Search Results

Search found 23427 results on 938 pages for 'christopher done'.

Page 609/938 | < Previous Page | 605 606 607 608 609 610 611 612 613 614 615 616  | Next Page >

  • Shell Prompt Line Wrapping Issue

    - by Rob
    I've done something to break my Bash Shell Prompt in OS X (10.5.7) Terminal. This is the PS1 that I had configured: PS1='\[\e[1;32m\]\h\[\e[0m\]:\[\e[1;34m\]\w\[\e[0m\]\$ ' As far as I can tell I have the color commands escaping correctly. However when I scroll up and down in my command history I often get line wrapping issues if the historic commands wrap onto multiple lines. I simplified my prompts to the following: PS1='\[\e[1m\]\h:\w\$ \[\e[0m\]' PS2='> ' And I still see something like: localhost:~/Library/Application Support/Firefox/Profiles/knpmxpup.Defau lt/extensions/{1A2D0EC4-75F5-4c91-89C4-3656F6E44B68}$ expocd \{1A2D0EC4-7 5F5-4c91-89C4-3656F6E export PS1="\[ \e[1;32m\]\h\[\e[0m\]: cd Library/Appl ication\ Support/ I've also tried \033 instead of \e. I just included PS2 up there for information, I haven't changed that from the install default. If I completely remove the color codes then everything works fine, any ideas?

    Read the article

  • Getting facts from documents

    - by dotnetdev
    Hi, I want to be able to get all the facts from webpages. But these have to be related to coding, and not, for example, about something irrelevant. For example: The Engine renders at a decent speed. May be a fact but is not what I am interested in. If the same article states: A class is a reference type. (This is C#) Then I am interested in that as it is coding related. Has an algorithm like this ever been done? How hard would this be? I'm thinking AI would come into play here. Any advice sought. Thanks

    Read the article

  • Corona SDK - Make a character pass through a platform

    - by Andy Res
    I'm building a game that has a character which should jump up on multiple platforms. The jumping functionality is done, but I would like if the character is just below a platform (static body), when I press the "jump" button, the character should pass through that platform and then sit on it. Right now it collides with the platform, and character cannot jump on it. Do you have any idea how this can be achieved? Right now the platforms are represented by rectangles with "static" body type: local platform = display.newRect( 50, 280, 150, 10 ) platform:setFillColor ( 55, 55, 55) physics.addBody ( platform, "static", {density=1.0, friction=1.0, bounce=0 }) And I was thinking if I could change, or remove the body type of platform when the character collids with it, so he can pass trough platform, but I don't know how to do this, or in general if this will work... maybe there are some built in techniques on how to achieve the effect I want?

    Read the article

  • How to configure IIS7 to Redirect member of An active Directory group to static page

    - by user1759075
    On IIS, we have disabled Anonymous authentication and enabled Windows Authentication What we need is to only allow users who are members of an Active Directory security group to access the Access Point at all. All other users should be directed to a static web page that will give them instructions on how to request access. By adding the security group to the website permissions, and removing the \Users group, we have almost achieved this. Users in the group are allowed through, those not in the group are asked for a (Windows) username and password. Instead of requesting the username and password, we want IIS to redirect them to the static page. Please advise me on how can this be done.

    Read the article

  • Scraping with multiple IP, in java.

    - by Titi Wangsa bin Damhore
    Well basically I have a scraping application. It scrapes around n items per minute. currently i have only one IP. The site i'm scraping allows me 3 connections per IP. I'm thinking about getting another IP. so i'll be able to get 6 connections. in theory i should be able to get n items in 40 seconds, more or less. currently i'm using java (commons-httpcore) to get the job done. I'm not sure if this is java question or an OS question. my machine has IP 1 and IP 2 how do i connect to, say, www.microsoft.com, using IP 1 and using IP2? how can i specify, which ip i want to use to do a connection?

    Read the article

  • Is using a DataSet's column Expression works in background same as manual calculation?

    - by Harikrishna
    I have one datatable which is not bindided and records are coming from the file by parsing it in the datatable dynamically every time. Now there is three columns in the datatable Marks1,Marks2 and FinalMarks. And their types is decimal. Now for making addition of columns Marks1 and Marks2 's records and store it into FinalMarks column,For that what I do is : datatableResult.Columns["FinalMarks"].Expression="Marks1+Marks2"; It's works properly. It can be done in other way also is foreach (DataRow r in datatableResult.Rows) { r["FinalMarks"]=Convert.ToDecimal(r["Marks1"])+Convert.ToDecimal(r["Marks2"]); } Is first approach same as second approach in background means is both approach same or what? EDIT: I want to know that first approach works in background as second approach.

    Read the article

  • Smallest Java Runtime I can legally distribute?

    - by Mark
    My Java SWT desktop application is distributed with it's own Java runtime and I want to make the download size as small as possible. I'd like to remove all the classes I don't use from rt.jar, but this is forbidden according to JDK runtime licence (see the README.html file in the root JDK folder). Since Java is open source, am I allowed to compile my own 'Java' runtime from source which doesn't have this distribution restriction? If so, has anyone done this already? (Or do you just ignore the JDK licence terms?)

    Read the article

  • What is the difference between "render a view" and send the response using the Response's method "sendResponse()"?

    - by Green
    I've asked a question about what is "rendering a view". Got some answers: Rendering a view means showing up a View eg html part to user or browser. and So by rendering a view, the MVC framework has handled the data in the controller and done the backend work in the model, and then sends that data to the View to be output to the user. and render just means to emit. To print. To echo. To write to some source (probably stdout). but don't understand then the difference between rendering a view and using the Response class to send the output to the user using its sendResponse() method. If render a view means to echo the output to the user then why sendResponse() exists and vise versa? sendResponse() exactly sends headers and after headers outputs the body. They solve the same tasks but differently? What is the difference?

    Read the article

  • How can I learn Android?

    - by Daisama
    I am a freshman in college which has been Java programming for over a year. I haven taken a couple of programming courses, both of which were with Java. And I have done web development for several years. So overall, I would't say that I am a complete beginner in programming. Recently, I have developed a strong interest in developing for Android. I read that Android development was with Java and I thought it would making development easier for me. But I was very wrong. Based on reviews from Amazon, I have begun reading "Professional Android Application Development by Meier but everything is going over my head. The Busy Coder's Guide to Android Development seems a bit more for my level but I still want everybody else's opinion. The Google stuff isn't very helpful to me at my level and neither are the tutorials on anddev and such. Any advice for a complete beginner on how to get started? Thanks.

    Read the article

  • Looking to redo a static website

    - by moorecats
    I have been asked to help redo my non-profit website. I would like to make it look better. What would be the best way to do this? I have some technical background and can learn. I have looked at various options such as Joomla, word press and so on but I am not certain on how to create a good UI for it. I have also looked at Ruby and such, which I think may be overkill for a static page such as this. I haven't done any programming etc in a few years, but I figure this may be an opportunity to get back into it.

    Read the article

  • Impressing Potential Employers

    - by superfly123
    Where I am, I can't afford to get certification. I'm definitely not the best programmer, but I do know my junk. I've been writing software in C++ for over 8 years now and have a very good knowledge of the Win32 API. But when applying for jobs, I get rejected every time I send a resume. I've given my resume to recruitment firms and asked them what they think's wrong with it and they said the only thing they could think of is the fact that I don't have certifications to prove that I know my stuff. But in my resume, I explain my previous work and projects, and also note that upon request they can actually see what I've done. Is there anything that you would suggest that might help others to stop ignoring my resumes? Thank you

    Read the article

  • select distinct over specific columns

    - by Midhat
    A query in a system I maintain returns QID AID DATA 1 2 x 1 2 y 5 6 t As per a new requirement, I do not want the (QID, AID)=(1,2) pair to be repeated. We also dont care what value is selected from "data" column. either x or y will do. What I have done is to enclose the original query like this SELECT * FROM (<original query text>) Results group by QID,AID Is there a better way to go about this? The original query uses multiple joins and unions and what not, So I would prefer not to touch it unless its absolutely necesary

    Read the article

  • Developing for Windows 6.5

    - by j-t-s
    Hi All I have just got a new company mobile and would like to begin developing apps for the HTC HD2 Mobile Phone. However, when I downloaded Microsoft Windows Phone Developer Tools, it pretty much said right at the end of installation that "Setup could not install correctly", and I clicked on "more", and it said "Silverlight 4.0 could not install correctly". So, the fact that Windows Phone Dev Tools couldn't install completely was because of this Silverlight 4 that couldn't install! Has anyone had the same problems, if so, how did you resolve this issue (if you did)? And... Is there another way to develop applications for mobile phones running the Windows Operating System other than XNA and Windows Dev Tools? Even better... Could it be done simply using the current Visual Studio Express Edition I already have? Thanks All

    Read the article

  • GWT: how to have different styles for splitters in different SplitLayoutPanels?

    - by user26270
    I know you can change the styles of the splitters with the defaults styles listed in the docs: .gwt-SplitLayoutPanel .gwt-SplitLayoutPanel-HDragger { horizontal dragger } .gwt-SplitLayoutPanel .gwt-SplitLayoutPanel-VDragger { vertical dragger } and we've done that in earlier development. However, now I'm developing new stuff and would like to use a different style for the splitters in a new SplitLayoutPanel. Unfortunately, we haven't or can't split the app into different modules, which might make this easier. I tried creating a new style and applying it to my new SplitLayoutPanel, but it didn't appear to have any effect on the splitters. I thought there might be a method to get a handle on the splitters in order to apply the new style to only them, but I didn't find any such method.

    Read the article

  • WIN32 visual c++

    - by mrbuxley
    I would like to write a simple program in c++. After the program is done i would like to get my answers in form of a graph or picture that would give some certain information if i click on a certain area. i have only written console apllications in c++ before and don't really have a clue where to start with the graphic part of it all. Can I write the first part of the program in console mode and some how run it under the WIN32 later? for ex what will happen to the cout<<"foo"; commands? Is there a simpler approach to do some very basic graphic programming.

    Read the article

  • C++ How do you set an array of pointers to null in an initialiser list like way?

    - by boredjoe
    I am aware you cannot use an initialiser list for an array. However I have heard of ways that you can set an array of pointers to NULL in a way that is similar to an initialiser list. I am not certain how this is done. I have heard that a pointer is set to NULL by default, though I do not know if this is guaranteed/ in the C++ standard. I am also not sure if initialising through the new operator compared to normal allocation can make a difference too.

    Read the article

  • i need to do a view in sql that returns the latest invoice date for each company

    - by dave haughton
    hi, i have a company table that is dbo.companies and has companyId as a column. I also have an invoice table that is dbo.invoices with invoicecompanyId column (which is the same as the companyId on the other table) and it also has a column called invoicedate. What i am mtrying to achieve is a view of each companyid with the corresponding latest invoice date for all the companies i have. i have done the following but i dont know how to filter for the latest invoice, it returns all invoices from all companies and i need latest invoice for all companies SELECT TOP (100) PERCENT 'A' + SUBSTRING('000000', 1, 6 - LEN(CAST(dbo.companies.companyId AS varchar(10)))) + CAST(dbo.companies.companyId AS varchar(10)) AS Client_ID, dbo.invoices.invoiceDate AS S_Inv_Date FROM dbo.invoices INNER JOIN dbo.companies ON dbo.invoices.invoiceCompanyId = dbo.companies.companyId ORDER BY Client_ID can you help please ta

    Read the article

  • In Ruby, how do I make a hash from an array?

    - by Wizzlewott
    I have a simple array: arr = ["apples", "bananas", "coconuts", "watermelons"] I also have a function f that will perform an operation on a single string input and return a value. This operation is very expensive, so I would like to memoize the results in the hash. I know I can make the desired hash with something like this: h = {} arr.each { |a| h[a] = f(a) } What I'd like to do is not have to initialize h, so that I can just write something like this: h = arr.(???) { |a| a => f(a) } Can that be done?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • C# creating a custom user interface

    - by CSharpInquisitor
    Hi, I have a SQL database holding a number of numeric and text values that get updated regularly. The exact number/type/names of these data points can change depending on the source of the database writes. I would like to create a user interface editor, where the user can add database points to the UI and arrange them and format them as they want. If a new point is added to the database they can right click on the UI and say "add this point" and choose from a list of database points. I'm looking for some pointers on where to start on creating this editor application, could something clever be done using XAML to dynamically create std WPF controls at runtime? Thanks in advance for any help, Si

    Read the article

  • How to trigger notification code TBN_TOOLBARCHANGE from inside c++ program?

    - by karikari
    Hi. How to trigger TBN_TOOLBARCHANGE from inside my c++ code? Is it the same as writing like this line below? SendMessage(m_hWndToolbar, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); Inside this project's code there is this line inside one the header file: BEGIN_MSG_MAP(CRebarHandler) NOTIFY_CODE_HANDLER(TBN_DROPDOWN, onNotifyDropDown) NOTIFY_CODE_HANDLER(TBN_TOOLBARCHANGE, onNotifyToolbarChange) NOTIFY_CODE_HANDLER(NM_CUSTOMDRAW, onNotifyCustomDraw) NOTIFY_CODE_HANDLER(TBN_ENDADJUST, onNotifyEndAdjust) MESSAGE_HANDLER(WM_SETREDRAW, onSetRedraw) END_MSG_MAP() It has already defined that for each TBN_TOOLBARCHANGE call, it will trigger the function onNotifyToolbarChange. For this example, it is triggered by IE. Inside my code, I need to trigger that particular function. And before that I need to trigger the TBN_TOOLBARCHANGE`. I just want to know how can it be done inside code, for example under a conditional statement.

    Read the article

  • Sort a DataGridView by DisplayMember

    - by Dave
    Hi, I have a DataGridView that is bound to a DataTable. In this table there are some foreign keys. I am then using the CellFormatting event to get the corresponding text from another database table for each foreign key. I want to sort the DataGridView when the user clicks the header. Automatic sorting works but is not correct as it is Sorting on the ValueMember (ForeignKey ID) and not on the DisplayMember (the text). I tried using the SortCompare event but then I read that it does not work on DataGridViews that use the DataSource property. How can this be done? Thanks

    Read the article

  • PHP memcached: getDelayed & getMulti - how to use?

    - by Industrial
    Hi everybody, I have thought a bit recently about how to use getDelayed and getMulti in a PHP application, and their difference. From reading the documentation about getDelayed: "The method does not wait for response and returns right away. When you are ready to collect the items, call either Memcached::fetch or Memcached::fetchAll." So obviously there's a need to call fetchAll before having the keys available, unlike getMulti. But when is the actual memcached call being done? At fetchAll or when getDelayed is run?

    Read the article

  • User's possibilities on site

    - by Lari13
    I want to build a system on the website, that allows users to do some things depend on their rating. For example I have rule for rating value X: 1 post in 3 days 10 comments in 1 day 20 votes in 2 days for rating value Y, rule may be following: 3 post in 1 day 50 comments in 1 day 30 votes in 1 day Each night I recalculate users' ratings, so I know what each user is able to do. Possibilities don't sum or reset on each rating's recalculation. One more important thing is that admin can fill concrete user's possibilities at any time. What is optimal database (MySQL) structure for desired? I can count what concrete user has done: SELECT COUNT(*) FROM posts WHERE UserID=XXX AND DateOfPost >= 'YYY' SELECT COUNT(*) FROM comments WHERE UserID=XXX AND CommentOfPost >= 'YYY' But how can I do admin filling possibilities in this case?

    Read the article

  • How to insert into data base using multi threading programming [closed]

    - by user1196650
    I am having a method and that method needs to do the following thing: It has to insert records into a database. No insert is done for the same table again. All inserts are into different tables. I need a multi threading logic which inserts the details into db using different threads. I am using oracle db and driver configuration and remaining stuff are perfect. Please help me with an efficient answer. Can anyone could provide me with a skeleton logic of the program.

    Read the article

< Previous Page | 605 606 607 608 609 610 611 612 613 614 615 616  | Next Page >