Search Results

Search found 23427 results on 938 pages for 'christopher done'.

Page 607/938 | < Previous Page | 603 604 605 606 607 608 609 610 611 612 613 614  | Next Page >

  • Would it be possible for web browsers to automatically update rendering engines?

    - by unknowing
    As a way to prevent the major annoyances of browser segmentation and older versions. This way the code would only need to be done for the latest version of the browser, but users could still have the functionality of the older version and not be forced to do major updates? I am sure there will be some major flaws in this, and I would like you to tell me what they are! -Obviously, people may not want this as often auto-updating is frowned upon, however Chrome does it (or at least, they used to); Without a manual check, Chrome will update itself automatically, Google said. "Google Chrome will automatically checks for updates approximately every five hours. If an update is available, it will be downloaded and applied at the next browser restart," Google said. -there is still the problem of getting users from the really old ones onto the any new browsers that have this functionality -To prevent exploits in terms of updates, maybe they could have a 7 day opt-in period before being pushed out to everyone?

    Read the article

  • Capture subprocess output

    - by schneck
    Hi there, I learned that when executing commands in Python, I should use subprocess. What I'm trying to achieve is to encode a file via ffmpeg and observe the program output until the file is done. Ffmpeg logs the progress to stderr. If I try something like this: child = subprocess.Popen(command, shell=True, stderr=subprocess.PIPE) complete = False while not complete: stderr = child.communicate() # Get progress print "Progress here later" if child.poll() is not None: complete = True time.sleep(2) the programm does not continue after calling child.communicate() and waits for the command to complete. Is there any other way to follow the output?

    Read the article

  • Manually manipulating ArrayList

    - by jsan
    I have an assignment where I have to create a deque, however I am not allowed to use any built-in classes or interfaces. I am implementing my deque using an array list. My problem is that when I have to, for instance, add to the beginning of the array list (beginning of the queue), i am not allowed to do this: public void addFirst(ArrayList<Integer> array) { array.add(0, int); } Is there a way to do this without using the add() function? Such as manually adding to the front and shifting the rest of the array to the right? Or maybe creating a new array list and copying...I'm not sure. Any help would be great; I have a bunch of functions to write, and getting the first one done will definitely put me in the right direction. Thanks

    Read the article

  • nextSibling issue, should be simple

    - by SoLoGHoST
    Ok, I'm trying to come to grips with this nextSibling function in JS. Here's my issue within the following code... var fromRow = document.getElementById("row_1"); while(fromRow.nodeType == 1 && fromRow.nextSibling != null) { var fRowId = fromRow.id; if (!fRowId) continue; // THIS ONLY gets done once and alerts "row_1" ONLY :( alert(fRowId); fromRow = fromRow.nextSibling; } Ok can someone please tell me what is wrong with this code? There are siblings next to this document.getElementById("row_1"); element for sure as I can see them, and they all have id attributes, so why is it not getting the id attributes of the siblings?? I don't get it. row_1 is a TR element, and I need to get the TR elements next to it within this table, but for some reason, it only gets the 1 element that I can already get using document.getElementById, arggg. Thanks guys :)

    Read the article

  • If you had to work with horrible HTML, what would you do?

    - by Doug
    I was looking over some of my friend's HTML and CSS, and I was speechless (in a bad way). If I had to work with that, such as putting AJAX into it, then it would have been a lot of work. I would have to rebuild a lot of the HTML aspects, otherwise it wouldn't work well with the AJAX. What would you do in a situation like so? Would you just edit at the minimum? Would you do a overhaul and redo the whole HTML aspect? Would you go back to the client and ask for more money because it was a lot more work than expected? I'm interested in strategies and approaches and how it's done out in the field.

    Read the article

  • Is tertiary operator possible here?

    - by silow
    I'm trying to set $value1, $value2, $value3 entirely using tertiary operators. This is what it looks like without tertiary if ($chk1 == 20) { $value1 = true; if ($chk2 == 40) { $value2 = 100 ; $value3 = 300; } else { $value2 = 200 ; $value3 = 400; } } else { $value1 = false; } I can set $value2 and $value3, but not sure how to set $value1. Can it be done? if ($chk1 == 20) { $value1 = true; $value2 = ($chk2 == 40) ? 100 : 200; $value3 = ($chk2 == 40) ? 300 : 400; } else { $value1 = false; }

    Read the article

  • sql query is too slow, how to improve speed

    - by user1289282
    I have run into a bottleneck when trying to update one of my tables. The player table has, among other things, id, skill, school, weight. What I am trying to do is: SELECT id, skill FROM player WHERE player.school = (current school of 4500) AND player.weight = (current weight of 14) to find the highest skill of all players returned from the query UPDATE player SET starter = 'TRUE' WHERE id = (highest skill) move to next weight and repeat when all weights have been completed move to next school and start over all schools completed, done I have this code implemented and it works, but I have approximately 4500 schools totaling 172000 players and the way I have it now, it would take probably a half hour or more to complete (did not wait it out), which is way too slow. How to speed this up? Short of reducing the scale of the system, I am willing to do anything that gets the intended result. Thanks! *the weights are the standard folk style wrestling weights ie, 103, 113, 120, 126, 132, 138, 145, 152, 160, 170, 182, 195, 220, 285 pounds

    Read the article

  • Return color on hover

    - by alonblack
    Here i created 3 images that goes from color to grayscale and i want to show the color on hover what i'v done wrong? here is the fiddle link: http://jsfiddle.net/4tHWg/6/ css code: .box { float: left; position: relative; width: 14.285714286%; } .boxInner img { width: 100%; display: block; } .boxInner img:hover { -webkit-filter: grayscale(0%); } @-webkit-keyframes toGrayScale { to { -webkit-filter: grayscale(100%); } } .box:nth-child(1) img { -webkit-animation: toGrayScale 1s 0.5s forwards; } .box:nth-child(2) img { -webkit-animation: toGrayScale 2s 1s forwards; } .box:nth-child(3) img { -webkit-animation: toGrayScale 3s 1.5s forwards; }

    Read the article

  • ASP: using existing Crystal Report with date parameter

    - by eric3141
    I have an existing Crystal Report done in Crystal Reports version 9. I need to display it via an ASP website created in Visual Studio 2008. I have put the Crystal data source and viewer controls on the design page and configured the controls to use the crystal report but cannot seem to figure out how to pass a date to the report which uses it as an input parameter for a SQL Server 2005 stored procedure. I have tried putting a calendar control on the design page but don't know how to use it to pass the date parameter. Thanks in advance for any help. Eric

    Read the article

  • How to arrange labels in a flowlayout manner?

    - by Tim Büthe
    How do I arrange some UILabels and/or UIButtons of a variable length? I just want to add them to a UITableViewCell and they should arrange in a left-to-right flow, much like lines of text in a paragraph. I only found possibilities to create lables with a fixed size and position using "initWithFrame:...". Same seems to be true for Interface Builder, as far as I can tell. Any solution is appreciated no matter if it's done in code or using a custom cell XIB-file.

    Read the article

  • Getting facts from documents

    - by dotnetdev
    Hi, I want to be able to get all the facts from webpages. But these have to be related to coding, and not, for example, about something irrelevant. For example: The Engine renders at a decent speed. May be a fact but is not what I am interested in. If the same article states: A class is a reference type. (This is C#) Then I am interested in that as it is coding related. Has an algorithm like this ever been done? How hard would this be? I'm thinking AI would come into play here. Any advice sought. Thanks

    Read the article

  • Advice regarding Java frameworks [closed]

    - by Mixiul
    I am in the process of creating a website/phone application using JQuery Mobile and PhoneGap. I am hoping to add openID support so users can login in with pre-existing accounts. It will be necessary for me to have a database with a few tables to enable me to implement all the core functionality I desire. I haven't really had much experience with frameworks before, the closest thing I have done to this is create a basic website using php that connected to a MySql database stored on the machine that hosted the apache webserver. The interaction with the database won't be complex. I am required to use a java framework for the backend of my application. My question is which java framework is most suitable (flexible and straight forward to learn)? Any advice you guys can provide is greatly appreciated. Thanks

    Read the article

  • Mercurial: Recommended way of sending a whole repository to someone

    - by Svish
    I have done some programming and I have used Mercurial for source control. I now need to send all of my code to someone else (because they are going to take over). Since all copies of a mercurial repository is a full and real repository my first thought is to first do a clone of my repository without an update and then zipping and emailing that clone. Is this a good way, or is there a better way? For example when using the TortoiseHg Repository Explorer I can right-click on a changeset and under Export there are various options that looks like they could be doing something interesting, but I don't quite understand them or know which one to use.

    Read the article

  • Dynamic View Creation in Iphone?

    - by adusum
    Hi can any one please tell me how to create Dynamic views in iphone. And I want to know like what is difference between custom views and dynamic views in iphone. Acutally i went throught google but i didn't find any proper answer. And I have one more question is like can we create all the views manually in the coding iteslf like the one we create using a Interface bulder and save it as a .nib. how can it be done?can any one please explain me this. Thanks,

    Read the article

  • string update in sqlserver

    - by Thiyaneshwaran S
    Currently i have varchar field. The delimiter is "$P$P$". The delimiter will appear atleast once and atmost twice in the varchar data. Eg. Sample Heading$P$P$Sample description$P$P$Sample conclusion Sample Heading$P$P$Sample Description If the delimiter appears twice, i need to insert a text before the second occurance of the delimiter. Eg: Sample Heading$P$P$Sample DescriptionINSERT TEXT HERE$P$P$Sample Conclusion If the delimiter occurs only once, then i need to insert a text at the end of the field. Eg: Sample Heading$P$P$Sample DescriptionAPPEND TEXT HERE How this can be done in sql query?

    Read the article

  • How to trigger notification code TBN_TOOLBARCHANGE from inside c++ program?

    - by karikari
    Hi. How to trigger TBN_TOOLBARCHANGE from inside my c++ code? Is it the same as writing like this line below? SendMessage(m_hWndToolbar, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); Inside this project's code there is this line inside one the header file: BEGIN_MSG_MAP(CRebarHandler) NOTIFY_CODE_HANDLER(TBN_DROPDOWN, onNotifyDropDown) NOTIFY_CODE_HANDLER(TBN_TOOLBARCHANGE, onNotifyToolbarChange) NOTIFY_CODE_HANDLER(NM_CUSTOMDRAW, onNotifyCustomDraw) NOTIFY_CODE_HANDLER(TBN_ENDADJUST, onNotifyEndAdjust) MESSAGE_HANDLER(WM_SETREDRAW, onSetRedraw) END_MSG_MAP() It has already defined that for each TBN_TOOLBARCHANGE call, it will trigger the function onNotifyToolbarChange. For this example, it is triggered by IE. Inside my code, I need to trigger that particular function. And before that I need to trigger the TBN_TOOLBARCHANGE`. I just want to know how can it be done inside code, for example under a conditional statement.

    Read the article

  • What to do with someone who can only use "the one true language"?

    - by Rob Wells
    G'day, How do you work with someone when they haven't been able to see that there is a range of other languages out there beyond "The One True Path"? I mean someone who hasn't grown up to realise that the modern software professional has a range of tools in his toolbox. Someone who has a well-equipped toolbox and then selects the best tool for the job at hand. The person who's knee jerk reaction is, for example, "We must do this is C++!" "Everything must be done in C++!" What's the best approach for these people? How do you open them up to the fact that "not everything is a nail." cheers,

    Read the article

  • Can I do this in only one query ?

    - by Paté
    Merry christmas everyone, I Know my way around SQL but I'm having a hard time figuring this one out. First here are my tables (examples) User id name friend from //userid to //userid If user 1 is friend with user 10 then you a row with 1,10. User 1 cannot be friend with user 10 if user 10 is not friend with user 1 so you have 1,10 10,1 It may look weird but I need those two rows per relations. Now I'm trying to make a query to select the users that have the most mutual friend with a given user. For example User 1 is friend with user 10,9 and 7 and user 8 is friend with 10,9 and 7 too ,I want to suggest user 1 to invite him (like facebook). I want to get like the 10 first people with the most mutual friend. The output would be like User,NumOfMutualFriends I dont know if that can be done in a single query ? Thanks in advance for any help.

    Read the article

  • Efficient job progress update in web application

    - by Endru6
    Hi, Creating a web application (Django in my case, but I think the question is more general) that is administrating a cluster of workers doing queued jobs, there is a need to track each jobs progress. When I've done it using database UPDATE (PostgreSQL in this case), it severely hits the database performance, because each UPDATE creates a new row in a table, and in my case only vacuuming DB removes obsolete rows. Having 30 jobs running and reporting progress every 1 minute DB may require vacuuming (and it means huge slow downs on a front end side for all the employees working with the system) every 10 days. Because the progress information isn't critical, ie. it doesn't have to be persistent, how would you do the progress updates from jobs without using an overhead database implies? There are 30 worker servers, each doing 1 or 2 jobs simultaneously, 1 front end server which serves a web application to users, and 1 database server.

    Read the article

  • C++ How do you set an array of pointers to null in an initialiser list like way?

    - by boredjoe
    I am aware you cannot use an initialiser list for an array. However I have heard of ways that you can set an array of pointers to NULL in a way that is similar to an initialiser list. I am not certain how this is done. I have heard that a pointer is set to NULL by default, though I do not know if this is guaranteed/ in the C++ standard. I am also not sure if initialising through the new operator compared to normal allocation can make a difference too.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Counting values in data frame subject to conditions

    - by unixsnob
    I have been searching around and I cannot figure out how to sumarise the data I have in my data frame (subject to some ranges). I know that it can be done when applying some combination of daaply/taaply or table but I haven't been able to get the exact result I was expecting. Basically I want to turn this: part_no val1 val2 val3 2 1 2 3 45.3 2 1 3 4 -12.3 3 1 3 4 99.3 3 1 5 2 -3.2 3 1 4 3 -55.3 Into this: part_no val3_between0_50 val3_bw50_100 val3_bw-50_0 val3_bw-100_-50 2 1 0 0 1 0 3 0 1 0 1 1 This is dummy data, I got a lot more rows, but the idea is the same. I just want to count the number of values for a participant that meet certain condition. If anyone could explain it sort of step by step, I would really appreciate it. I saw lots of different little posts around, but none do exactly this and my attempts only got me half way there. Like using table, etc. Thanks!

    Read the article

  • Is it possible to authenticate user manually with oauth2

    - by iixi
    I want to authenticate a user with oauth2 to access google drive. I can get the access token required when using AccountManager to retrieve an account and then get the token with: mgr.blockingGetAuthToken(account, ApiConst.DRIVE_AUTH_SCOPE, true); But I want the user to be able to authenticate by providing username and password instead of using the account added to the phone. Is this possible? EDIT So I have tried to implement the authorization in a WebView. I followed this example. I have extracted the code request parameter but the code used to retrieve the access token seems to be deprecated and not compatible with the packages used by Google Drive SDK. This is the code used to retrieve the access token in the example: AccessTokenResponse accessTokenResponse = new GoogleAuthorizationCodeGrant(new NetHttpTransport(), new JacksonFactory(), OAuth2ClientCredentials.CLIENT_ID, OAuth2ClientCredentials.CLIENT_SECRET, code, OAuth2ClientCredentials.REDIRECT_URI).execute(); Can this be done in some other way or should I just give up?

    Read the article

  • Detecting video playing in browser from a screenshot -- OpenCV

    - by Jon
    I would like to draw a rectangle around a video playing on my screen. For example, I am watching a YouTube video in my browser. I would like to be able to take a screenshot, analyze that screenshot, and then draw a rectangle around where the YouTube video is playing. I have just started looking into how I might be able to to this. I came across OpenCV. I understand that OpenCV covers many computer vision techniques. Would any of them be particularly well suited for this task? Also, is this something that can be done in real time? Finally, is there a technique that would work for both in browser and full screen? Thanks!

    Read the article

  • EntityFramework 4.0: can you return different types depending on data in the database?

    - by user200341
    I have a Media table in the database. I also have an IMedia interface. I have two different media types that implements the same interface: 1) AudioMedia 2) PictureMedia What I wonder here, is if I can use EntityFramework (I'm using an EDMX file but I have my models in a separate library, with automatic code generation turned off), and depending on the data in the database, select what type to get (AutioMedia or PictureMedia). Since they are both implementing the same interface (could be changed to an abstract class if needed I suppose), I'm thinking that somewhere along the way you could specify what class it should be. I should perhaps point out that I have a class that inherits from ObjectContext to access the objects. Perhaps there is something that that can be done?

    Read the article

< Previous Page | 603 604 605 606 607 608 609 610 611 612 613 614  | Next Page >