TextBlock.InputBindings> </TextBlock> </Grid> Update 1 Sorry, I'm unable to comment because I lack the reputation points. Basically, I have a custom control which inherit from a Panel which children are a collection of Component. It's not a hack, like I've mentioned, I could directly have access to SomeCommandProperty If I aggregate the ViewModel into Component. Doing so, however, feels icky. That is, having direct access to ViewModel from a Model. I guess the question I'm asking is. Given the situation that Component's parent UIElement's DataContext is set to ViewModel, is it possible to access SomeCommandProperty without Component owning a reference to the ViewModel that owns SomeCommandProperty? Programatically, that is. Using ItemsControl doesn't change the fact that I still need to bind SomeCommandProperty to each Items.

  Read the article

• Java - is this an idiom or pattern, behavior classes with no state

  - by Berlin Brown

  I am trying to incorporate more functional programming idioms into my java development. One pattern that I like the most and avoids side effects is building classes that have behavior but they don't necessarily have any state. The behavior is locked into the methods but they only act on the parameters passed in. The code below is code I am trying to avoid: public class BadObject { private Map<String, String> data = new HashMap<String, String>(); public BadObject() { data.put("data", "data"); } /** * Act on the data class. But this is bad because we can't * rely on the integrity of the object's state. */ public void execute() { data.get("data").toString(); } } The code below is nothing special but I am acting on the parameters and state is contained within that class. We still may run into issues with this class but that is an issue with the method and the state of the data, we can address issues in the routine as opposed to not trusting the entire object. Is this some form of idiom? Is this similar to any pattern that you use? public class SemiStatefulOOP { /** * Private class implies that I can access the members of the <code>Data</code> class * within the <code>SemiStatefulOOP</code> class and I can also access * the getData method from some other class. * * @see Test1 * */ class Data { protected int counter = 0; public int getData() { return counter; } public String toString() { return Integer.toString(counter); } } /** * Act on the data class. */ public void execute(final Data data) { data.counter++; } /** * Act on the data class. */ public void updateStateWithCallToService(final Data data) { data.counter++; } /** * Similar to CLOS (Common Lisp Object System) make instance. */ public Data makeInstance() { return new Data(); } } // End of Class // Issues with the code above: I wanted to declare the Data class private, but then I can't really reference it outside of the class: I can't override the SemiStateful class and access the private members. Usage: final SemiStatefulOOP someObject = new SemiStatefulOOP(); final SemiStatefulOOP.Data data = someObject.makeInstance(); someObject.execute(data); someObject.updateStateWithCallToService(data);

  Read the article

• One Controller is Sometimes Bound Twice with Ninject

  - by Dusda

  I have the following NinjectModule, where we bind our repositories and business objects: /// <summary> /// Used by Ninject to bind interface contracts to concrete types. /// </summary> public class ServiceModule : NinjectModule { /// <summary> /// Loads this instance. /// </summary> public override void Load() { //bindings here. //Bind<IMyInterface>().To<MyImplementation>(); Bind<IUserRepository>().To<SqlUserRepository>(); Bind<IHomeRepository>().To<SqlHomeRepository>(); Bind<IPhotoRepository>().To<SqlPhotoRepository>(); //and so on //business objects Bind<IUser>().To<Data.User>(); Bind<IHome>().To<Data.Home>(); Bind<IPhoto>().To<Data.Photo>(); //and so on } } And here are the relevant overrides from our Global.asax, where we inherit from NinjectHttpApplication in order to integrate it with Asp.Net Mvc (The module lies in a separate dll called Thing.Web.Configuration): protected override void OnApplicationStarted() { base.OnApplicationStarted(); //routes and areas AreaRegistration.RegisterAllAreas(); RegisterRoutes(RouteTable.Routes); //Initializes a singleton that must reference this HttpApplication class, //in order to provide the Ninject Kernel to the rest of Thing.Web. This //is necessary because there are a few instances (currently Membership) //that require manual dependency injection. NinjectKernel.Instance = new NinjectKernel(this); //view model factory. NinjectKernel.Instance.Kernel.Bind<IModelFactory>().To<MasterModelFactory>(); } protected override NinjectControllerFactory CreateControllerFactory() { return base.CreateControllerFactory(); } protected override Ninject.IKernel CreateKernel() { var kernel = new StandardKernel(); kernel.Load("Thing.Web.Configuration.dll"); return kernel; } Now, everything works great, with one exception: For some reason, sometimes Ninject will bind the PhotoController twice. This leads to an ActivationException, because Ninject can't discern which PhotoController I want. This causes all requests for thumbnails and other user images on the site to fail. Here is the PhotoController in it's entirety: public class PhotoController : Controller { public PhotoController() { } public ActionResult Index(string id) { var dir = Server.MapPath("~/" + ConfigurationManager.AppSettings["UserPhotos"]); var path = Path.Combine(dir, id); return base.File(path, "image/jpeg"); } } Every controller works in exactly the same way, but for some reason the PhotoController gets double-bound. Even then, it only happens occasionally (either when re-building the solution, or on staging/production when the app pool kicks in). Once this happens, it continues to happen until I redeploy without changing anything. So...what's up with that?

  Read the article

• Pass param to a silverlight application

  - by Lucas_Santos

  In my javascript I create my <OBJECT> tag var htmlEmbedSilverlight = "<div id='silverlightControlHost'> " + "<object data='data:application/x-silverlight-2,' type='application/x-silverlight-2' width='550px' height='250px'> " + "<param name='source' value='../../ClientBin/FotoEmprestimoChave.xap'/> " + "<param name='onError' value='onSilverlightError' /> " + "<param name='background' value='white' /> " + "<param name='minRuntimeVersion' value='4.0.60310.0' /> " + "<param name='autoUpgrade' value='true' /> " + "<param name='initparams' values='chave_id=" + data + "' /> " + "<a href='http://go.microsoft.com/fwlink/?LinkID=149156&v=4.0.60310.0' style='text-decoration:none'> " + "<img src='http://go.microsoft.com/fwlink/?LinkId=161376' alt='Get Microsoft Silverlight' style='border-style:none'/> " + "</a> " + "</object><iframe id='_sl_historyFrame' style='visibility:hidden;height:0px;width:0px;border:0px'></iframe></div>"; $("#tiraFotoSilverlight").html(htmlEmbedSilverlight); This is a reference to my Silverlight application where I call in my Web Application. The problem is my <param name='initparams' values='chave_id=" + data + "' /> " because in my App.xaml in Silverlight, I have the code below private void Application_Startup(object sender, StartupEventArgs e) { if (e.InitParams != null) { foreach (var item in e.InitParams) { this.Resources.Add(item.Key, item.Value); } } this.RootVisual = new MainPage(); } Where InitParams always has Count = 0 and I don't know why. Can someone help me ? I'm just trying to pass a value to my Silverlight application, without a PostBack. Rendered <object width="550px" height="250px" type="application/x-silverlight-2" data="data:application/x-silverlight-2,"> <param value="../../ClientBin/FotoEmprestimoChave.xap" name="source"> <param value="onSilverlightError" name="onError"> <param value="white" name="background"> <param value="4.0.60310.0" name="minRuntimeVersion"> <param value="true" name="autoUpgrade"> <param values="chave_id=1" name="initparams"> <a style="text-decoration:none" href="http://go.microsoft.com/fwlink/?LinkID=149156&v=4.0.60310.0"> </object>

  Read the article

• Backbone.js (model instanceof Model) via Chrome Extension

  - by Leoncelot

  Hey guys, This is my first time ever posting on this site and the problem I'm about to pose is difficult to articulate due to the set of variables required to arrive at it. Let me just quickly explain the framework I'm working with. I'm building a Chrome Extension using jQuery, jQuery-ui, and Backbone The entire JS suite for the extension is written in CoffeeScript and I'm utilizing Rails and the asset pipeline to manage it all. This means that when I want to deploy my extension code I run rake assets:precompile and copy the resulting compressed JS to my extensions Directory. The nice thing about this approach is that I can actually run the extension js from inside my Rails app by including the library. This is basically the same as my extensions background.js file which injects the js as a content script. Anyway, the problem I've recently encountered was when I tried testing my extension on my buddy's site, whiskeynotes.com. What I was noticing is that my backbone models were being mangled upon adding them to their respective collections. So something like this.collection.add(new SomeModel) created some nonsense version of my model. This code eventually runs into Backbone's prepareModel code _prepareModel: function(model, options) { options || (options = {}); if (!(model instanceof Model)) { var attrs = model; options.collection = this; model = new this.model(attrs, options); if (!model._validate(model.attributes, options)) model = false; } else if (!model.collection) { model.collection = this; } return model; }, Now, in most of the sites on which I've tested the extension, the result is normal, however on my buddy's site the !(model instance Model) evaluates to true even though it is actually an instance of the correct class. The consequence is a super messed up version of the model where the model's attributes is a reference to the models collection (strange right?). Needless to say, all kinds of crazy things were happening afterward. Why this is occurring is beyond me. However changing this line (!(model instanceof Model)) to (!(model instanceof Backbone.Model)) seems to fix the problem. I thought maybe it had something to do with the Flot library (jQuery graph library) creating their own version of 'Model' but looking through the source yielded no instances of it. I'm just curious as to why this would happen. And does it make sense to add this little change to the Backbone source? Update: I just realized that the "fix" doesn't actually work. I can also add that my backbone Models are namespaced in a wrapping object so that declaration looks something like class SomeNamespace.SomeModel extends Backbone.Model

  Read the article

• how to user ajax with json in ruby on rails

  - by fenec

  I am implemeting a facebook application in rails using facebooker plugin, therefore it is very important to use this architecture if i want to update multiple DOM in my page. if my code works in a regular rails application it would work in my facebook application. i am trying to use ajax to let the user know that the comment was sent, and update the comments bloc. migration: class CreateComments < ActiveRecord::Migration def self.up create_table :comments do |t| t.string :body t.timestamps end end def self.down drop_table :comments end end controller: class CommentsController < ApplicationController def index @comments=Comment.all end def create @comment=Comment.create(params[:comment]) if request.xhr? @comments=Comment.all render :json=>{:ids_to_update=>[:all_comments,:form_message], :all_comments=>render_to_string(:partial=>"comments" ), :form_message=>"Your comment has been added." } else redirect_to comments_url end end end view: <script> function update_count(str,message_id) { len=str.length; if (len < 200) { $(message_id).innerHTML="<span style='color: green'>"+ (200-len)+" remaining</span>"; } else { $(message_id).innerHTML="<span style='color: red'>"+ "Comment too long. Only 200 characters allowed.</span>"; } } function update_multiple(json) { for( var i=0; i<json["ids_to_update"].length; i++ ) { id=json["ids_to_update"][i]; $(id).innerHTML=json[id]; } } </script> <div id="all_comments" > <%= render :partial=>"comments/comments" %> </div> Talk some trash: <br /> <% remote_form_for Comment.new, :url=>comments_url, :success=>"update_multiple(request)" do |f|%> <%= f.text_area :body, :onchange=>"update_count(this.getValue(),'remaining');" , :onkeyup=>"update_count(this.getValue(),'remaining');" %> <br /> <%= f.submit 'Post'%> <% end %> <p id="remaining" >&nbsp;</p> <p id="form_message" >&nbsp;</p> <br><br> <br> if i try to do alert(json) in the first line of the update_multiple function , i got an [object Object]. if i try to do alert(json["ids_to_update"][0]) in the first line of the update_multiple function , there is no dialog box displayed. however the comment got saved but nothing is updated. questions: 1.how can javascript and rails know that i am dealing with json objects? 2.how can i debug this problem? 3.how can i get it to work?

  Read the article

• Marshalling non-Blittable Structs from C# to C++

  - by Greggo

  I'm in the process of rewriting an overengineered and unmaintainable chunk of my company's library code that interfaces between C# and C++. I've started looking into P/Invoke, but it seems like there's not much in the way of accessible help. We're passing a struct that contains various parameters and settings down to unmanaged codes, so we're defining identical structs. We don't need to change any of those parameters on the C++ side, but we do need to access them after the P/Invoked function has returned. My questions are: What is the best way to pass strings? Some are short (device id's which can be set by us), and some are file paths (which may contain Asian characters) Should I pass an IntPtr to the C# struct or should I just let the Marshaller take care of it by putting the struct type in the function signature? Should I be worried about any non-pointer datatypes like bools or enums (in other, related structs)? We have the treat warnings as errors flag set in C++ so we can't use the Microsoft extension for enums to force a datatype. Is P/Invoke actually the way to go? There was some Microsoft documentation about Implicit P/Invoke that said it was more type-safe and performant. For reference, here is one of the pairs of structs I've written so far: C++ /** Struct used for marshalling Scan parameters from managed to unmanaged code. */ struct ScanParameters { LPSTR deviceID; LPSTR spdClock; LPSTR spdStartTrigger; double spinRpm; double startRadius; double endRadius; double trackSpacing; UINT64 numTracks; UINT32 nominalSampleCount; double gainLimit; double sampleRate; double scanHeight; LPWSTR qmoPath; //includes filename LPWSTR qzpPath; //includes filename }; C# /// <summary> /// Struct used for marshalling scan parameters between managed and unmanaged code. /// </summary> [StructLayout(LayoutKind.Sequential)] public struct ScanParameters { [MarshalAs(UnmanagedType.LPStr)] public string deviceID; [MarshalAs(UnmanagedType.LPStr)] public string spdClock; [MarshalAs(UnmanagedType.LPStr)] public string spdStartTrigger; public Double spinRpm; public Double startRadius; public Double endRadius; public Double trackSpacing; public UInt64 numTracks; public UInt32 nominalSampleCount; public Double gainLimit; public Double sampleRate; public Double scanHeight; [MarshalAs(UnmanagedType.LPWStr)] public string qmoPath; [MarshalAs(UnmanagedType.LPWStr)] public string qzpPath; }

  Read the article

• NHibernate and objects with value-semantics

  - by Groo

  Problem: If I pass a class with value semantics (Equals method overridden) to NHibernate, NHibernate tries to save it to db even though it just saved an entity equal by value (but not by reference) to the database. What am I doing wrong? Here is a simplified example model for my problem: Let's say I have a Person entity and a City entity. One thread (producer) is creating new Person objects which belong to a specific existing City, and another thread (consumer) is saving them to a repository (using NHibernate as DAL). Since there is lot of objects being flushed at a time, I am using Guid.Comb id's to ensure that each insert is made using a single SQL command. City is an object with value-type semantics (equal by name only -- for this example purposes only): public class City : IEquatable<City> { public virtual Guid Id { get; private set; } public virtual string Name { get; set; } public virtual bool Equals(City other) { if (other == null) return false; return this.Name == other.Name; } public override bool Equals(object obj) { return Equals(obj as City); } public override int GetHashCode() { return this.Name.GetHashCode(); } } Fluent NH mapping is something like: public class PersonMap : ClassMap<Person> { public PersonMap() { Id(x => x.Id) .GeneratedBy.GuidComb(); References(x => x.City) .Cascade.SaveUpdate(); } } public class CityMap : ClassMap<City> { public CityMap() { Id(x => x.Id) .GeneratedBy.GuidComb(); Map(x => x.Name); } } Right now (with my current NHibernate mapping config), my consumer thread maintains a dictionary of cities and replaces their references in incoming person objects (otherwise NHibernate will see a new, non-cached City object and try to save it as well), and I need to do it for every produced Person object. Since I have implemented City class to behave like a value type, I hoped that NHibernate would compare Cities by value and not try to save them each time -- i.e. I would only need to do a lookup once per session and not care about them anymore. Is this possible, and if yes, what am I doing wrong here?

  Read the article

• SQL Native Client 10 Performance miserable (due to server-side cursors)

  - by namezero

  we have an application that uses ODBC via CDatabase/CRecordset in MFC (VS2010). We have two backends implemented. MSSQL and MySQL. Now, when we use MSSQL (with the Native Client 10.0), retrieving records with SELECT is dramatically slow via slow links (VPN, for example). The MySQL ODBC driver does not exhibit this nasty behavior. For example: CRecordset r(&m_db); r.Open(CRecordset::snapshot, L"SELECT a.something, b.sthelse FROM TableA AS a LEFT JOIN TableB AS b ON a.ID=b.Ref"); r.MoveFirst(); while(!r.IsEOF()) { // Retrieve CString strData; crs.GetFieldValue(L"a.something", strData); crs.MoveNext(); } Now, with the MySQL driver, everything runs as it should. The query is returned, and everything is lightning fast. However, with the MSSQL Native Client, things slow down, because on every MoveNext(), the driver communicates with the server. I think it is due to server-side cursors, but I didn't find a way to disable them. I have tried using: ::SQLSetConnectAttr(m_db.m_hdbc, SQL_ATTR_ODBC_CURSORS, SQL_CUR_USE_ODBC, SQL_IS_INTEGER); But this didn't help either. There are still long-running exec's to sp_cursorfetch() et al in SQL Profiler. I have also tried a small reference project with SQLAPI and bulk fetch, but that hangs in FetchNext() for a long time, too (even if there is only one record in the resultset). This however only happens on queries with LEFT JOINS, table-valued functions, etc. Note that the query doesn't take that long - executing the same SQL via SQL Studio over the same connection returns in a reasonable time. Question1: Is is possible to somehow get the native client to "cache" all results locally use local cursors in a similar fashion as the MySQL driver seems to do it? Maybe this is the wrong approach altogether, but I'm not sure how else to do this. All we want is to retrieve all data at once from a SELECT, then never talk the server again until the next query. We don't care about recordset updates, deletes, etc or any of that nonsense. We only want to retrieve data. We take that recordset, get all the data, and delete it. Question2: Is there a more efficient way to just retrieve data in MFC with ODBC?

  Read the article

• Inserting a string array as a row into an Excel document using the Open XML SDK 2.0

  - by Sam

  The code runs, but corrupts my excel document. Any help would be mucho appreciated! I used this as a reference. public void AddRow(string fileName, string[] values) { using (SpreadsheetDocument doc = SpreadsheetDocument.Open(fileName, true)) { SharedStringTablePart sharedStringPart = GetSharedStringPart(doc); WorksheetPart worksheetPart = doc.WorkbookPart.WorksheetParts.First(); uint rowIdx = AppendRow(worksheetPart); for (int i = 0; i < values.Length; ++i) { int stringIdx = InsertSharedString(values[i], sharedStringPart); Cell cell = InsertCell(i, rowIdx, worksheetPart); cell.CellValue = new CellValue(stringIdx.ToString()); cell.DataType = new EnumValue<CellValues>( CellValues.SharedString); worksheetPart.Worksheet.Save(); } } } private SharedStringTablePart GetSharedStringPart( SpreadsheetDocument doc) { if (doc.WorkbookPart. GetPartsCountOfType<SharedStringTablePart>() > 0) return doc.WorkbookPart. GetPartsOfType<SharedStringTablePart>().First(); else return doc.WorkbookPart. AddNewPart<SharedStringTablePart>(); } private uint AppendRow(WorksheetPart worksheetPart) { SheetData sheetData = worksheetPart.Worksheet. GetFirstChild<SheetData>(); uint rowIndex = (uint)sheetData.Elements<Row>().Count(); Row row = new Row() { RowIndex = rowIndex }; sheetData.Append(row); return rowIndex; } private int InsertSharedString(string s, SharedStringTablePart sharedStringPart) { if (sharedStringPart.SharedStringTable == null) sharedStringPart.SharedStringTable = new SharedStringTable(); int i = 0; foreach (SharedStringItem item in sharedStringPart.SharedStringTable. Elements<SharedStringItem>()) { if (item.InnerText == s) return i; ++i; } sharedStringPart.SharedStringTable.AppendChild( new Text(s)); sharedStringPart.SharedStringTable.Save(); return i; } private Cell InsertCell(int i, uint rowIdx, WorksheetPart worksheetPart) { SheetData sheetData = worksheetPart.Worksheet. GetFirstChild<SheetData>(); string cellReference = AlphabetMap.Instance[i] + rowIdx; Cell cell = new Cell() { CellReference = cellReference }; Row row = sheetData.Elements<Row>().ElementAt((int)rowIdx); row.InsertAt(cell, i); worksheetPart.Worksheet.Save(); return cell; }

  Read the article

• cellForRowAtIndexPath called too late

  - by Mihai Fonoage

  Hi, I am trying to re-load a table every time some data I get from the web is available. This is what I have: SearchDataViewController: - (void)parseDatatXML { parsingDelegate = [[XMLParsingDelegate alloc] init]; parsingDelegate.searchDataController = self; // CONTAINS THE TABLE THAT NEEDS RE-LOADING; ImplementedSearchViewController *searchController = [[ImplementedSearchViewController alloc] initWithNibName:@"ImplementedSearchView" bundle:nil]; ProjectAppDelegate *delegate = [[UIApplication sharedApplication] delegate]; UINavigationController *nav = (UINavigationController *)[delegate.splitViewController.viewControllers objectAtIndex: 0]; NSArray *viewControllers = [[NSArray alloc] initWithObjects:nav, searchController, nil]; self.splitViewController.viewControllers = viewControllers; [viewControllers release]; // PASS A REFERENCE TO THE PARSING DELEGATE SO THAT IT CAN CALL reloadData on the table parsingDelegate.searchViewController = searchController; [searchController release]; // Build the url request used to fetch data ... NSURLRequest *dataURLRequest = [NSURLRequest requestWithURL:[NSURL URLWithString:dataURL]]; parsingDelegate.feedConnection = [[[NSURLConnection alloc] initWithRequest:dataURLRequest delegate:parsingDelegate] autorelease]; } ImplementedSearchViewController: - (NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { NSLog(@"count = %d", [keys count]); // keys IS A NSMutableArray return [self.keys count]; } - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { ... cell.textLabel.text = [keys objectAtIndex:row]; ... } XMLParsingDelgate: -(void) updateSearchTable:(NSArray *)array { ... [self.currentParseBatch addObject:(NSString *)[array objectAtIndex:1]]; // RELOAD TABLE [self.searchViewController.table reloadData]; } - (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qualifiedName attributes:(NSDictionary *)attributeDict { if ([elementName isEqualToString:@"..."]) { self.currentParseBatch = [NSMutableArray array]; searchViewController.keys = self.currentParseBatch; ... } ... } - (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName { if ([elementName isEqualToString:@"..."]) { ... [self performSelectorOnMainThread:@selector(updateSearchTable:) withObject:array waitUntilDone:NO]; } ... } My problem is that when I debug, the calls go between reloadData and numberOfRowsInSection until the keys array is filled with the last data, time at which the cellForRowAtIndexPath gets called. I wanted the table to be updated for each element I send, one by one, instead of just in the end. Any ideas why this behavior? Thank you!

  Read the article

• ASP.Net / MySQL : Translating content into several languages

  - by philwilks

  I have an ASP.Net website which uses a MySQL database for the back end. The website is an English e-commerce system, and we are looking at the possibility of translating it into about five other languages (French, Spanish etc). We will be getting human translators to perform the translation - we've looked at automated services but these aren't good enough. The static text on the site (e.g. headings, buttons etc) can easily be served up in multiple languages via .Net's built in localization features (resx files etc). The thing that I'm not so sure about it how best to store and retrieve the multi-language content in the database. For example, there is a products table that includes these fields... productId (int) categoryId (int) title (varchar) summary (varchar) description (text) features (text) The title, summary, description and features text would need to be available in all the different languages. Here are the two options that I've come up with... Create additional field for each language For example we could have titleEn, titleFr, titleEs etc for all the languages, and repeat this for all text columns. We would then adapt our code to use the appropriate field depending on the language selected. This feels a bit hacky, and also would lead to some very large tables. Also, if we wanted to add additional languages in the future it would be time consuming to add even more columns. Use a lookup table We could create a new table with the following format... textId | languageId | content ------------------------------- 10 | EN | Car 10 | FR | Voiture 10 | ES | Coche 11 | EN | Bike 11 | FR | Vélo We'd then adapt our products table to reference the appropriate textId for the title, summary, description and features instead of having the text stored in the product table. This seems much more elegant, but I can't think of a simple way of getting this data out of the database and onto the page without using complex SQL statements. Of course adding new languages in the future would be very simple compared to the previous option. I'd be very grateful for any suggestions about the best way to achieve this! Is there any "best practice" guidance out there? Has anyone done this before?

  Read the article

• Clearcase - selective merge.

  - by Keshav

  Hi, I have a peculiar Clearcase doubt. I cannot fully describe why I'm doing such a confusing architecture, but I need to do it (thanks to the mistake done by someone long back). Ok, here's a bit of detail: B1 is a contaminated branch where both my group's changes and another group's changes got mixed together so badly that there is no way of finding which code is whose). So the solution proposed is to create a new branch called B2 (at the same level as B1) and put all the unmodified code of the other group on it (The way to do that would be to merge B1 with B2 and then go about removing all changes from it till it becomes original). Then create a CR branch on B1 and keep only my group's newly added files or modified files on that branch. Finally create an integration branch out of B2 and merge the changes from CR branch of B1 to integration branch of B2. So here is what I did: (The use case is where I have dir D where file a, b and c are there. My group ended up modifying file a while b and c are not modified at all). There is a branch B1 on which there are files a, b and c. There is another branch B2. A merge is done from B1 to B2. Now B2 also has a, b and c. At this point both branch B1 and B2 are same. Now I delete file a from branch B2 (rmname). Now B2 has b and c only. I put a label to this branch called Label1. This makes the code with label Label1 as the unmodified code from other group. Now I create a sub branch called CR1 from B1 and delete all the files that are there in B2 branch (i.e b and c) such that it contains only the modified code from original code on it. In my case it is file a. At this point branch B2 with label Label1 has files b and c (those are unmodified code) and branch CR1 coming off B1 has only a (that is modified by us). Now I create another branch called integration branch that comes off B2 Label1. And then I do a merge of CR branch on to that expecting that it will have all three files a, b and c for me. All I'd need to do is to do a version tree view and see who modified what. But the problem I face is that since I had done a rmname of file a on branch B2 earlier to putting Label. The merge does not really take the file a from CR branch. How to I get around that problem. I want to selectively merge. Is it possible? sorry if it is a bad design. I'm not really conversant with Clear case and have limited options and time to clear some one else's mess.

  Read the article

• How do you programmatically set a Style on a View?

  - by Greg

  I would like to do something like this: <Button android:id="@+id/button" android:layout_width="wrap_content" android:layout_height="wrap_cotent" style="@style/SubmitButtonType" /> But in code The xml approach works fine provided that SubmitButtonType is defined. Now what I assume happens is that the appt parser runs through this xml, generates an AttributeSet. That AttributeSet when passed to context/theme#obtainStyledAttributes() will have the style ref mask anything that is not written inline in this tag. Great that's fine! Now how do we do this programmatically. Button, as well as other View types, has a constructor that has the form: <Widget>(Context context, AttributeSet set, int defStyle). So I thought this would work. Button button = new Button(context, null, R.style.SubmitButtonType); However, I am finding that defStyle is badly documented as it really should be written to be a resourceId to an attribute (from R.attrs) that will be passed to obtainStyledAttributes() as the attribute resource, and not the style resource. After looking at the code, all the view implementations seem to pass 0 as the styleRef. I don't see the harm in having it passed as both the attr and the style resource (more flexible and negligible overhead) However I might be approaching this all wrong. How do you do this in code then other than by setting each individual element of the style to the specific widget you want to style (only possible by looking a the code to see what param maps to which method or set of methods). The only way I have found to do this is: <declare-styleable> <attr name="totallyAdhoc_attribute_just_for_this_case" format="reference"> </declare-styleable> <style name="MyAlreadyExistantTheme" > ... ... <item name="totallyAdhoc_attribute_just_for_this_case">@style/SubmitButtonType</item> </style> And instead of passing R.style.SubmitButtonType as defStyle, I pass the new R.attr.totallyAdhoc_attribute_just_for_this_case. Button button = new Button(context, null, R.attr.totallyAdhoc_attribute_just_for_this_case); This works but sounds way too complicated.

  Read the article

• [C++] Multiple inheritance from template class

  - by Tom P.

  Hello, I'm having issues with multiple inheritance from different instantiations of the same template class. Specifically, I'm trying to do this: template <class T> class Base { public: Base() : obj(NULL) { } virtual ~Base() { if( obj != NULL ) delete obj; } template <class T> T* createBase() { obj = new T(); return obj; } protected: T* obj; }; class Something { // ... }; class SomethingElse { // ... }; class Derived : public Base<Something>, public Base<SomethingElse> { }; int main() { Derived* d = new Derived(); Something* smth1 = d->createBase<Something>(); SomethingElse* smth2 = d->createBase<SomethingElse>(); delete d; return 0; } When I try to compile the above code, I get the following errors: 1>[...](41) : error C2440: '=' : cannot convert from 'SomethingElse *' to 'Something *' 1> Types pointed to are unrelated; conversion requires reinterpret_cast, C-style cast or function-style cast 1> [...](71) : see reference to function template instantiation 'T *Base<Something>::createBase<SomethingElse>(void)' being compiled 1> with 1> [ 1> T=SomethingElse 1> ] 1>[...](43) : error C2440: 'return' : cannot convert from 'Something *' to 'SomethingElse *' 1> Types pointed to are unrelated; conversion requires reinterpret_cast, C-style cast or function-style cast The issue seems to be ambiguity due to member obj being inherited from both Base< Something and Base< SomethingElse , and I can work around it by disambiguating my calls to createBase: Something* smth1 = d->Base<Something>::createBase<Something>(); SomethingElse* smth2 = d->Base<SomethingElse>::createBase<SomethingElse>(); However, this solution is dreadfully impractical, syntactically speaking, and I'd prefer something more elegant. Moreover, I'm puzzled by the first error message. It seems to imply that there is an instantiation createBase< SomethingElse in Base< Something , but how is that even possible? Any information or advice regarding this issue would be much appreciated.

  Read the article

• Robust way to save/load objects with dependencies?

  - by mrteacup

  I'm writing an Android game in Java and I need a robust way to save and load application state quickly. The question seems to apply to most OO languages. To understand what I need to save: I'm using a Strategy pattern to control my game entities. The idea is I have a very general Entity class which e.g. stores the location of a bullet/player/enemy and I then attach a Behaviour class that tells the entity how to act: class Entiy { float x; float y; Behavior b; } abstract class Behavior { void update(Entity e); {} // Move about at a constant speed class MoveBehavior extends Behavior { float speed; void update ... } // Chase after another entity class ChaseBehavior extends Behavior { Entity target; void update ... } // Perform two behaviours in sequence class CombineBehavior extends Behavior { Behaviour a, b; void update ... } Essentially, Entity objects are easy to save but Behaviour objects can have a semi-complex graph of dependencies between other Entity objects and other Behaviour objects. I also have cases where a Behaviour object is shared between entities. I'm willing to change my design to make saving/loading state easier, but the above design works really well for structuring the game. Anyway, the options I've considered are: Use Java serialization. This is meant to be really slow in Android (I'll profile it sometime). I'm worried about robustness when changes are made between versions however. Use something like JSON or XML. I'm not sure how I would cope with storing the dependencies between objects however. Would I have to give each object a unique ID and then use these IDs on loading to link the right objects together? I thought I could e.g. change the ChaseBehaviour to store a ID to an entity, instead of a reference, that would be used to look up the Entity before performing the behaviour. I'd rather avoid having to write lots of loading/saving code myself as I find it really easy to make mistakes (e.g. forgetting to save something, reading things out in the wrong order). Can anyone give me any tips on good formats to save to or class designs that make saving state easier?

  Read the article

• Need Google Map InfoWindow Hyperlink to Open Content in Overlay (Fusion Table Usage)

  - by McKev

  I have the following code established to render the map in my site. When the map is clicked, the info window pops up with a bunch of content including a hyperlink to open up a website with a form in it. I would like to utilize a function like fancybox to open up this link "form" in an overlay. I have read that fancybox doesn't support calling the function from within an iframe, and was wondering if there was a way to pass the link data to the DOM and trigger the fancybox (or another overlay option) in another way? Maybe a callback trick - any tips would be much appreciated! <style> #map-canvas { width:850px; height:600px; } </style> <script type="text/javascript" src="http://maps.google.com/maps/api/js?sensor=true"></script> <script src="http://gmaps-utility-gis.googlecode.com/svn/trunk/fusiontips/src/fusiontips.js" type="text/javascript"></script> <script type="text/javascript"> var map; var tableid = "1nDFsxuYxr54viD_fuH7fGm1QRZRdcxFKbSwwRjk"; var layer; var initialLocation; var browserSupportFlag = new Boolean(); var uscenter = new google.maps.LatLng(37.6970, -91.8096); function initialize() { map = new google.maps.Map(document.getElementById('map-canvas'), { zoom: 4, mapTypeId: google.maps.MapTypeId.ROADMAP }); layer = new google.maps.FusionTablesLayer({ query: { select: "'Geometry'", from: tableid }, map: map }); //http://gmaps-utility-gis.googlecode.com/svn/trunk/fusiontips/docs/reference.html layer.enableMapTips({ select: "'Contact Name','Contact Title','Contact Location','Contact Phone'", from: tableid, geometryColumn: 'Geometry', suppressMapTips: false, delay: 500, tolerance: 8 }); ; // Try W3C Geolocation (Preferred) if(navigator.geolocation) { browserSupportFlag = true; navigator.geolocation.getCurrentPosition(function(position) { initialLocation = new google.maps.LatLng(position.coords.latitude,position.coords.longitude); map.setCenter(initialLocation); //Custom Marker var pinColor = "A83C0A"; var pinImage = new google.maps.MarkerImage("http://chart.apis.google.com/chart?chst=d_map_pin_letter&chld=%E2%80%A2|" + pinColor, new google.maps.Size(21, 34), new google.maps.Point(0,0), new google.maps.Point(10, 34)); var pinShadow = new google.maps.MarkerImage("http://chart.apis.google.com/chart?chst=d_map_pin_shadow", new google.maps.Size(40, 37), new google.maps.Point(0, 0), new google.maps.Point(12, 35)); new google.maps.Marker({ position: initialLocation, map: map, icon: pinImage, shadow: pinShadow }); }, function() { handleNoGeolocation(browserSupportFlag); }); } // Browser doesn't support Geolocation else { browserSupportFlag = false; handleNoGeolocation(browserSupportFlag); } function handleNoGeolocation(errorFlag) { if (errorFlag == true) { //Geolocation service failed initialLocation = uscenter; } else { //Browser doesn't support geolocation initialLocation = uscenter; } map.setCenter(initialLocation); } } google.maps.event.addDomListener(window, 'load', initialize); </script>

  Read the article

• Select latest group by in nhibernate

  - by Kendrick

  I have Canine and CanineHandler objects in my application. The CanineHandler object has a PersonID (which references a completely different database), an EffectiveDate (which specifies when a handler started with the canine), and a FK reference to the Canine (CanineID). Given a specific PersonID, I want to find all canines they're currently responsible for. The (simplified) query I'd use in SQL would be: Select Canine.* from Canine inner join CanineHandler on(CanineHandler.CanineID=Canine.CanineID) inner join (select CanineID,Max(EffectiveDate) MaxEffectiveDate from caninehandler group by CanineID) as CurrentHandler on(CurrentHandler.CanineID=CanineHandler.CanineID and CurrentHandler.MaxEffectiveDate=CanineHandler.EffectiveDate) where CanineHandler.HandlerPersonID=@PersonID Edit: Added mapping files below: <class name="CanineHandler" table="CanineHandler" schema="dbo"> <id name="CanineHandlerID" type="Int32"> <generator class="identity" /> </id> <property name="EffectiveDate" type="DateTime" precision="16" not-null="true" /> <property name="HandlerPersonID" type="Int64" precision="19" not-null="true" /> <many-to-one name="Canine" class="Canine" column="CanineID" not-null="true" access="field.camelcase-underscore" /> </class> <class name="Canine" table="Canine"> <id name="CanineID" type="Int32"> <generator class="identity" /> </id> <property name="Name" type="String" length="64" not-null="true" /> ... <set name="CanineHandlers" table="CanineHandler" inverse="true" order-by="EffectiveDate desc" cascade="save-update" access="field.camelcase-underscore"> <key column="CanineID" /> <one-to-many class="CanineHandler" /> </set> <property name="IsDeleted" type="Boolean" not-null="true" /> </class> I haven't tried yet, but I'm guessing I could do this in HQL. I haven't had to write anything in HQL yet, so I'll have to tackle that eventually anyway, but my question is whether/how I can do this sub-query with the criterion/subqueries objects. I got as far as creating the following detached criteria: DetachedCriteria effectiveHandlers = DetachedCriteria.For<Canine>() .SetProjection(Projections.ProjectionList() .Add(Projections.Max("EffectiveDate"),"MaxEffectiveDate") .Add(Projections.GroupProperty("CanineID"),"handledCanineID") ); but I can't figure out how to do the inner join. If I do this: Session.CreateCriteria<Canine>() .CreateCriteria("CanineHandler", "handler", NHibernate.SqlCommand.JoinType.InnerJoin) .List<Canine>(); I get an error "could not resolve property: CanineHandler of: OPS.CanineApp.Model.Canine". Obviously I'm missing something(s) but from the documentation I got the impression that should return a list of Canines that have handlers (possibly with duplicates). Until I can make this work, adding the subquery isn't going to work... I've found similar questions, such as http://stackoverflow.com/questions/747382/only-get-latest-results-using-nhibernate but none of the answers really seem to apply with the kind of direct result I'm looking for. Any help or suggestion is greatly appreciated.

  Read the article

• jQuery - Sorting an array?

  - by Probocop

  Hi, I'm using Ajax to get some XML, and then filling in some fields on a form with the results. There is a numerical field on the form and I would like to sort the results by this number (highest first). How would I go about doing this in jQuery? My js function code is currently: function linkCounts() { ws_url = "http://archreport.epiphanydev2.co.uk/worker.php?query=linkcounts&domain="+$('#hidden_the_domain').val(); $.ajax({ type: "GET", url: ws_url, dataType: "xml", success: function(xmlIn){ results = xmlIn.getElementsByTagName("URL"); for ( var i = 0; i < results.length; i++ ) { $("#tb_domain_linkcount_url_"+(i+1)).val($(results[i].getElementsByTagName("Page")).text()); $("#tb_domain_linkcount_num_"+(i+1)).val($(results[i].getElementsByTagName("Links")).text()); } $('#img_linkcount_worked').attr("src","/images/worked.jpg"); }, error: function(){$('#img_linkcount_worked').attr("src","/images/failed.jpg");} }); } The Links tag is the one I'm wanting to sort it on. Thanks For reference the XML that's getting returned is like the following: <?xml version="1.0" encoding="utf-8" standalone="yes"?> <Response> <ResponseCode>1</ResponseCode> <ResponseStatus>OK</ResponseStatus> <ReportId>2</ReportId> <UrlChecked /> <MaxLinks>75</MaxLinks> <PagesFound>121</PagesFound> <URLs> <URL> <Page>http://www.epiphanysolutions.co.uk/blog</Page> <Links>78</Links> </URL> <URL> <Page>http://www.epiphanysolutions.co.uk/blog/</Page> <Links>78</Links> </URL> <URL> <Page>http://www.epiphanysolutions.co.uk/blog/author/daniel-peden/</Page> <Links>78</Links> </URL> <URL> <Page>http://www.epiphanysolutions.co.uk/blog/author/daniel-peden/page/2/</Page> <Links>78</Links> </URL> </URLS> </Response>

  Read the article

< Previous Page | 597 598 599 600 601 602 603 604 605 606 607 608  | Next Page >